A functional balloon, its preparation method and application

Abstract

This invention relates to the field of balloon technology, and discloses a functional balloon, its preparation method, and its application. The surface of the functional balloon is loaded with polyglutamic acid, which is linked to a DNA hydrogel via amide bonds. A nucleotide sequence is linked to the DNA hydrogel and thrombin. The balloon obtained by this invention can achieve hemostasis and reduce bleeding symptoms without vascular occlusion.

Description

Technical Field

[0001] This invention relates to the field of balloon technology, and more particularly to a functional balloon, its preparation method, and its application. Background Technology

[0002] Coronary artery rupture is a serious complication of interventional procedures, requiring rapid hemostasis to prevent cardiac tamponade. Cardiac tamponade occurs when blood or fluid accumulates in the pericardial cavity, compressing the heart and restricting its diastolic function, severely impairing its pumping ability. This condition can lead to hypotension, cardiac tamponade, or even cardiac arrest, and without timely intervention, it can rapidly result in shock or death.

[0003] In existing technologies, once a tubular artery perforation occurs, a compliant balloon is typically placed proximal to the perforation site under pressure to limit extravasation. Covered stents are also used for hemostasis. However, it has been found that existing hemostasis techniques (such as covered stents) have problems such as difficulty in positioning and permanent occlusion; while traditional balloons mainly rely on physical occlusion, which cannot meet the hemostasis requirements, and bleeding symptoms may still occur when the balloon is removed. Summary of the Invention

[0004] To address the aforementioned technical problems, this invention provides a functional balloon, its preparation method, and its application. The balloon obtained by this invention can achieve hemostasis and reduce bleeding symptoms without vascular occlusion.

[0005] The present invention provides a functional balloon, the surface of which is loaded with polyglutamic acid, the polyglutamic acid being linked to a DNA hydrogel via amide bonds, and a nucleotide sequence being linked to the DNA hydrogel and thrombin.

[0006] Furthermore, the carboxyl group of the polyglutamic acid forms an amide bond with the amino group of the DNA hydrogel.

[0007] Furthermore, the nucleotide sequence is shown in SEQ ID NO.1.

[0008] Furthermore, the method for preparing the DNA hydrogel includes:

[0009] Step S11: Obtain repeating long chain RCA-products-1 complementary to DNA template 1;

[0010] Step S12: Obtain repeating long chain RCA-products-2 complementary to DNA template 2;

[0011] Step S13: Mix RCA-products-1 and RCA-products-2 at a mass ratio of 1:1, shake, and obtain DNA hydrogel.

[0012] In this invention, by controlling the mass concentration and addition volume of the solutions containing RCA-products-1 and RCA-products-2, it is sufficient to ensure that the mass ratio of RCA-products-1 to RCA-products-2 is 1:1 after mixing.

[0013] Furthermore, the oscillation time is 25-35 minutes.

[0014] Furthermore, the method for preparing the DNA template 1 includes: obtaining the DNA template 1 by PCR using the DNA linear template 1 and the DNA primer 1.

[0015] Furthermore, the method for preparing the DNA template 2 includes: obtaining the DNA template 2 by PCR using a linear DNA template 2 and DNA primer 2.

[0016] Furthermore, the sequence of the DNA linear template 1 is shown in SEQ ID NO.2.

[0017] Furthermore, the sequence of the DNA primer 1 is shown in SEQ ID NO.3.

[0018] Furthermore, the sequence of the DNA linear template 2 is shown in SEQ ID NO.4.

[0019] Furthermore, the sequence of the DNA primer 2 is shown in SEQ ID NO.5.

[0020] Furthermore, the DNA hydrogel has a pore size of 50 μm-200 μm.

[0021] The present invention also provides a method for preparing the functional balloon, the method comprising:

[0022] Step S1: Prepare DNA hydrogel;

[0023] Step S2: Connect the DNA hydrogel obtained in step S1 to a capsule loaded with polyglutamic acid to obtain an intermediate product;

[0024] Step S3: Connect the DNA hydrogel and thrombin in the intermediate product by nucleotide sequence to obtain a functional balloon.

