Preparation method and application of HPV (human papillomavirus) rapid detection reagent

Abstract

The invention provides a preparation method and application of a rapid HPV (human papillomavirus) detection reagent. The method comprises the following steps: 1, preparing a solution A; 2, magnetic stirring; 3, preparing platinum nanoparticles; 4, preparing a solution C; 5, preparing core-shell nanoparticles; and 6, preparing a rapid detection reagent, wherein the rapid detection reagent is used as an RNA trigger signal amplification reaction element in a fluorescent probe system and is applied to HPV vaccine curative effect evaluation. According to the method, RNA extraction and amplification in a complex sample are achieved through a Pt-coated Fe3O4-MOFs-RNA rapid detection reagent, efficient enrichment of low-copy viruses is achieved, meanwhile, a detection fluorescence signal is generated through efficient trans-cleavage activity of Cas13a, the performance of an HPV virus POCT detection technology is improved, the problem that a micro-fluidic chip is lack of liquid flowing power is solved, and the detection accuracy of the HPV virus POCT detection technology is improved. And an innovative idea is provided for application of CRISPR-based analysis in clinical diagnosis.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of virus detection, in particular to a preparation method and application of a HPV virus rapid detection reagent. BACKGROUND

[0002] In epidemiological studies, more than 80% of sexually active people are infected with at least one HPV subtype in their lifetime, and persistent infection with high-risk HPV (such as HPV16 / 18) leads to 84% of cervical cancer and some oropharyngeal cancer, anal cancer and other malignant tumors. Although prophylactic vaccines (such as the nine-valent vaccine) can prevent major high-risk infections, the existing vaccine coverage is insufficient (about 30% on average worldwide) and ineffective for infected individuals, which makes high-efficiency HPV detection technology a core pillar of secondary prevention of cervical cancer. The HPV genome is about 8 kb, including early regulatory regions (E6 / E7 oncogenes) and late structural regions (L1 / L2 capsid proteins), and its carcinogenic mechanism is that E6 degrades p53 by ubiquitination and E7 binds to RB protein to cause cell cycle disorder, which makes E6 / E7 mRNA an ideal detection target. According to the carcinogenic risk, WHO divides HPV into high-risk types (16 / 18 / 31 / 33, etc. 14 types), possible high-risk types (26 / 53 / 66, etc.) and low-risk types (6 / 11, etc.), and it is worth noting that HPV16 alone contributes to more than 50% of cervical cancer cases, and the type distribution varies by region (such as HPV58 accounts for a significantly higher proportion in East Asia than in Europe and the United States), which puts forward a customized demand for the type coverage ability of the detection technology.

[0003] The second-generation hybrid capture 2 (HC2) technology first realized the detection of 13 high-risk types of DNA, with a sensitivity of 95%, but could not distinguish specific types. Real-time fluorescent quantitative PCR (such as Cobas 4800) realizes HPV16 / 18 typing through TaqMan probes, and becomes the clinical gold standard, but faces problems such as primer dimer interference. The CRISPR-Cas system (especially Cas12a / 13a) uses crRNA-guided targeted cleavage to activate the reporter molecule, combined with isothermal amplification (RPA / LAMP), to push the detection limit to 1 copy / μL. The CRISDA technology reported in Science Translational Medicine in 2024 uses cascade signal amplification to complete the synchronous detection of 25 HPV subtypes in 30 minutes. However, the existing detection system still has three contradictions: (1) Sensitivity and specificity balance: Although the colorimetric method enhanced by nanomaterials can realize naked eye reading (such as AuNP aggregation color development), the matrix effect in complex samples (cervical mucus) leads to a 5-8% increase in false positive rate; (2) Conflict between portability and quantitative accuracy: Microfluidic chips reduce the volume to the size of a credit card (such as the centrifugal chip developed by the Peking University team in 2025), but the fluorescence detection module still relies on external optical equipment; (3) Cost and throughput paradox: The cost of CRISPR reagents for a single detection has been reduced to less than $2, but multiple detection (>10plex) requires expensive substrates such as microarrays. The existing HPV virus isothermal detection method mainly relies on RT-RPA and RT-LAMP technology, which has good accuracy and sensitivity, but still faces the problem of not being portable and not easy to apply to POCT.

