CD22 binding molecules and uses thereof

Abstract

The invention relates to CD22 binding molecules and uses thereof. The invention provides a CD22 binding molecule which comprises an anti-CD22 nano antibody or an antigen binding fragment thereof, and a complementary determining region (CDR) of the anti-CD22 nano antibody comprises CDR1, CDR2 and CDR3.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological immunotherapy, in particular to anti-CD22 binding molecules and uses thereof. BACKGROUND

[0002] CD22, also known as Siglec-2, is widely present in normal B cells and B cell malignancies. CD22 is mainly expressed in mature B cells and is a cell surface adhesion molecule with regulatory effects on B cell activation, which helps to control the sensitivity of B cells to antigen response. Tedder TF team further proved that CD22 expression is specific in B cells and is subject to developmental regulation in mice and humans. As shown in Figure 1, CD22 can be expressed in pro-B cells and pre-B cells, and gradually transferred to the cell surface, but the expression level is low; it is highly expressed in IgM+ and IgD+ mature B cells, also highly expressed in follicular B cells, mantle cells, marginal zone B cells, but eventually down-regulated in CD27+ memory B cells, especially in plasma cells. In addition, recent studies have found that CD22 expression has also been observed in mouse intestinal acid granulocytes, which is a new expression pattern, indicating that CD22 may have eosinophil regulatory function.

[0003] CD22 molecule is one of the B cell surface inhibitory accessory receptors, which is closely related to the development, differentiation and function of B cells. CD22 is restrictedly expressed on the surface of mature B cells and most B lymphoma cells. Targeting CD22 for tumor immunotherapy has become one of the hotspots of immunological research. At present, in addition to therapeutic antibodies, there are also CAR-T cell therapies for immunotargeting therapy of CD22 molecules. As of November 2019, although only two CD22-related antibody drugs have been approved for marketing, there are nearly 108 clinical studies on CD22 CAR-T cell therapy and antibody drugs. There is no report on anti-CD22 nanobody in the art. SUMMARY

[0004] The present application provides a CD22 binding molecule comprising an anti-CD22 nanobody or an antigen binding fragment thereof, the complementarity determining region CDR of the anti-CD22 nanobody comprising CDR1, CDR2 and CDR3, wherein the CDR1 comprises a sequence as shown in any one of SEQ ID NO: 1-20, the CDR2 comprises a sequence as shown in any one of SEQ ID NO: 21-37, and the CDR3 comprises a sequence as shown in any one of SEQ ID NO: 38-58.

[0005] In one or more embodiments, the anti-CD22 Nanobody contains a CDR1, CDR2, and CDR3 that is the group of CDR1, CDR2, and CDR3 set forth in any one of the rows of SEQ ID NOs in Table 1.

[0006] Table 1 SEQ ID NOs for Nanobody CDR regions

[0007]

[0008]

[0009] In one or more embodiments, the FR1 of the anti-CD22 Nanobody comprises a sequence set forth in any one of SEQ ID NOs: 59-72; the FR2 comprises a sequence set forth in any one of SEQ ID NOs: 73-89; the FR3 comprises a sequence set forth in any one of SEQ ID NOs: 90-106; and the FR4 comprises a sequence set forth in any one of SEQ ID NOs: 107-112.

[0010] In one or more embodiments, the anti-CD22 Nanobody contains a FR1, FR2, FR3, and FR4 that is the group of FR1, FR2, FR3, and FR4 set forth in any one of the rows of Table 2.

[0011] In one or more embodiments, the variable region sequence of the heavy chain of the anti-CD22 Nanobody is set forth in any one of SEQ ID NOs: 113-134.

[0012] In one or more embodiments, the CD22 binding molecule is a monovalent or multivalent Nanobody or single domain antibody, or a multi-specific Nanobody or single domain antibody, comprising one, two, or more anti-CD22 Nanobodies or antigen binding fragments thereof.

[0013] In one or more embodiments, the multivalent binding molecule or multi-specific binding molecule links multiple anti-CD22 Nanobodies or antigen binding fragments thereof via a linker. The linker consists of 1-15 amino acids selected from G and S.

[0014] In one or more embodiments, the Nanobody is a camelid heavy chain antibody or a cartilaginous fish heavy chain antibody.

[0015] In one or more embodiments, the Nanobody further comprises a heavy chain constant region.