[0025] Furthermore, the specific method for obtaining the repeating long chain RCA-products-1 complementary to DNA template 1 includes:

[0026] The solution containing DNA template 1, phi29 DNA polymerase, phi29 DNA polymerase reaction buffer, bovine serum albumin (BSA), a solution containing deoxyribonucleoside triphosphates (dNTPs), sodium chloride solution, and sterile water were mixed and shaken to obtain repeating long chain RCA-products-1 complementary to DNA template 1.

[0027] Furthermore, the method for preparing the solution containing DNA template 1 includes: dispersing DNA template 1 in sterile water.

[0028] Furthermore, the molar concentration of the solution containing DNA template 1 is 30 nmol / L-100 nmol / L.

[0029] Furthermore, the concentration of the phi29 DNA polymerase is 0.1 U / L-0.3 U / L.

[0030] Furthermore, the concentration of the phi29 DNA polymerase reaction buffer is ×10.

[0031] Furthermore, the concentration of the bovine serum albumin is 200 × 200.

[0032] Furthermore, the method for preparing the solution containing deoxyribonucleoside triphosphate includes: dispersing deoxyribonucleoside triphosphate in sterile water.

[0033] Furthermore, the molar concentration of the solution containing deoxyribonucleoside triphosphate is 0.5 mmol / L to 1 mmol / L.

[0034] Furthermore, the method for preparing the sodium chloride solution includes: dispersing sodium chloride in sterile water.

[0035] Furthermore, the molar concentration of the sodium chloride solution is 40 mmol / L-80 mmol / L.

[0036] Furthermore, by volume, the ratio of the solution containing DNA template 1, phi29 DNA polymerase, phi29 DNA polymerase reaction buffer, bovine serum albumin, solution containing deoxyribonucleoside triphosphate, and sodium chloride solution is 20:3:10:1:10:10.

[0037] Furthermore, the sterile water is added to a final volume of 500 μL.

[0038] Furthermore, in the method for preparing RCA-products-1, the oscillation conditions are oscillation at a speed of 200 rpm to 450 rpm for 5 h to 20 h.

[0039] Furthermore, the specific method for obtaining the repeating long chain RCA-products-2 complementary to DNA template 2 includes:

[0040] The solution containing DNA template 2, phi29 DNA polymerase, phi29 DNA polymerase reaction buffer, bovine serum albumin, a solution containing deoxyribonucleoside triphosphate, sodium chloride solution, and sterile water were mixed and shaken to obtain repeating long-chain RCA-products-2 complementary to DNA template 2.

[0041] Furthermore, the method for preparing the solution containing DNA template 2 is as follows: dispersing DNA template 2 in sterile water.

[0042] Furthermore, the concentration of the solution containing DNA template 2 is 30 nmol / L-100 nmol / L.

[0043] Furthermore, by volume, the ratio of the solution containing DNA template 2, phi29 DNA polymerase, phi29 DNA polymerase reaction buffer, bovine serum albumin, solution containing deoxyribonucleoside triphosphate, and sodium chloride solution is 20:3:10:1:10:10.

[0044] Those skilled in the art should understand that the method for obtaining repeating long chains complementary to DNA templates is conventional. The specific method for obtaining repeating long chains RCA-products-2 is the same as that for obtaining repeating long chains RCA-products-1, with the only difference being the template added.

[0045] Furthermore, the preparation method of the DNA template 1 includes: mixing a solution containing a concentration of 10 μmol / L of linear DNA template 1 and a solution containing a concentration of 10 μmol / L of DNA primer 1 at a volume ratio of 1:1, heating to 95°C and reacting for 2 minutes, cooling to 20°C at a rate of -0.5°C / 30s after the reaction, then adding 1~6U of T4 DNA ligase and reacting at 25°C for 12 hours.

[0046] Furthermore, the method for preparing the solution containing the DNA linear template 1 includes: dispersing the DNA linear template 1 in sterile water.

[0047] Furthermore, the method for preparing the solution containing DNA primer 1 includes: dispersing DNA primer 1 in sterile water.

[0048] Furthermore, the method for preparing the DNA template 2 includes: mixing a solution containing the linear DNA template 2 and a solution containing the DNA primer 2 at a volume ratio of 1:1, heating to 95°C and reacting for 2 minutes, cooling to 20°C at a rate of -0.5°C / 30s after the reaction, adding 1~6U of T4 DNA ligase and reacting at 25°C for 12 hours.