[0004] Currently, under the condition of prior art, the virus nucleic acid detection technology based on CRISPR-Cas13a system is gradually mature. The CRISPR-Cas13a system belongs to the VI type CRISPR-Cas family, and its core is composed of Cas13a protein and guide crRNA. Unlike traditional DNA-targeting Cas9, Cas13a specifically recognizes single-stranded RNA (ssRNA) targets. After binding to the target viral RNA (such as the ORF1ab gene of SARS-CoV-2 or the E6 / E7 mRNA of HPV) guided by crRNA, it activates its non-specific “collateral cleavage” activity, which can indiscriminately degrade surrounding reporter RNA molecules (such as fluorescently labeled RNA probes). This “one-target triggering multiple signals” cascade amplification effect makes its detection sensitivity reach aM level, which is more than 1000 times higher than qPCR. The breakthroughs of its key technologies include: (1) Normal temperature reaction system construction: Through engineering modification of Cas13a protein (such as LbuCas13a mutant), it realizes stable work in 25-42℃ wide temperature range, and gets rid of the dependence of PCR thermal cycling; (2) Multi-target detection design: Through the design of multi-target crRNA library, the key mutation sites of viral variants (such as the L452R mutation of Omicron BA.5) can be detected simultaneously; (3) Signal conversion innovation: Combined with gold nanoparticle colorimetric method or electrochemical sensor, RNA cleavage is converted into color change or current signal visible to the naked eye. Based on Cas13a, the SHERLOCK technology can complete the detection of throat swab samples within 40 minutes, and the detection rate of samples with Ct value ≤35 reaches 98.7%. Compared with antigen detection (sensitivity 60-80%) and RT-PCR (2-4 hours are needed), it has both rapidity and high accuracy. For the continuous infection monitoring of Epstein-Barr virus (nasopharyngeal carcinoma) and HPV (cervical cancer), Cas13a can directly detect oncogene transcripts (such as HPV16 E6 / E7 mRNA), which is more reflective of cancer risk than DNA detection. The “HPV-CRISPR-Dx” system reported by Science Translational Medicine in 2024 has a positive prediction rate of 92.4% for CIN2+ lesions. The “miSHERLOCK” system developed by Harvard team combines smartphone imaging to realize field detection of Ebola virus; the “CRISPR-MicroBox” microfluidic device developed in China is driven by built-in fuel cells, which is suitable for areas without power grid.

[0005] The breakthroughs in future HPV virus detection technologies will focus on: (1) the development of room temperature stable freeze-dried CRISPR reagents (such as liposome embedding technology) self-powered microfluidic systems (such as friction nanogenerator TENG driven); (2) artificial intelligence assisted image interpretation algorithm (smartphone APP with accuracy > 99%). With the advancement of WHO's '90-70-90' cervical cancer elimination strategy, the fourth generation HPV detection technology with the characteristics of 'precision, universal, intelligent' will become an important tool to achieve global health equity. The breakthrough in this field is not only related to individual life rescue, but also is a test of the transformation ability of molecular diagnostic technology. However, at present, when HPV is used as the target of detection, how to solve the technical bottlenecks such as low pretreatment efficiency caused by complex sample matrix, complicated steps caused by incubation temperature difference of amplification and detection, and limitations of microfluidic chip function and flow dynamics, has become a problem to be solved.

[0006] Therefore, the technical personnel of the present application provide a preparation method and use of a rapid HPV virus detection reagent. SUMMARY

[0007] The purpose of the present application is to provide a preparation method and use of a rapid HPV virus detection reagent. The technical problem to be solved by the present application is: when HPV is used as the target of detection, to solve the technical bottleneck problems such as low pretreatment efficiency caused by complex sample matrix, complicated steps caused by incubation temperature difference of amplification and detection, and to realize fluid self-driving by combining the use of microfluidic chip function and MOFs new self-powered nanometer enzyme reporter probe to complete the rapid detection of HPV virus.

[0008] The design idea of the present application is: (1) primer design and preparation of recognition elements: there are some highly conserved regions in the HPV viral genome, which have highly similar nucleotide sequences in different HPV types. Selecting the complementary RNA sequence of these conserved regions as primers can ensure that the primers can widely recognize multiple HPV types and improve the coverage of detection. Primer design is usually based on bioinformatics analysis, using sequence information in HPV genome database, through comparison and analysis, selecting sequences with high conservation and specificity as primers. The primer is combined with magnetic nanoparticles through chemical modification to form magnetic primer. This combination usually involves the formation of covalent bonds, such as silanization, amination, etc., to ensure the stable combination between the primer and the magnetic nanoparticle. The process of chemical modification needs to accurately control the reaction conditions such as temperature, pH value, reaction time, etc., to ensure the uniformity and efficiency of modification. Magnetic nanoparticles usually choose iron oxide (such as Fe3O4) or its composite materials because they have good magnetic properties and biocompatibility. These nanoparticles can be prepared by hydrothermal synthesis, sol-gel method, etc., and surface modification is carried out to improve their stability and biocompatibility. Surface modification usually includes coating polymers, biomolecules (such as proteins, polysaccharides, etc.) or functional small molecules to improve the dispersibility and biocompatibility of magnetic nanoparticles. (2) Rapid separation of HPV viral RNA in sample: using the responsiveness of magnetic nanoparticles in external magnetic field, the magnetic field is used to capture and separate the magnetic primer-HPV RNA complex in the sample. The principle of magnetic separation is based on the change of magnetic moment of magnetic nanoparticles in magnetic field, which leads to their movement and aggregation in magnetic field. The process of magnetic separation needs to accurately control the strength and direction of magnetic field to ensure the effective capture and separation of magnetic nanoparticles. Magnetic separation technology has the advantages of simple operation, rapid, high efficiency and good repeatability. Compared with traditional separation techniques (such as centrifugation, filtration, etc.), magnetic separation can complete the separation and purification of sample in a shorter time, while reducing the loss of sample. The process of magnetic separation is usually carried out at room temperature, which does not need complex equipment and reagents, reducing the operation cost and complexity. (3) Enzyme-mimetic activity of platinum magnetic nanocatalytic material: platinum nanoparticles have unique surface electronic structure, which can mimic the activity of enzyme. In this application, platinum nanoparticles mimic the activity of peroxidase and oxidase to catalyze the oxidation of TMB and the decomposition of H2O2. The catalytic activity of platinum nanoparticles is closely related to its size, shape, surface structure and electronic properties, which can be adjusted by controlling the synthesis conditions and post-treatment steps. Platinum nanoparticles catalyze the oxidation of colorless TMB to blue oxTMB, which produces obvious color change and is convenient for detection by spectral analysis. The mechanism of TMB oxidation reaction involves electron transfer on the surface of platinum nanoparticles, which oxidizes TMB to oxTMB. During the reaction, the active sites on the surface of platinum nanoparticles interact with TMB molecules, promoting the oxidation of TMB through electron transfer.The platinum nanoparticles catalyze the decomposition of H2O2 to produce oxygen gas, generating bubbles. The mechanism of this reaction involves redox reactions on the surface of platinum nanoparticles, which decompose H2O2 into H2O and O2. During the reaction, active sites on the surface of platinum nanoparticles interact with H2O2 molecules, promoting the decomposition of H2O2 through redox reactions. (4) Application of microfluidic chip: Microfluidic chip is a miniaturized platform that integrates fluid channels and reaction chambers, which can realize the automation of sample processing and detection. In this application, microfluidic chip is used to realize the rapid detection of HPV RNA. The design of microfluidic chip needs to consider the flow characteristics of fluid, reaction kinetics and detection sensitivity, etc. factors, in order to ensure the accuracy and reliability of detection. Using the characteristics of platinum nanoparticles catalyzing H2O2 to generate bubbles, the reagent flow in the microfluidic chip can be automatically driven, realizing the automation of sample processing and detection. Bubble-driven fluid control uses the generation and release of bubbles to control the flow of fluid, realizing the precise delivery and mixing of reagents. Bubble-driven fluid control has the advantages of simple operation, good controllability and fast response speed, which is suitable for fluid control in microfluidic chip.