[0016] In one or more embodiments, the heavy chain constant region is a constant region of a camelid heavy chain antibody, comprising CH2 and CH3. In one or more embodiments, the CH2 and CH3 are CH2 and CH3 of human IgG Fc, e.g. CH2 and CH3 of IgG4. Preferably, the heavy chain constant region is as set forth in SEQ ID NO: 135. In one or more embodiments, the heavy chain constant region is a constant region of a cartilaginous fish heavy chain antibody, comprising CH1, CH2, CH3, CH4 and CH5.

[0017] In one or more embodiments, the CD22 binding molecule of any embodiment of the application is a chimeric antibody or a fully human antibody; preferably a fully human antibody.

[0018] In one or more embodiments, the binding molecule is an antibody comprising the anti-CD22 nanobody as a heavy chain variable domain.

[0019] In one or more embodiments, the binding molecule further comprises a light chain variable domain, a heavy chain constant domain and a light chain constant domain.

[0020] In one or more embodiments, the antigen binding fragment of an antibody is selected from the group consisting of Fab, F(ab')2, Fv, scFv.

[0021] The present application also provides a nucleic acid molecule having a sequence selected from the group consisting of:

[0022] (1 ) a sequence encoding a CD22 binding molecule according to any embodiment herein;

[0023] (2) a complement of (1 );

[0024] (3) a fragment of 5-50 bp of any of the sequences of (1 ) or (2).

[0025] In one or more embodiments, the fragment is a primer.

[0026] The present application also provides a nucleic acid construct comprising a nucleic acid molecule as described herein.

[0027] In one or more embodiments, the nucleic acid construct is a cloning vector, an expression vector or an integration vector.

[0028] The present application also provides a phage comprising a CD22 binding molecule according to any embodiment herein.

[0029] In one or more embodiments, the CD22 binding molecule is displayed on the surface of the phage.

[0030] The present application also provides a host cell selected from the group consisting of:

[0031] (1) expressing and / or secreting a CD22 binding molecule according to any of the embodiments described herein;

[0032] (2) comprising a nucleic acid molecule described herein; and / or

[0033] (3) comprising a nucleic acid construct described herein.

[0034] In one or more embodiments, the host cell is an immune effector cell, preferably a T cell.

[0035] The present application also provides fusion proteins comprising an anti-CD22 binding molecule described herein and a further polypeptide.

[0036] In some embodiments, the further polypeptide is located N-terminal and / or C-terminal to the binding molecule.

[0037] In some embodiments, the further polypeptide comprises a polypeptide that localizes the binding molecule to a different organelle, a tag for purification or for an immune response, a transmembrane protein or a transmembrane region thereof, a chimeric antigen receptor or a component thereof.

[0038] In some embodiments, the fusion protein is a chimeric antigen receptor, the antigen binding domain of which comprises the CD22 binding molecule.

[0039] The present application also provides a method of producing a CD22 binding molecule according to any of the embodiments described herein, comprising:

[0040] culturing a host cell described herein under conditions suitable for production of a CD22 binding molecule (e.g. a Nanobody or antigen binding fragment thereof, a monovalent or multivalent Nanobody or single domain antibody, or a multispecific Nanobody or single domain antibody), and optionally purifying the CD22 binding molecule from the culture, or

[0041] incubating a nucleic acid molecule encoding a CD22 binding molecule according to any of the embodiments described herein under conditions suitable for translation of the DNA or RNA in a non-cellular system (e.g. in solution).

[0042] The present application also provides a pharmaceutical composition comprising a CD22 binding molecule, a nucleic acid molecule, a nucleic acid construct, a phage or a host cell according to any of the embodiments described herein, and a pharmaceutically acceptable excipient.

[0043] In one or more embodiments, the pharmaceutical composition is for use in the treatment of a disease or condition associated with CD22 expression, e.g. cancer.

[0044] The present application also provides the use of a CD22 binding molecule, a nucleic acid molecule, a nucleic acid construct, a phage or a host cell according to any of the embodiments described herein for the preparation of an activated immune cell, e.g. a T cell.

[0045] The present application also provides the use of a CD22 binding molecule, a nucleic acid molecule, a nucleic acid construct, a bacteriophage or a host cell according to any of the embodiments herein in the manufacture of a medicament for preventing or treating a CD22 expression related disease or condition.

[0046] In one or more embodiments, the disease or condition is cancer, such as non-Hodgkin's lymphoma, Burkitt's lymphoma, small lymphocytic lymphoma, primary effusion lymphoma, diffuse large B-cell lymphoma (DLBCL), splenic marginal zone lymphoma, mucosa-associated lymphoid tissue (MALT) lymphoma, hairy cell leukemia (HCL), chronic lymphocytic leukemia (CLL), chronic myelogenous leukemia, B-cell prolymphocytic leukemia, mantle cell lymphoma, B-cell acute lymphoblastic leukemia (ALL).