[0049] Furthermore, in step S2, the specific method for obtaining the connection between the DNA hydrogel and the polyglutamic acid-loaded capsule in step S1 includes:

[0050] Carbodiimide and N-hydroxysuccinimide were added to a PBS buffer solution containing polyglutamic acid to activate the carboxyl group of polyglutamic acid. After activation, DNA hydrogel was added, and the reaction was carried out. The capsule was then immersed in the reaction solution and dried at room temperature to achieve the linkage between the DNA hydrogel and polyglutamic acid in the intermediate product.

[0051] Furthermore, in the PBS buffer solution containing polyglutamic acid, the mass concentration of polyglutamic acid is 10%.

[0052] Furthermore, by mass, the ratio of the polyglutamic acid, carbodiimide, N-hydroxysuccinimide, and DNA hydrogel is 100:5:2:100.

[0053] Furthermore, the activation time is 25-35 minutes.

[0054] Those skilled in the art should understand that, in order to achieve full activation of the carboxyl groups of polyglutamic acid, stirring can be performed during activation, and the stirring speed can be adjusted by those skilled in the art according to the actual situation.

[0055] Furthermore, the reaction time is 25-35 minutes, and the pH value of the reaction is 4.7-6.

[0056] Those skilled in the art should understand that, in order to achieve a full reaction, stirring may be performed during the reaction, and the stirring speed may be adjusted by those skilled in the art according to the actual situation.

[0057] Furthermore, the soaking time is 50-70 seconds.

[0058] Furthermore, in step S3, the specific method for linking the DNA hydrogel and thrombin in the intermediate product via nucleotide sequences includes:

[0059] A solution containing the nucleotide sequence was added to the intermediate product, and a single room temperature reaction was performed. Thrombin was then added, and a second room temperature reaction was performed to obtain a functional balloon.

[0060] Furthermore, the method for preparing the solution containing the nucleotide sequence includes dispersing the nucleotide sequence in sterile water.

[0061] Furthermore, the time for the single room temperature reaction is 25-35 minutes.

[0062] Those skilled in the art should understand that, during a single room temperature reaction, shaking can be used to promote a complete reaction.

[0063] Furthermore, the ratio of the intermediate product to the nucleotide sequence is 500:1 by mass.

[0064] Furthermore, the duration of the secondary room temperature reaction is 35-45 minutes.

[0065] Those skilled in the art should understand that, during the secondary room temperature reaction, shaking can be used to promote a complete reaction.

[0066] Furthermore, the ratio of the intermediate product to thrombin is 200:1 by mass.

[0067] The present invention also provides the application of the aforementioned functional balloon in hemostasis of coronary artery rupture.

[0068] The embodiments of the present invention have the following technical effects:

[0069] 1. Firstly, the functional balloon in this invention can simultaneously achieve physical occlusion and hemostasis. The balloon provides physical occlusion, while the thrombin on the balloon acts on the bleeding point to stop the bleeding. To achieve precise application of thrombin to the bleeding point, this invention links the thrombin to a DNA hydrogel via a DNA sequence. When the balloon reaches the bleeding point, the DNA sequence breaks, releasing the thrombin to act on the bleeding point. Furthermore, when the balloon is inflated, it enhances the adhesion between the DNA hydrogel and the bleeding point, further reducing bleeding. After removing the balloon, physical hemostasis is achieved. The DNA hydrogel is biocompatible and can be absorbed later, thus ultimately restoring patency to the blocked blood vessel.

[0070] 2. In this invention, in order to achieve precise release of thrombin, given the working environment of the balloon of this invention, there is local inflammation MMP-2 at the bleeding point. The DNA sequence of this invention is broken under the induction of MMP-2, thereby avoiding premature release of thrombin.

[0071] 3. In this invention, polyglutamic acid is loaded on the surface of the capsule, and the polyglutamic acid is chemically covalently coupled to the DNA hydrogel through amide bonds, thereby further preventing the DNA hydrogel from falling off. Attached Figure Description

[0072] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0073] Figure 1 This is an electron microscope image of the DNA hydrogel provided in Example 1 of the present invention;

[0074] Figure 2 This is a color Doppler ultrasound device with a functional balloon placed inside a blood vessel, prepared according to Embodiment 1 of the present invention. Figure 1 ;

[0075] Figure 3 This is a color Doppler ultrasound device with a functional balloon placed inside a blood vessel, prepared according to Embodiment 1 of the present invention. Figure 2 ;

[0076] Figure 4 It is a color Doppler ultrasound of the blood vessels. Figure 1 ;

[0077] Figure 5 It is a color Doppler ultrasound of the blood vessels. Figure 2 . Detailed Implementation

[0078] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of this invention, and not all of them. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0079] In a first aspect, some embodiments of the present invention provide a functional balloon, the surface of which is loaded with polyglutamic acid, the polyglutamic acid being linked to a DNA hydrogel via amide bonds, and a nucleotide sequence linking the DNA hydrogel and thrombin.