[0009] The integration of magnetic separation technology and catalytic activity of platinum magnetic nanoparticles into a detection system realizes the rapid, sensitive and specific detection of HPV viral RNA. This integration takes advantage of the high efficiency of magnetic separation and the catalytic activity of platinum nanoparticles, improving the sensitivity and accuracy of detection. The integration process needs to accurately control the conditions and parameters of each step to ensure the accuracy and reliability of detection. By detecting the color change of oxTMB, the concentration of HPV viral RNA in the sample can be quantitatively analyzed. The principle of spectral analysis is based on the absorption characteristics of oxTMB at a specific wavelength, and the concentration of oxTMB is quantitatively analyzed by measuring the absorbance, so as to calculate the concentration of HPV RNA. The process of spectral analysis needs to accurately control the conditions such as light source, detector and sample cell, in order to ensure the accuracy and repeatability of detection.

[0010] A biosensor based on platinum magnetic nanocatalytic material is developed for HPV virus detection. The complementary RNA sequence of the most conservative region in the HPV virus genome is selected as a pretreatment material to modify the primer to prepare a recognition element. The rapid separation of HPV virus RNA in the sample can be realized by magnetic separation. In addition, the pretreatment material can simulate the activity of "peroxidase-like" and "oxidase-like" enzymes to catalyze the oxidation of colorless 3,3',5,5'-tetramethylbenzidine (TMB) to blue oxTMB, and can also catalyze the generation of bubbles to drive the flow of reagents in the microfluidic chip. The prepared CRISPR-Cas13a HPV virus rapid detection reagent can solve the technical bottleneck problems such as low pretreatment efficiency caused by complex sample matrix, complicated steps caused by differences in amplification and detection incubation temperature, and explore the use of the trans-cleavage activity of the CRISPR-Cas13a system combined with the Pt-doped MOFs new self-powered nanoscale enzyme reporter probe to realize the self-driving of the fluid, which can be used as a signal amplification and output signal mechanism, combined with the use of a microfluidic disc chip for rapid detection of HPV virus E6 / E7 mRNA, and through a smart phone to realize on-site rapid and instant detection, which can provide technical support for the diversion management of HPV positive patients and the risk assessment of precancerous lesions.