[0047] The present application also provides a method of treating or preventing a CD22 expression related disease or condition, comprising administering to a patient in need thereof a therapeutically effective amount of a CD22 binding molecule, a nucleic acid molecule, a nucleic acid construct or a host cell according to any of the embodiments herein, or a pharmaceutical composition according to any of the embodiments herein.

[0048] The present application also provides a kit for detecting CD22, for example for assessing the effect of a drug treatment or for diagnosing cancer, comprising a CD22 binding molecule, a nucleic acid molecule, a nucleic acid construct or a host cell according to any of the embodiments herein.

[0049] In one or more embodiments, the kit further comprises a reagent for detecting the binding of CD22 to the CD22 binding molecule. For example, the reagent for detecting the binding is an enzyme-linked immunoassay.

[0050] In one or more embodiments, the reagent for detecting the binding is a detectable label that can be attached to the CD22 binding molecule, such as biotin. The detectable label can be attached to the CD22 binding molecule or present separately in the kit.

[0051] The present application also provides a non-diagnostic method of detecting the presence of CD22 in a sample, comprising incubating a sample with a CD22 binding molecule according to any of the embodiments herein, and detecting the binding of CD22 to the CD22 binding molecule, thereby determining the presence of CD22 in the sample. The detection is by enzyme-linked immunoassay.

[0052] The present application also provides the use of a CD22 binding molecule according to any of the embodiments herein in the manufacture of a kit for detecting CD22, assessing the effect of a drug treatment or diagnosing cancer. BRIEF DESCRIPTION OF DRAWINGS

[0053] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the drawings needed in the embodiments will be briefly introduced as follows. It should be understood that the following drawings only show some embodiments of the present application, and therefore should not be regarded as a limitation on the scope. Other related drawings can also be obtained by those skilled in the art without creative effort.

[0054] Figure 1 Detection of the titer of the llama antiserum against CD22 protein.

[0055] Figure 2 Detection of the titer of the llama antiserum against CD22 overexpressing cell strain

[0056] Figure 3 Detection of the binding of the candidate antibody to 293T-hCD22 overexpressing cell strain

[0057] Figure 4 Detection of the binding of the candidate antibody to Raji tumor cell strain

[0058] Figure 5 Detection of the binding of the candidate antibody to Daudi tumor cell strain

[0059] Figure 6 After 96h of killing tumor cells by CAR-T with different effector-to-target ratios, the tumor cells were lysed to different degrees. DETAILED DESCRIPTION

[0060] The present inventors have made extensive and in-depth research, and through a large number of screening, found a class of anti-CD22 nanobodies and antigen-binding fragments thereof, which can specifically recognize CD22, bind to CD22 with high affinity, and have good functional activity.

[0061] Specifically, the present application uses CD22 protein to immunize a llama, and obtains a high-quality single-domain antibody gene library. Then, the phage display technology is used to screen the antibody gene library, so as to obtain a CD22-specific single-domain antibody gene. Then, the gene is transferred to a mammalian cell, so as to obtain an antibody strain that can be efficiently expressed in a mammalian cell and has high specificity. Then, the nanobody with high affinity, high specificity, and high functional activity is identified by ELISA, molecular interaction analysis, and blocking test. The antibody or antigen-binding fragment thereof has good safety and targeting, and can specifically bind to the extracellular domain of human CD22.

[0062] Antibody

[0063] In this document, the "CD22 binding molecule" is a protein that specifically binds to CD22, including but not limited to an antibody, a heavy chain antibody, a nanobody, or an antigen-binding fragment thereof.

[0064] The term "antibody" herein includes monoclonal antibodies (including full-length antibodies having an immunoglobulin Fc region), antibody compositions with polyepitopic specificity, multispecific antibodies (e.g., bispecific antibodies), diabodies, and single-chain molecules, as well as antibody fragments, particularly antigen-binding fragments, such as Fab, F(ab')2, and Fv. The term "antibody" is used interchangeably with "immunoglobulin" herein.