[0080] In some embodiments, the carboxyl group of the polyglutamic acid forms an amide bond with the amino group of the DNA hydrogel.

[0081] In some embodiments, the nucleotide sequence is as shown in SEQ ID NO.1.

[0082] In some embodiments, SEQ ID NO.1 is: CCCAATCCCAATCCCAATCCCTAACGATCGATCGATGGTTGGTGTGGTTGG.

[0083] In some embodiments, the method for preparing the DNA hydrogel includes:

[0084] Step S11: Obtain repeating long chain RCA-products-1 complementary to DNA template 1;

[0085] Step S12: Obtain repeating long chain RCA-products-2 complementary to DNA template 2;

[0086] Step S13: Mix RCA-products-1 and RCA-products-2 at a mass ratio of 1:1, shake, and obtain DNA hydrogel.

[0087] In this invention, by controlling the mass concentration and addition volume of the solutions containing RCA-products-1 and RCA-products-2, it is sufficient to ensure that the mass ratio of RCA-products-1 to RCA-products-2 is 1:1 after mixing.

[0088] In some embodiments, the oscillation time is 25-35 minutes.

[0089] In some embodiments, the preparation method of the DNA template 1 includes: obtaining the DNA template 1 by PCR using a linear DNA template 1 and DNA primer 1.

[0090] In some embodiments, the preparation method of the DNA template 2 includes: obtaining the DNA template 2 by PCR using a linear DNA template 2 and DNA primer 2.

[0091] In some embodiments, the sequence of the DNA linear template 1 is shown in SEQ ID NO.2.

[0092] SEQ ID NO.2 is: TTTTCCCAATCCCAATCCCAATCCCTAACGATCTTTTGTAGGAACATCAAACGACAGCCAG.

[0093] In some embodiments, the sequence of the DNA primer 1 is shown in SEQ ID NO.3.

[0094] SEQ ID NO.3 is: H2N-TAACCCAAAACTGGCTGTCGTT-3'.

[0095] In some embodiments, the sequence of the DNA linear template 2 is shown in SEQ ID NO.4.

[0096] SEQ ID NO.4 is: CTGGCTTGTCGTTTGATGTTCCTACATCGTTTT.

[0097] In some embodiments, the sequence of the DNA primer 2 is shown in SEQ ID NO. 5.

[0098] SEQ ID NO.5 is: H2N-GACAGCCAGAAAACGAT-3'.

[0099] In some embodiments, the pore size of the DNA hydrogel is 50 μm-200 μm.

[0100] In this invention, the degradation rate of DNA hydrogel can be controlled by controlling the pore size of the DNA hydrogel.

[0101] Secondly, some embodiments of the present invention also provide a method for preparing the functional balloon, the method comprising:

[0102] Step S1: Prepare DNA hydrogel;

[0103] Step S2: Connect the DNA hydrogel obtained in step S1 to a capsule loaded with polyglutamic acid to obtain an intermediate product;

[0104] Step S3: Connect the DNA hydrogel and thrombin by nucleotide sequence to obtain a functional balloon.

[0105] In some embodiments, the method for preparing the DNA hydrogel includes:

[0106] Step S11: Obtain repeating long chain RCA-products-1 complementary to DNA template 1;

[0107] Step S12: Obtain repeating long chain RCA-products-2 complementary to DNA template 2;

[0108] Step S13: Mix RCA-products-1 and RCA-products-2 at a mass ratio of 1:1, shake, and obtain DNA hydrogel.

[0109] In some embodiments, the oscillation time is 25-35 minutes.

[0110] In some embodiments, the preparation method of the DNA template 1 includes: obtaining the DNA template 1 by PCR using a linear DNA template 1 and DNA primer 1.