[0011] To achieve the above object, the technical scheme of the present application is: A preparation method of a HPV virus rapid detection reagent, the method comprising the following steps: 1. Preparation of A solution: 50 mg of polyvinylpyrrolidone, 30 mg of ascorbic acid, and 200 mg of potassium bromide are placed in a container containing 10 mL of ultrapure water under normal temperature and pressure, and ultrasonicated until completely dissolved to prepare an A solution for standby use; 2. Magnetic stirring: the A solution prepared in step 1 is preheated for 10 min under magnetic stirring at a normal pressure temperature of 80℃, then 2 mL of a 5 mg / mL sodium tetrachloroplatinate aqueous solution is added to the preheated A solution, and the reaction is carried out for 6 hours under the condition of maintaining the temperature at 80℃ to prepare a B solution, which is cooled to room temperature for standby use; 3. Preparation of platinum nanoparticles: the B solution prepared in step 2 is washed with a mixed solution of ethanol / ultrapure water at a volume ratio of 1:1 for at least 3-5 times, and after washing, the solid is collected by centrifugation to obtain platinum nanoparticles, which are resuspended in 10 mL of ethanol for standby use; 4. Preparation of C solution: 50 mg of polyvinylpyrrolidone and 20 mg of ascorbic acid are dissolved in 10 mL of ethylene glycol at normal temperature and pressure, and the ethylene glycol containing polyvinylpyrrolidone and ascorbic acid is transferred to a three-necked flask, which is stirred in an oil bath at 220℃ for 30 min, and the platinum nanoparticles prepared in step 3 are added to the three-necked flask, which is reacted at a temperature of 220℃ for 30 min. 5. Preparation of core-shell nanoparticles: 5 mL of iron chloride solution is rapidly injected into the reaction solution of step 4, and the reaction is continued at a temperature of 220°C under normal pressure for 30 min. After the reaction is completed, the product is collected by centrifugation after washing with isopropanol and ultrapure water for 3-5 times, and Pt@Fe3O4-MOFs core-shell nanoparticles are obtained. The Pt@Fe3O4-MOFs core-shell nanoparticles are resuspended in 10 mL of ultrapure water, ultrasonically dispersed, and resuspended in 5 mL of PBS buffer after centrifugation. 6. Preparation of rapid detection reagent: Under normal temperature and pressure, E6 mRNA nucleic acid complementary sequence and E7 mRNA nucleic acid complementary sequence are added to the PBS buffer obtained in step 5, and incubated at 37°C for 60 min. After the reaction is completed, the product is washed with ultrapure water for 3-5 times, and the volume is adjusted to 1 mL to obtain Pt@Fe3O4-MOFs-RNA rapid detection reagent. Then, it is stored at 4°C for standby.

[0012] The sequences of E6 mRNA nucleic acid complementary sequence and E7 mRNA nucleic acid complementary sequence involved in step 6 of the method are as follows: The sequence of E6 mRNA-RAA-F is cttataggtggctatcagtaatgttt; and the sequence of E6 mRNA-RAA-R is ctttagccgccttgacgaactaaa. The sequence of E7 mRNA-RAA-F is attataggtggctatcagtaatgt; and the sequence of E7 mRNA-RAA-R is aaacataaaactttagccaagcc.

[0013] The sequence of E6 mRNA-crRNA is uaauuucuaaaaaaaaugguagaaaau; and the sequence of E7 mRNA-crRNA is uaauuuacuacuucaguugaa.

[0014] The rapid detection reagent is used as an RNA trigger signal amplification reaction element in a fluorescence probe system and in HPV vaccine efficacy evaluation.

[0015] RAA primer design and synthesis: according to the designed crRNA binding site, the Premier software is used for the design of RAA primer, so that the RAA amplification region contains the screened crRNA binding site, and the non-specific amplification is reduced as much as possible. The synthesized plasmid powder containing E6 mRNA gene sequence is centrifuged, and the recommended amount of ultrapure water is added to the tube wall label, and fully mixed, so that the concentration is 10 mu M. According to the RAA nucleic acid amplification kit instructions, 5 mu L of plasmid solution is taken as the amplification substrate, and 20 mu L of A buffer, 1.5 mu L of RAA-F (10 mu M), 1.5 mu L of RAA-R (10 mu M), 12.5 mu L of BeyoPureTM Ultrapure Water and dry powder are added to the detection tube, and 4.5 mu L of B buffer is added to the detection tube cover, and the tube cover is covered, fully mixed, and placed in a 37 degree C incubator for 40 minutes. Take 100 mu L of amplified product, and verify the feasibility and whether there is non-specific amplification according to the fluorescence intensity recovery degree.

[0016] Compared with the prior art, the positive effects of the present application are: 1. The method realizes RNA extraction in complex samples by Pt@Fe3O4-MOFs-RNA rapid detection reagent, and realizes efficient enrichment of low copy viruses through amplification, and simultaneously utilizes the high efficient transcleavage activity of Cas13a to generate a detection fluorescence signal; 2. The method utilizes the self-powered catalytic driving fluid detection strategy of the Pt@Fe3O4-MOFs-RNA rapid detection reagent, realizes good linear response in the range of 10-1000 copies / mu L, and can detect as low as 10 copies of HPV virus, completely covering the minimum lower limit of the virus infection dose; 3. The method utilizes the transcleavage activity of the CRISPR-Cas13a system in combination with the Pt-doped MOFs novel self-powered nanoenzyme reporter probe to realize fluid self-driving, which can be used as a signal amplification and output signal mechanism, in combination with the microfluidic disc chip for rapid detection of HPV virus E6 / E7 mRNA, and through a smart phone, on-site rapid and instant detection is realized, which provides technical support for the shunt management of HPV positive patients and the risk assessment of precancerous lesions; 4. The method improves the performance of the HPV virus POCT detection technology, solves the problem of lack of liquid flow power of the microfluidic chip, and provides an innovative idea for the application of CRISPR-based analysis in clinical diagnosis; 5. The method selects the complementary RNA sequence of the most conservative region in the HPV virus genome as the Pt@Fe3O4-MOFs-RNA rapid detection reagent modified primer to prepare a recognition element, and the rapid separation of HPV virus RNA in the sample can be realized through magnetic separation; 6、The method is used to solve the problem that the microfluidic device is not portable and is not easy to apply to POCT; 7、When the method is used for virus detection, the operation difficulty of the detection personnel can be reduced, the consumption of virus detection consumables is reduced, medical resources can be saved, and the method can be widely used in medical research institutions and hospitals. BRIEF DESCRIPTION OF DRAWINGS

[0017] In order to more clearly illustrate the technical in the embodiments of the application required to use the drawings are briefly introduced. The drawings in the following description is only exemplary, for those skilled in the art, without the premise of paying creative labor, can also be obtained according to the drawings provided by other implementation drawings.

