Specific DNA (deoxyribonucleic acid) fragment for identifying sex of acrossocheilus longifin, identification primer and application

Abstract

The invention discloses a specific DNA fragment for identifying the sex of acrossocheilus longifin, an identification primer and application, the PCR primer is used for PCR amplification reaction and agarose gel electrophoresis detection, and the result shows that an individual with a 271bp specific band is male, and an individual without an amplified band is female. According to the molecular marker, the primer and the identification method for identifying the gender of the acrossocheilus longifin, under the condition that the acrossocheilus longifin does not need to be killed, the gender of the acrossocheilus longifin can be identified by taking fin rays of the acrossocheilus longifin; meanwhile, the sex of the juvenile fish which cannot be distinguished from the appearance can be identified in advance; the method has the advantages of being accurate, simple, rapid, small in damage to fishes and the like, and provides important help for protection of acrossocheilus longifin wild resources and development of the culture industry.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of genetic sex identification of fish, in particular to a specific DNA fragment for sex identification of Acrossocheilus longipinnis, primers and an identification method. BACKGROUND

[0002] Acrossocheilus longipinnis belongs to Cypriniformes, Cyprinidae, Barbinae and Acrossocheilus, and is a rare fish in the Red River basin. It has 5 vertical horizontal bands on the body side, and the last unbranched fin ray and the first branched fin ray are elongated into silk, which has ornamental value and economic value. However, due to the influence of the cascade hydropower development of the Red River, habitat fragmentation and overfishing, the number of its wild population has decreased sharply, and it has been listed as a vulnerable species (VU) and needs protection. Acrossocheilus longipinnis has no obvious secondary sexual characteristics before sexual maturity, and the early development cannot be distinguished between males and females in morphology.

[0003] At present, the traditional method is to raise Acrossocheilus longipinnis to sexual maturity, then squeeze the abdomen, and observe the sperm and egg discharge to identify the male and female. This method is time-consuming and low in efficiency, and is limited by the development stage, which seriously affects the artificial propagation and field population protection of Acrossocheilus longipinnis. Therefore, it is an urgent problem for those skilled in the art to provide a specific DNA fragment for sex identification of Acrossocheilus longipinnis, primers and an identification method. SUMMARY

[0004] The present application provides a specific DNA fragment for sex identification of Acrossocheilus longipinnis, as shown in SEQ ID NO. 3, which is located on the Y chromosome and can specifically identify male Acrossocheilus longipinnis.

[0005] The present application provides a reagent for detecting the specific DNA fragment for sex identification of Acrossocheilus longipinnis.

[0006] The last purpose of the present application is to provide an application of the reagent for detecting the specific DNA fragment for sex identification of Acrossocheilus longipinnis, which includes sex identification or breeding of Acrossocheilus longipinnis.

[0007] In order to achieve the above purpose, the present application adopts the following technical solutions:

[0008] The application constructs a sequencing library by whole genome DNA of male and female Trichogaster trichopterus, performs 2b-RAD sequencing on an Illumina sequencing platform, and selects one male and one female to perform whole genome survey sequencing to obtain a reference sequence.

[0009] The protection scope of the application also includes:

[0010] The reagent for detecting the specific DNA fragment for gender identification of Trichogaster trichopterus is shown as SEQ ID NO. 3.

[0011] The reagent is preferably a primer.

[0012] The reagent is preferably a primer, which is GCY-F: 5'-CTGTTTTCCTATGCTGTGTATCAATTACCA-3' and GCY-R: 5'-TCTTGTCGCTGTCATTCTGTCGCA-3'.

[0013] The application of the reagent for detecting the specific DNA fragment for gender identification of Trichogaster trichopterus in gender identification of Trichogaster trichopterus. The application specifically includes the following steps:

[0014] The genomic DNA of Trichogaster trichopterus is detected by using the reagent, if the reagent detects that the DNA of Trichogaster trichopterus contains the polynucleotide shown in SEQ ID NO. 3, it is determined that the Trichogaster trichopterus is a male; if the polynucleotide shown in SEQ ID NO. 3 is not detected, it is determined that the Trichogaster trichopterus is a female.