[0111] In some embodiments, the preparation method of the DNA template 2 includes: obtaining the DNA template 2 by PCR using a linear DNA template 2 and DNA primer 2.

[0112] In some embodiments, the sequence of the DNA linear template 1 is shown in SEQ ID NO.2.

[0113] In some embodiments, the sequence of the DNA primer 1 is shown in SEQ ID NO.3.

[0114] In some embodiments, the sequence of the DNA linear template 2 is shown in SEQ ID NO.4.

[0115] In some embodiments, the sequence of the DNA primer 2 is shown in SEQ ID NO. 5.

[0116] In some embodiments, the specific method for obtaining the repeating long chain RCA-products-1 complementary to DNA template 1 includes:

[0117] The solution containing DNA template 1, phi29 DNA polymerase, phi29 DNA polymerase reaction buffer, bovine serum albumin, a solution containing deoxyribonucleoside triphosphate, sodium chloride solution, and sterile water were mixed and shaken to obtain a repeating long chain RCA-products-1 complementary to DNA template 1.

[0118] In some embodiments, the method for preparing the solution containing DNA template 1 involves dispersing DNA template 1 in sterile water.

[0119] In some embodiments, the molar concentration of the solution containing DNA template 1 is 30 nmol / L to 100 nmol / L.

[0120] In some embodiments, the concentration of the phi29 DNA polymerase is 0.1 U / L-0.3 U / L.

[0121] In some embodiments, the concentration of the phi29 DNA polymerase reaction buffer is ×10.

[0122] In some embodiments, the concentration of bovine serum albumin is 200 × 200.

[0123] In some embodiments, the method for preparing the solution containing deoxyribonucleoside triphosphate includes: dispersing deoxyribonucleoside triphosphate in sterile water.

[0124] In some embodiments, the molar concentration of the solution containing deoxyribonucleoside triphosphate is 0.5 mmol / L to 1 mmol / L.

[0125] In some embodiments, the method for preparing the sodium chloride solution includes dispersing sodium chloride in sterile water.

[0126] In some embodiments, the molar concentration of the sodium chloride solution is 40 mmol / L to 80 mmol / L.

[0127] In some embodiments, the ratio of the solution containing DNA template 1, phi29 DNA polymerase, phi29 DNA polymerase reaction buffer, bovine serum albumin, solution containing deoxyribonucleoside triphosphate, and sodium chloride solution, by volume, is 20:3:10:1:10:10.

[0128] In some embodiments, the sterile water is added to a final volume of 500 μL.

[0129] In some embodiments, in the method for preparing RCA-products-1, the oscillation conditions are oscillation at a speed of 200 rpm to 450 rpm for 5 h to 20 h.

[0130] In some embodiments, the specific method for obtaining the repeating long chain RCA-products-2 complementary to DNA template 2 includes:

[0131] The solution containing DNA template 2, phi29 DNA polymerase, phi29 DNA polymerase reaction buffer, bovine serum albumin, a solution containing deoxyribonucleoside triphosphate, sodium chloride solution, and sterile water were mixed and shaken to obtain repeating long-chain RCA-products-2 complementary to DNA template 2.

[0132] In some embodiments, the method for preparing the solution containing DNA template 2 involves dispersing the circular DNA template 2 in sterile water.

[0133] In some embodiments, the concentration of the solution containing DNA template 2 is 30 nmol / L to 100 nmol / L.

[0134] In some embodiments, the ratio of the solution containing DNA template 2, phi29 DNA polymerase, phi29 DNA polymerase reaction buffer, bovine serum albumin, solution containing deoxyribonucleoside triphosphate, and sodium chloride solution, by volume, is 20:3:10:1:10:10.

[0135] In some embodiments, the preparation method of the DNA template 1 is as follows: a solution containing a concentration of 10 μmol / L of linear DNA template 1 and a solution containing a concentration of 10 μmol / L of DNA primer 1 are mixed at a volume ratio of 1:1, heated to 95°C and reacted for 2 minutes. After the reaction is completed, the temperature is lowered to 20°C at a rate of -0.5°C / 30s. Then, 1~6U of T4 DNA ligase is added and the reaction is carried out at 25°C for 12 hours.

[0136] In some embodiments, the method for preparing the solution containing the DNA linear template 1 involves dispersing the DNA linear template 1 in sterile water.