[0018] The structure, proportion, size, etc. of the drawings shown in the specification, are only used to cooperate with the content disclosed in the specification, for the technicians in the art to understand and read, and are not used to limit the implementation conditions of the application, any modification of structure, change of proportion relationship or adjustment of size, without affecting the effect and purpose of the technology can produce and can achieve, should still fall within the scope of the technology disclosed in the application can cover.

[0019] Figure 1 , the scanning electron microscope image (SEM) of Pt@Fe3O4-MOFs-RNA prepared for the embodiment of the application, the image in the figure shows that the material is a polygonal structure, and the particle size is 456±2.1 nm; Figure 2 , the Fourier infrared result graph of the embodiment of the application, which confirms that the material core-shell structure and amino modification are successful, and the "core-shell" structure is spherical; Figure 3 , the self-powered catalytic kinetics analysis graph of the embodiment of the application, the relationship curve between the initial reaction rate (ν) and the concentration of TMB and H2O2 is drawn, and a typical Michaelis-Menten curve can be obtained. By converting the curve into the corresponding double-reciprocal graph, the Km value and Kcat are calculated; the a graph in the figure shows the influence of TMB (3,3',5,5'-tetramethylbenzidine) concentration on the reaction rate, the horizontal axis is the concentration of TMB (unit: mM), and the vertical axis is the reaction rate (unit: V×10 −4 M min −1), the graph shows that as the concentration of TMB increases, the reaction rate gradually increases, but the increase gradually decreases, showing a saturation trend, which indicates that TMB is one of the substrates of the reaction, and there is a certain saturation point; c shows the effect of TMB concentration on the reciprocal of the reaction rate, the horizontal axis is the concentration of TMB (unit: mM), and the vertical axis is the reciprocal of the reaction rate (unit: 1 / V*104min M-1), the graph shows that as the TMB concentration increases, the reciprocal of the reaction rate increases linearly, which indicates that the reaction rate is inversely proportional to the TMB concentration, which is consistent with the characteristics of Michaelis kinetics; b shows the effect of hydrogen peroxide (H2O2) concentration on the reaction rate, the horizontal axis is the concentration of hydrogen peroxide (unit: mM), and the vertical axis is the reaction rate (unit: V*10 −4 M min −1 ), the graph shows that as the concentration of hydrogen peroxide increases, the reaction rate gradually increases, but the increase gradually decreases, showing a saturation trend, which indicates that hydrogen peroxide is one of the substrates of the reaction, and there is a certain saturation point; d shows the effect of hydrogen peroxide concentration on the reciprocal of the reaction rate, the horizontal axis is the concentration of hydrogen peroxide (unit: mM), and the vertical axis is the reciprocal of the reaction rate (unit: 1 / V*10 4 min M −1 ), the graph shows that as the hydrogen peroxide concentration increases, the reciprocal of the reaction rate increases linearly, which indicates that the reaction rate is inversely proportional to the hydrogen peroxide concentration, which is consistent with the characteristics of Michaelis kinetics; Figure 4 , a, c in the graph are the performance verification and evaluation figures of the detection system of the embodiment of the application, the fluorescence intensity values collected by the mobile phone colorimeter, the standard curve, and the repeatability of the performance, the detection ability of CRISPR on 500 nM FQ reporter gene is evaluated, the FQ concentration in the CRISPR system is 500 nM (LOD=0.51 nM), and it has good linear correlation (R2=0.9945) in the range of 0.1-10 nM, and the fluorescence intensity is proportional to the concentration in the concentration range; b, d are the PCR detection sample results and the standard curve of the detection system of the embodiment of the application, figure b shows that as the number of cycles increases, the fluorescence intensity gradually increases, and the fluorescence intensity of different concentrations increases at different rates, indicating the cumulative effect of the fluorescence signal, and the fluorescence intensity increases faster at high concentrations, figure d shows that there is a linear relationship between 1 / Ct and lg(nM), the slope is 4.27, the intercept is 37.88, and the correlation coefficient R2 is 0.9982, the fitting degree is very high, and the fluorescence intensity is inversely proportional to the concentration. DETAILED DESCRIPTION

[0020] The technical solutions of the present application are further described clearly and completely below in combination with embodiments and drawings. The specific embodiments below are only used to further illustrate the present application and cannot be understood as limiting the protection scope of the present application. Those skilled in the art can make some non-essential improvements and adjustments to the present application according to the above application content.

[0021] 1. Reagents: The main reagents are shown in Table 1, and the experimental water is prepared by a Millipore-Milli-Q10 system.