[0015] The application of the reagent for detecting the specific DNA fragment for gender identification of Trichogaster trichopterus in the preparation of a gender detection kit for Trichogaster trichopterus.

[0016] The application of the reagent for detecting the specific DNA fragment for gender identification of Trichogaster trichopterus in the breeding of Trichogaster trichopterus.

[0017] Compared with the prior art, the application has the following advantages:

[0018] The application discloses a specific DNA fragment for gender identification of long-finned Hemibarbus, identification primers and application, and gender of the long-finned Hemibarbus can be identified by taking any tissue (preferably fin strip) of the long-finned Hemibarbus without killing the fish; meanwhile, gender of the juvenile fish without mature gonad can be identified in advance. The PCR primer disclosed by the application can be used for identifying genetic gender of the long-finned Hemibarbus by using conventional PCR amplification and agarose electrophoresis, and has the advantages of accuracy, simplicity, rapidness, less damage to the fish and the like, thereby providing help for wild resource protection and development of the long-finned Hemibarbus breeding industry. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 A gel electrophoresis diagram for identifying female and male long-finned Hemibarbus by the application;

[0020] In the formula, M represents DL2000; 1-9 and 19-26 and 35-43 represent male long-finned Hemibarbus samples; and 10-18 and 27-34 represent female long-finned Hemibarbus samples. DETAILED DESCRIPTION

[0021] The technical solutions in the embodiments of the application will be apparently and completely described below with reference to the drawings in the embodiments of the application. Apparently, the described embodiments are only part of the embodiments of the application, rather than all the embodiments of the application. Based on the embodiments in the application, all other embodiments obtained by those skilled in the art without creative work belong to the protection scope of the application. The technical solutions described in the application are conventional solutions in the art, and the reagents or materials are from commercial channels, unless specifically described.

[0022] Embodiment 1

[0023] Obtaining of the specific DNA fragment for gender identification of long-finned Hemibarbus

[0024] Ten male long-finned Hemibarbus and ten female long-finned Hemibarbus are identified by artificial oviposition and dissection observation of gonad in the breeding season, tail fins are cut, and whole genome DNA is extracted. The target genome is cut by BsaXI and SapI, a sequencing library is constructed, 2b-RAD sequencing is performed on an Illumina sequencing platform, and one male and one female are selected for whole genome survey sequencing to obtain a reference sequence. By comparing the tag sequences of the male and female individuals by comparative genomics method, a gender-specific DNA fragment tag sequence is obtained, and corresponding primers are designed at both ends according to the position of the tag sequence in the genome survey for population effectiveness verification, and finally a male-specific DNA tag sequence is obtained, as shown in SEQ ID NO. 3. No homologous sequence is found by comparison with the GenBank database.

[0025] The detection primers designed for the above male-specific DNA tag sequence are as follows:

[0026] GCY-F: 5'-CTGTTTTCCTATGCTGTGTATCAATTACCA-3' (SEQ ID NO. 1)

[0027] GCY-R: 5'-TCTTGTCGCTGTCATTCTGTCGCA-3' (SEQ ID NO. 2)

[0028] Example 2:

[0029] The detection primers of the specific DNA fragment for gender identification of the longfin wrasse are used to identify the gender of the longfin wrasse.

[0030] (1) Extract the genomic DNA of the longfin wrasse to be tested;

[0031] (2) PCR amplification

[0032] DNA polymerase: 2xTSINGKE Master Mix (Blue) (purchased from Beijing Genesee Biotechnology Co., Ltd., Cat. No. TSE004);

[0033] The PCR reaction system is as follows:

[0034]

[0035] The PCR reaction conditions are as follows:

[0036]

[0037]

[0038] (3) Determination method:

[0039] The longfin wrasse is of XY type sex determination, i.e. the male contains Y sequence and the chromosome type is XY; the female does not contain Y chromosome and the sex chromosome is XX. Whether it is male is determined by whether Y can be amplified.