[0137] In some embodiments, the method for preparing the solution containing DNA primer 1 involves dispersing DNA primer 1 in sterile water.

[0138] In some embodiments, the preparation method of the DNA template 2 is as follows: a solution containing the linear DNA template 2 and a solution containing the DNA primer 2 are mixed at a volume ratio of 1:1, heated to 95°C for 2 minutes, and after the reaction is completed, the temperature is lowered to 20°C at a rate of -0.5°C / 30s. Then, 1~6U of T4 DNA ligase is added and the mixture is reacted at 25°C for 12 hours.

[0139] In some embodiments, the specific method for obtaining the connection between the DNA hydrogel and the polyglutamic acid-loaded capsule in step S1 in step S2 includes:

[0140] Carbodiimide and N-hydroxysuccinimide were added to a PBS buffer solution containing polyglutamic acid to activate the carboxyl group of polyglutamic acid. After activation, DNA hydrogel was added, and the reaction was carried out. The capsule was then immersed in the reaction solution and dried at room temperature to achieve the linkage between the DNA hydrogel and polyglutamic acid in the intermediate product.

[0141] In some embodiments, the polyglutamic acid in the PBS buffer solution containing polyglutamic acid has a mass concentration of 10%.

[0142] In some embodiments, the ratio of polyglutamic acid, carbodiimide, N-hydroxysuccinimide, and DNA hydrogel by mass is 100:5:2:100.

[0143] In some embodiments, the activation time is 25-35 minutes.

[0144] In some embodiments, the reaction time is 25-35 minutes and the pH value of the reaction is 4.7-6.

[0145] In some embodiments, the soaking time is 50s-70s.

[0146] In some embodiments, the specific method for linking the DNA hydrogel and thrombin via nucleotide sequences in step S3 includes:

[0147] A solution containing the nucleotide sequence was added to the intermediate product, and a single room temperature reaction was performed. Thrombin was then added, and a second room temperature reaction was performed to obtain a functional balloon.

[0148] In some embodiments, the thrombin used is Agkistrodon agkistrodon hemocoagulase, which is a type of thrombin obtained by isolating and purifying Agkistrodon agkistrodon venom. It can dissolve the titanium A in the A subunit to produce soluble fibrin polymers, thereby playing a hemostatic role.

[0149] In some embodiments, the time for the single room temperature reaction is 25 min to 35 min.

[0150] In some embodiments, the ratio of the intermediate product to the nucleotide sequence is 500:1 by mass.

[0151] In some embodiments, the secondary room temperature reaction time is 35 min to 45 min.

[0152] In some embodiments, the ratio of the intermediate product to thrombin is 200:1 by mass.

[0153] Thirdly, some embodiments of the present invention also provide the application of the functional balloon in hemostasis of coronary artery rupture.

[0154] The following description, in conjunction with specific embodiments and comparative examples, illustrates the points:

[0155] Example 1:

[0156] (1) The method for synthesizing DNA hydrogels is as follows:

[0157] A solution containing DNA template 1 at a final concentration of 65 nmol / L, 0.2 U / L PHI 29 DNA polymerase, 10× PHI 29 DNA polymerase reaction buffer, 200× BSA, 1 mmol / L dNTPs solution, 60 mmol / L NaCl solution, and sterile water were mixed. The ratio of DNA template 1 solution, PHI 29 DNA polymerase, PHI 29 DNA polymerase reaction buffer, bovine serum albumin, solution containing deoxyribonucleoside triphosphate, and sodium chloride solution was 20:3:10:1:10:10 by volume. The mixture was shaken at 300 rpm for 10 h to obtain repeating long-chain RCA-products-1 complementary to DNA template 1.

[0158] The same method was used to obtain repeating long chains of RCA-products-2 that are complementary to DNA template 2.

[0159] Preparation method of DNA template 1: A solution containing 10 μmol / L linear DNA template 1 and a solution containing 10 μmol / L DNA primer 1 are mixed at a volume ratio of 1:1. The mixture is heated to 95℃ and reacted for 2 minutes. After the reaction, the temperature is lowered to 20℃ at a rate of -0.5℃ / 30s. Then, 1~6U of T4 DNA ligase is added and the mixture is reacted at 25℃ for 12 hours.

[0160] The same method was used to obtain DNA template 2.

[0161] The sequence of DNA linear template 1 is shown in SEQ ID NO.2.