[0022] Table 1 Reagents and materials

[0023] 2. Instruments: The main instruments and equipment are shown in Table 2.

[0024] Table 2 Instruments and equipment used in preparation

[0025] 3. Nucleic acid sequences: The nucleic acid sequences are synthesized by Huada Gene, wherein the single-stranded DNA is purified by PAGE, and Table 3 shows the nucleic acid sequences.

[0026] Table 3 Nucleic acid sequences

[0027] The sequences marked with “F” in the table are forward primers, and the sequences marked with “R” are reverse primers.

[0028] 4. Design and synthesis of RAA primers: According to the designed crRNA binding site, the Premier software is used to design the RAA primers, so that the RAA amplification region contains the screened crRNA binding site, and the non-specific amplification is reduced as much as possible. The synthesized plasmid dry powder containing the E6 mRNA gene sequence is centrifuged, and the recommended amount of ultrapure water is added to the tube wall label, and mixed thoroughly, so that the concentration is 10 μM. According to the RAA nucleic acid amplification kit instructions, 5 μL of plasmid solution is taken as the amplification substrate, and 20 μL of A Buffer, 1.5 μL of RAA-F (10 μM), 1.5 μL of RAA-R (10 μM), 12.5 μL of BeyoPure™ Ultrapure Water and dry powder are added to the detection tube, and 4.5 μL of B Buffer is added to the detection tube cover, and the tube cover is covered, mixed thoroughly, and placed in a 37°C incubator for 40 min. Take 100 μL of the amplified product, and verify the feasibility and whether there is non-specific amplification according to the fluorescence intensity recovery degree.

[0029] 5、Microfluidic chip preparation: According to the requirements of HPV virus rapid detection reagent, the microfluidic chip will be entrusted to the professional manufacturer for processing and manufacturing. The resin microfluidic chip realizes the integrated manufacturing of complex microchannel structure through light curing molding, and the core steps can be divided into three stages of design, 3D printing and post-processing. (1) Use CAD (computer aided design), SolidWorks (SolidWorks) to design a three-dimensional model, accurately plan the microchannel (50 pm), reaction cavity and inlet and outlet structure, and export it as STL or OBJ format. (2) Before 3D printing, select high-precision photosensitive resin material, set the layer thickness to 20 pm and the exposure time to 30 s through the slicing software Cura. Pour the resin into the resin tank of the DLP (digital light processing) or SLA (stereolithography) printer, and solidify the resin layer by layer with ultraviolet light source. The solidification depth of each layer needs to be strictly controlled to avoid channel blockage. Use in-situ transfer light solidification technology (IsT-VPP) to print a 10 pm precision microchannel top layer, or realize the suspended structure through double platform alternating exposure. After 3D printing, immediately remove the surface residual resin with isopropyl alcohol or special cleaning agent, and use ultraviolet light for secondary curing to ensure the structure strength. (3) 3D printing post-processing: 1) Mechanical polishing, use 800-2000 mesh sandpaper to polish the surface of the channel; 2) Plasma treatment to improve the hydrophilicity of the PDMS (polydimethylsiloxane) bonding surface; 3) Use UVLED (ultraviolet light emitting diode) curing machine (365-405 nm wavelength) to complete the chip packaging within 10 seconds to avoid thermal deformation. Finally, verify the channel sealing property through fluid test, and use deionized water and gas to alternate flushing to prevent residue. EMBODIMENT

[0030] 1、Preparation of rapid detection reagent (1) Preparation of A solution: Under normal temperature and pressure, 50 mg of polyvinylpyrrolidone, 30 mg of ascorbic acid, and 200 mg of potassium bromide were placed in a container containing 10 mL of ultrapure water, and ultrasonicated until completely dissolved to prepare A solution for standby; (2) Magnetic stirring: The A solution prepared in step 1 was preheated at 80°C under magnetic stirring at normal pressure for 10 min, then 2 mL of 5 mg / mL sodium tetrachloroplatinate aqueous solution was added to the preheated A solution, and the reaction was carried out at 80°C for 6 hours to prepare B solution, which was cooled to room temperature for standby; (3) Preparation of platinum nanoparticles: The B solution prepared in step 2 was washed with a mixture of ethanol / ultrapure water at a volume ratio of 1:1 for at least 3-5 times, and the solid was collected by centrifugation after washing to obtain platinum nanoparticles, which were resuspended in 10 mL of ethanol for standby; (4) Preparation of C solution: 50 mg of polyvinylpyrrolidone and 20 mg of ascorbic acid were dissolved in 10 mL of ethylene glycol at room temperature and normal pressure, and the ethylene glycol in which polyvinylpyrrolidone and ascorbic acid were dissolved was transferred into a three-necked flask, stirred in an oil bath at a temperature of 220°C for 30 min, and then the platinum nanoparticles prepared in step 3 were added into the three-necked flask, and reacted at a temperature of 220°C for 30 min; (5) Preparation of core-shell nanoparticles: 5 mL of iron chloride solution was rapidly injected into the reaction solution of step 4, and the reaction was continuously carried out at a temperature of 220°C and normal pressure for 30 min. After the reaction was completed, isopropyl alcohol and ultrapure water were used for washing 3-5 times, respectively. After washing was completed, the product was collected by centrifugation to obtain Pt@Fe3O4-MOFs core-shell nanoparticles, and the obtained Pt@Fe3O4-MOFs core-shell nanoparticles were resuspended in 10 mL of ultrapure water, ultrasonically dispersed, and then resuspended to 5 mL of PBS buffer after centrifugation; (6) Preparation of rapid detection reagent: under room temperature and normal pressure, E6 mRNA nucleic acid complementary sequence and E7 mRNA nucleic acid complementary sequence were added into the PBS buffer after constant volume of step 5, and incubated at 37°C for 60 min. After the reaction was completed, ultrapure water was used for washing 3-5 times, and constant volume was made to 1 mL to obtain Pt@Fe3O4-MOFs-RNA rapid detection reagent, which was then stored at a temperature of 4°C for standby use.