[0040] The above reaction product is subjected to agarose gel electrophoresis, the gel concentration is 1%, the voltage is 220V, and the time is 20 min. The reaction product with only 271 bp specific band is male, and the female has no fragment. The 271 bp specific band DNA fragment amplified is shown in SEQ ID NO. 3, which is as follows:

[0041] CTGTTTTCCTATGCTGTGTATCAATTACCATAATATAATTATAAAGCATTAAATAAAGCATTTTTTTTCTTATTATAATGAAACGTTGCAGGCCTTCGCATGATCTAACAAGGAGCAGTTGTATTTGATTAACTAATGTTAACAAGGTAGGATTCATAAATAGTGTAACAAATGTATTGTTGATGAGAATCAGAAAGAGCTTTATTGCCAGGCATTTGTTTTAGTGACAGAAGCTCCAGAG TGCGACAGAATGACAGCGACAAGA .

[0042] Example 3

[0043] Application of the detection primer of the specific DNA fragment in identifying the gender of the long-finned pygmy sunfish:

[0044] (1) 17 female and 26 male long-finned pygmy sunfish individuals whose genders were confirmed by paraffin section were collected, fin strip tissue samples were collected and stored in anhydrous ethanol, genomic DNA was extracted by using a DNA extraction kit, and was diluted to 50 ng / μl and stored at -20℃ for standby; the collected samples included wild samples.

[0045] (2) The above genomic DNA was amplified by using the method of Example 2 and agarose gel electrophoresis was performed, the DL2000 DNA Marker was composed of 6 DNA fragments with the lengths of 2,000 bp, 1,000 bp, 750 bp, 500 bp, 250 bp and 100 bp.

[0046] The results are as follows:

[0047] The samples were dissected to make paraffin sections to view the gonads, and the genders were determined: 1-9, 19-26 and 35-43 were male long-finned pygmy sunfish samples; 10-18 and 27-34 were female long-finned pygmy sunfish samples.

[0048] The PCR product electrophoresis results are shown in Figure 1 ; the lane numbers in the figure are consistent with the sample numbers.

[0049] Only the 271 bp specific band was male, and no fragment was female; which was consistent with the results of identifying the gonads by dissecting to make paraffin sections. It is shown that the one male-specific primer screened in the application can achieve the purpose of identifying the female and male genders of the long-finned pygmy sunfish.

[0050] The foregoing description of the disclosed embodiments enables a person skilled in the art to make or use the application. Modifications of these embodiments will occur to persons of skill in the art, and that the appended claims are intended to cover all such modifications that do not depart from the true spirit and scope of the application. Therefore, the application is not limited to the embodiments shown but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A specific DNA fragment for sex identification of the longfin ray, wherein the DNA fragment is shown in SEQ ID NO.

3.

2. A reagent for detecting the DNA fragment according to claim 1.

3. The reagent according to claim 2, wherein the reagent is a primer.

4. The reagent according to claim 3, wherein the primers are GCY-F: 5'-CTGTTTTCCTATGCTGTGTATCAATTACCA-3' and GCY-R: 5'-TCTTGTCGCTGTCATTCTGTCGCA-3'.

5. Use of the reagent according to claim 2 in sex identification of longfin ray.

6. The application according to claim 5, wherein the application process comprises: The genomic DNA of the longfin rayfish is tested using a reagent. If the reagent detects that the DNA of the longfin rayfish contains the polynucleotide shown in SEQ ID NO.3, the longfin rayfish is determined to be a male fish; if the polynucleotide shown in SEQ ID NO.3 is not detected, the longfin rayfish is determined to be a female fish.

7. Use of the reagent according to claim 2 in preparing a sex detection kit for longfin bream.

8. Use of the reagent according to claim 2 in breeding of longfin bream.

Images