[0162] SEQ ID NO.2 is: TTTTCCCAATCCCAATCCCAATCCCTAACGATCTTTTGTAGGAACATCAAACGACAGCCAG.

[0163] The sequence of DNA primer 1 is shown in SEQ ID NO.3.

[0164] SEQ ID NO.3 is: H2N-TAACCCAAAACTGGCTGTCGTT-3'.

[0165] The sequence of DNA linear template 2 is shown in SEQ ID NO.4.

[0166] SEQ ID NO.4 is: CTGGCTTGTCGTTTGATGTTCCTACATCGTTTT.

[0167] The sequence of DNA primer 2 is shown in SEQ ID NO.5.

[0168] SEQ ID NO.5 is: H2N-GACAGCCAGAAAACGAT-3'.

[0169] Mix RCA-products-1 and RCA-products-2 at a mass ratio of 1:1 and shake for 30 minutes to obtain a DNA hydrogel. By controlling the mass concentration and addition volume of the solutions containing RCA-products-1 and RCA-products-2, it is sufficient to ensure that the mass ratio of RCA-products-1 to RCA-products-2 is 1:1 after mixing.

[0170] The electron micrograph of the DNA hydrogel prepared in this embodiment is shown below. Figure 1 As shown.

[0171] (2) Add carbodiimide and N-hydroxysuccinimide to the PBS buffer solution containing polyglutamic acid to activate the carboxyl group of polyglutamic acid for 30 min. After activation, add DNA hydrogel and react for 30 min. The pH value of the reaction is 4.7-6. Soak the capsule (60 s) in the solution after the reaction and dry at room temperature to achieve the connection between DNA hydrogel and polyglutamic acid in the intermediate product.

[0172] In the PBS buffer solution containing polyglutamic acid, the mass concentration of polyglutamic acid is 10%.

[0173] The ratio of polyglutamic acid, carbodiimide, N-hydroxysuccinimide and DNA hydrogel by mass is 100:5:2:100.

[0174] (3) Add the solution containing the nucleotide sequence to the intermediate product and shake for 30 min at room temperature; add the aggrophytes hemocoagulase and shake for 40 min at room temperature, then air dry at room temperature to obtain the functional balloon.

[0175] The ratio of intermediate product to nucleotide sequence by mass is 500:1; the ratio of intermediate product to thrombin by mass is 200:1.

[0176] The nucleotide sequence is shown in SEQ ID NO.1. SEQ ID NO.1 is: CCCAATCCCAATCCCAATCCCTAACGATCGATCGATGGTTGGTGTGGTTGG.

[0177] Application examples

[0178] After the functional balloon prepared in Example 1 was placed in the blood vessels of a rabbit, the intravascular ultrasound image is as follows. Figure 2 As shown; for easier observation, see [reference needed]. Figure 3 As shown, the part highlighted in red is the functional balloon prepared in Example 1; the color Doppler ultrasound image of the rabbit's blood vessels is shown below. Figure 4 As shown, for clarity, please refer to the following details. Figure 5 As shown, the blue line represents the inner lining of the blood vessel, and the yellow line represents the inner diameter of the blood vessel; combined with... Figures 2-5 It can be seen that the coating of the functional balloon prepared in this application is mainly bonded to the rupture site.

[0179] The release rate of thrombin on the surface of the functional balloon prepared in this embodiment was detected by the chromogenic substrate method. Specifically, the thrombin-specific chromogenic substrate Tos-Gly-Pro-Arg-pNA was used. Thrombin catalyzes the hydrolysis of the substrate to generate a yellow product (pNA). The concentration of active thrombin was quantitatively detected by absorbance (405 nm) to obtain the thrombin release rate.

[0180] In the experimental group, the thrombin release rate of the functional balloon prepared in Example 1 was measured under the MMP-2 inflammatory microenvironment to detect its specific release; in the control group, the thrombin release rate of the functional balloon prepared in Example 1 was measured under physiological conditions (without MMP-2) to detect its non-specific release. The treatment conditions for the experimental and control groups are shown in Table 1.