[0031] 2. Evaluation of self-powered dynamic activity and steady-state kinetic study At room temperature (~25°C), the catalytic properties of peroxidase-like and driving bubble experiment were verified by using 3,3',5,5'-tetramethylbenzidine (TMB) and hydrogen peroxide (H2O2) as substrates in acetic acid buffer solution with pH value of 4.5. After adding Pt@Fe3O4-MOFs-RNA reagent into the mixed solution containing TMB (10 mM), H2O2 (0.1 M) and buffer, the reaction solution was incubated for 20 min, and the absorbance of 450-800 nm was measured on a UV-1800 spectrophotometer. The steady-state kinetic measurement of peroxidase-like was carried out by monitoring the absorbance change at 650 nm. The curve slope at each initial point of reaction was calculated. The initial reaction rate (ν) was calculated by the formula: ν=SlopeInitial / (εoxTMB-652nm×Ɩ), where εoxTMB-652nm is the molar absorption coefficient of oxidized TMB (oxTMB) at 650 nm (3.9×104M−1cm−1). The relationship between ν and TMB concentration was fitted by nonlinear regression of Michaelis-Menten equation.

[0032] 3. Evaluation of detection range, sensitivity and reproducibility of sensing system Take 50 μL of the above E6 / E7 mRNA, 500 nM Pt@Fe3O4-MOFs-RNA rapid detection reagent into a 1.5 mL sterile EP tube, centrifuge at 10000 rpm for 5 min. After discarding the supernatant, add 50 μL ultrapure water, mix 50 μL sample, and then add to the microfluidic chip sample port. Add amplification reagent, stand for 10 seconds, then place on the heating module, incubate at 40°C for 40 min, then add 150 nM Cas13a protein, 100 nM E6 / E7 crRNA, 500 nM nucleic acid FQ probe, stand for 20 seconds, then place on the heating module, incubate at 37°C for 50 min, and then detect.

[0033] 4. Sample collection and detection Use a vaginal swab to collect secretions, and use a special brush head to rotate and scrape cervical transformation zone cells, and store in cell preservation solution or RNA stabilizer to ensure the effectiveness of the collected sample. Take 50 μL of the above sample into a 1.5 mL sterile EP tube, centrifuge at 10000 rpm for 5 min. After discarding the supernatant, add 50 μL ultrapure water, place on a 95°C heating module for 5 min, then continue centrifugation at 12000 rpm for 10 min, which completes the mRNA extraction. Then add 500 nM Pt@Fe3O4-MOFs-RNA rapid detection reagent, centrifuge at 10000 rpm, dilute by 100 times, and then magnetically separate for 20 min. Discard the supernatant and resuspend the precipitate in 50 μL ultrapure water. Mix 50 μL sample, then add to the microfluidic chip sample port. Add amplification reagent, stand for 10 seconds, then place on the heating module, incubate at 40°C for 40 min, then add detection system reagent, stand for 20 seconds, then place on the heating module, incubate at 37°C for 50 min. Finally, take a photo with a mobile phone, and read the detection result by RGB colorimeter.

[0034] Example detection results 1. Material characterization As Figures 1-3As shown, SEM images showed that the material was in a polygonal structure with a particle size of 456 ± 2.1 nm. Fourier infrared spectroscopy also confirmed the successful core-shell structure and amino modification of the material, and the "core-shell" structure formed was spherical. By plotting the initial reaction rate (v) versus the concentration of TMB and H2O2, a typical Michaelis-Menten curve can be obtained. By converting the curve into the corresponding double-reciprocal plot, the Km value and Kcat were calculated, which were similar to HRP. The same concentration of HRP as the material was selected for Michaelis-Menten kinetic analysis. Increasing the concentration of HRP did not significantly change Vmax and Km, but Kcat = Vmax / [E] was significantly reduced. Therefore, the concentration of HRP is crucial for Michaelis-Menten kinetic analysis.

[0035] 2. Performance analysis of detection system As shown in Figure 4 The present application studied the detection limit of the Cas13a system, and trans-cleavage was observed in the target concentration range of 0.005 nM to 10 nM, as well as the blank control. Considering that the concentration of the reporter gene significantly affects the trans-cleavage rate of the Cas protein, the present application evaluated the detection ability of CRISPR at 500 nM FQ reporter gene CRISPR system with FQ concentration of 500 nM (LOD = 0.51 nM), which had good linear correlation (R2= 0.9945) in the range of 0.1-10 nM. At the same time, the samples were also verified by PCR detection method, thereby proving the accuracy of the experiment.