[0181] Table 1

[0182]

[0183] The thrombin release rates of the experimental group and the control group are shown in Table 2:

[0184] Table 2

[0185]

[0186] As can be seen from the data in Table 2, the thrombin in the functional balloon prepared in Example 1 of this application is stable under physiological conditions and has a low release rate; in the MMP-2 inflammatory microenvironment, the thrombin release rate is ≥80%, thus proving that the thrombin on the functional balloon prepared in this application can act on the bleeding point and play a hemostatic role.

[0187] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the technical solutions of the embodiments of the present invention.

Claims

1. A functional balloon, characterized in that, The surface of the functional balloon is loaded with polyglutamic acid, which is linked to the DNA hydrogel by amide bonds, and the nucleotide sequence is linked to the DNA hydrogel and thrombin. The method for loading polyglutamic acid onto the surface of the functional balloon is as follows: Carbodiimide and N-hydroxysuccinimide were added to a PBS buffer solution containing polyglutamic acid to activate the carboxyl group of polyglutamic acid. After activation, DNA hydrogel was added and reacted. The capsule was immersed in the reaction solution and dried at room temperature to achieve the connection between DNA hydrogel and polyglutamic acid, thus obtaining the intermediate product. The activation time is 25-35 minutes; the reaction time is 25-35 minutes, and the pH value of the reaction is 4.7-6; the soaking time is 50-70 seconds. The method for linking nucleotide sequences to DNA hydrogels and thrombin is as follows: A solution containing the nucleotide sequence was added to the intermediate product and reacted once at room temperature; thrombin was added and reacted twice at room temperature to obtain a functional balloon. The time for the single room temperature reaction is 25 min-35 min; The ratio of the intermediate product to the nucleotide sequence is 500:1 by mass. The time for the secondary room temperature reaction is 35 min-45 min; The ratio of the intermediate product to thrombin is 200:1 by mass.

2. The functional balloon according to claim 1, characterized in that, The carboxyl group of the polyglutamic acid forms an amide bond with the amino group of the DNA hydrogel; the pore size of the DNA hydrogel is 50 μm-200 μm. The nucleotide sequence is shown in SEQ ID NO.

1.

3. The functional balloon according to claim 1, characterized in that, The method for preparing the DNA hydrogel includes: Step S11: Obtain repeating long chain RCA-products-1 complementary to DNA template 1; Step S12: Obtain repeating long chain RCA-products-2 complementary to DNA template 2; Step S13: Mix RCA-products-1 and RCA-products-2 at a mass ratio of 1:1, shake, and obtain DNA hydrogel; The method for preparing the DNA template 1 includes: obtaining the DNA template 1 by PCR using a linear DNA template 1 and DNA primer 1; The method for preparing the DNA template 2 includes: obtaining the DNA template 2 by PCR using a linear DNA template 2 and DNA primer 2; The sequence of the DNA linear template 1 is shown in SEQ ID NO.2; The sequence of DNA primer 1 is shown in SEQ ID NO.3; The sequence of the DNA linear template 2 is shown in SEQ ID NO.4; The sequence of the DNA primer 2 is shown in SEQ ID NO.

5.

4. The method for preparing the functional balloon according to any one of claims 1-3, characterized in that, The preparation method includes: Step S1: Prepare DNA hydrogel; Step S2: Connect the DNA hydrogel obtained in step S1 to a capsule loaded with polyglutamic acid to obtain an intermediate product; Step S3: Connect the DNA hydrogel and thrombin in the intermediate product by nucleotide sequence to obtain a functional balloon.

5. The preparation method according to claim 4, characterized in that, In step S2, the specific method for connecting the DNA hydrogel obtained in step S1 to the polyglutamic acid-loaded capsule includes: Carbodiimide and N-hydroxysuccinimide were added to a PBS buffer solution containing polyglutamic acid to activate the carboxyl group of polyglutamic acid. After activation, DNA hydrogel was added, and the reaction was carried out. The capsule was then immersed in the reaction solution and dried at room temperature to achieve the linkage between the DNA hydrogel and polyglutamic acid in the intermediate product.

6. The preparation method according to claim 5, characterized in that, The PBS buffer solution containing polyglutamic acid has a polyglutamic acid mass concentration of 10%. The ratio of polyglutamic acid, carbodiimide, N-hydroxysuccinimide and DNA hydrogel by mass is 100:5:2:

100.

7. The use of the functional balloon according to any one of claims 1-3 or the functional balloon obtained by the preparation method of any one of claims 4-6 in hemostasis of coronary artery rupture.

Images