[0036] 3. Sample detection results In order to evaluate the practical clinical diagnostic application of the proposed sensor, the present application added 3 concentrations (0.1, 1 and 10 nM) of HPV virus to the vaginal swab and cervical transformation zone cell samples, and determined their E6 mRNA detection content. As shown in Table 4, the recovery rates were 96.27-106.30%, 95.70-106.11%, and the relative standard deviation (RSD) was less than 2.2% and 1.3%.

[0037] Table 4

[0038] All features disclosed in this specification, and / or all combinations and permutations of the disclosed features, can be combined in any rational manner, unless such features and / or step are mutually exclusive. Any of the features disclosed in this specification, unless specifically stated otherwise, can be replaced by alternative features serving the same, equivalent or similar purpose, unless such substitution would result in a departure from the spirit and / or scope of the present application. That is, not only can each feature be replaced by an alternative feature, but a feature itself can also be one of a range of equivalent or similar features, unless specifically stated otherwise.

[0039] The above description is only some non-limited embodiments of the present application, and a large number of embodiments can be derived, and some modified embodiments can be made by those skilled in the art without departing from the inventive concept and without making creative labor, which all belong to the protection scope of the present application.

Claims

1. A method for preparing a rapid HPV virus detection reagent, characterized in that: The method comprises the following steps: (1) Prepare Solution A: Place 50 mg of polyvinyl pyrrolidone, 30 mg of ascorbic acid, and 200 mg of potassium bromide in a container containing 10 mL of ultrapure water at room temperature and pressure, and ultrasonicate until completely dissolved to prepare Solution A for later use; (2) Magnetic stirring: preheat the solution A prepared in step (1) at 80°C under normal pressure for 10 min under magnetic stirring, then add 2 mL of a 5 mg / mL sodium tetrachloroplatinate aqueous solution to the preheated solution A, and keep the temperature at 80°C for 6 hours to prepare a solution B, which is then cooled to room temperature for later use; (3) Preparation of platinum nanoparticles: Wash the solution B prepared in step (2) with a mixed solution of ethanol / ultrapure water at a volume ratio of 1:1 for at least 3-5 times. After washing, collect the solid by centrifugation to obtain platinum nanoparticles, and resuspend the obtained platinum nanoparticles in 10 mL of ethanol for later use; (4) Prepare solution C: dissolve 50 mg of polyvinyl pyrrolidone and 20 mg of ascorbic acid in 10 mL of ethylene glycol at room temperature and pressure. Transfer the ethylene glycol dissolved in polyvinyl pyrrolidone and ascorbic acid into a three-necked flask and stir in an oil bath at 220°C for 30 min. Then, add the platinum nanoparticles prepared in step (3) into the three-necked flask and react at 220°C for 30 min. (5) Preparation of core-shell nanoparticles: 5 mL of ferric chloride solution was rapidly injected into the reaction solution of step (4), and the reaction was continued for 30 min at normal pressure and temperature of 220 ° C. After the reaction was completed, the product was washed with isopropanol and ultrapure water for 3-5 times respectively. After washing, the product was collected by centrifugation to obtain Pt@Fe3O4-MOFs core-shell nanoparticles, and the obtained Pt@Fe3O4-MOFs core-shell nanoparticles were resuspended in 10 mL of ultrapure water, ultrasonically dispersed, and then centrifuged and resuspended to a volume of 5 mL of PBS buffer; (6) Preparation of rapid detection reagent: Add E6mRNA nucleic acid complementary sequence and E7mRNA nucleic acid complementary sequence to the fixed volume PBS buffer obtained in step (5) at room temperature and pressure, incubate at 37°C for 60 minutes, wash with ultrapure water 3-5 times after the reaction is completed, and fix the volume to 1 mL to obtain Pt@Fe3O4-MOFs-RNA rapid detection reagent, which is then stored at 4°C for future use.

2. The method for preparing the HPV virus rapid detection reagent according to claim 1, characterized in that: The sequences of the E6 mRNA nucleic acid complementary sequence and the E7 mRNA nucleic acid complementary sequence involved in step (6) of the method are as follows: The sequence of E6 mRNA-RAA-F is cttataggtggctatcagtaatgttt; the sequence of E6 mRNA-RAA-R is ctttagccgccttgacgaactaaa; The sequence of E7 mRNA-RAA-F is attataggtggctatcagtaatgt; the sequence of E7 mRNA-RAA-R is aaacataaaactttagccaagcc.

3. The method for preparing the HPV virus rapid detection reagent according to claim 1 or 2, characterized in that: In the method, the sequence of E6 mRNA-crRNA is uaauuucuaaaaaaaaaugguagaaaau; the sequence of E7 mRNA-crRNA is uaauuuacuacuucaguugaa.

4. The use of the HPV virus rapid detection reagent according to claim 1, characterized in that: The rapid detection reagent is used as an RNA-triggered signal amplification reaction element in a fluorescent probe system and in the evaluation of HPV vaccine efficacy.

Images