[0065] A conventional "antibody" contains a basic 4-chain antibody unit, which is a heterotetrameric glycoprotein composed of two identical light (L) chains and two identical heavy (H) chains. Each of the heavy chains has at its N-terminus, a variable domain (VH) followed by three constant domains (CH1, CH2, and CH3) and a hinge region between CH1 and CH2 domains. Each of the light chains has at its N-terminus, a variable domain (VL) followed by a constant domain (CL) at its other end. The pairwise combinations of VHand VLcreate a single antigen-binding site. See, e.g., Basic and Clinical Immunology, 8th Ed., Daniel P. Sties, Abba I. Terr and Tristram G. Parslow, eds., Appleton & Lange, Norwalk, CT, 1994, p. 71 and Chapter 6, for a description of the structural and functional characteristics of the different classes of antibodies. The light chains can be of two types, kappa and lambda, depending on the amino acid sequence of the constant domain. The gamma and alpha classes are further divided into subclasses, e.g., in humans the following subclasses are expressed: IgGl, IgG2A, IgG2B, IgG3, IgG4, IgAl, and IgA2, based on the relative small differences in CH sequences and functions.

[0066] A "heavy chain antibody" described herein is an antibody derived from a Camelid or a Cartilaginous fish. In contrast to the above 4-chain antibody, a heavy chain antibody lacks a light chain and a heavy chain constant region 1 (CH1), and contains only 2 heavy chains composed of a variable region (VHH) and other constant regions, with the variable region connected to the constant region by a hinge-like structure. Each heavy chain of a Camelid heavy chain antibody contains 1 variable region (VHH) and 2 constant regions (CH2 and CH3), and each heavy chain of a Cartilaginous fish heavy chain antibody contains 1 variable region and 5 constant regions (CH1-CH5). An antigen-binding fragment of a heavy chain antibody includes VHH and a single-chain heavy chain antibody. By fusing with the constant region of human IgG Fc, a heavy chain antibody can have CH2 and CH3 of human IgG Fc.

[0067] As used herein, the terms "single domain antibody", "anti-CD22 single domain antibody", "heavy chain variable region domain of a heavy chain antibody", "VHH" are used interchangeably and all refer to a single domain antibody that specifically recognizes and binds to CD22. A single domain antibody is the variable region of a heavy chain antibody. A single domain antibody is the smallest functional antigen binding fragment, usually containing three CDRs and four FRs. Preferably, the single domain antibody of the present application has a CDR1 as set forth in any one of SEQ ID NOs: 1-20, a CDR2 as set forth in any one of SEQ ID NOs: 21-37, and a CDR3 as set forth in any one of SEQ ID NOs: 38-58. Preferably, the single domain antibody of the present application has a FR1 as set forth in any one of SEQ ID NOs: 59-72, a FR2 as set forth in any one of SEQ ID NOs: 73-89, a FR3 as set forth in any one of SEQ ID NOs: 90-106, and a FR4 as set forth in any one of SEQ ID NOs: 107-112. A VHH obtained by recombination of the CDRs and FRs is also within the scope of the present application. Usually, a single domain antibody is constructed by cloning the variable region of the antibody heavy chain after obtaining an antibody naturally lacking the light chain and the heavy chain constant region 1 (CH1) from the antibody.

[0068] Herein, "nanobody" refers to a VHH-based immunomolecule containing the CDRs or combinations of CDRs described herein. It can be a heavy chain antibody as described above, but also a multivalent or multispecific molecule containing multiple VHHs, or a recombinant molecule obtained by recombination of a VHH and an antibody Fc (e.g. CH2 and CH3 or CH2, CH3 and CH4).

[0069] A binding molecule comprising two or more single domain antibodies is a multivalent single domain antibody; a binding molecule comprising two or more single domain antibodies of different specificity is a multispecific single domain antibody. A multivalent single domain antibody or a multispecific single domain antibody connects multiple single domain antibodies via a linker. The linker usually consists of 1-15 amino acids selected from G and S.

[0070] Herein, heavy chain antibody and antibody (traditional four-chain antibody) are intended to distinguish between different combinations of antibodies. Due to the similarity of the structures of both, the following structural description of antibodies also applies to heavy chain antibodies, except where the light chain is mentioned.

[0071] The "variable region" or "variable domain" of an antibody refers to the amino-terminal domains of the heavy or light chain of an antibody. The variable domains of the heavy chain and light chain can be referred to as "VH" and "VL", respectively. These domains are generally the most variable parts of an antibody (relative to other antibodies of the same type) and contain the antigen binding sites.

[0072] The term "variable" refers to the fact that certain segments of the variable domains differ extensively in sequence among antibodies, and are used to confer antigen binding specificity and particular antigenic specificity of a particular antibody. However, the variability is not evenly distributed throughout the variable domains of antibodies; it is concentrated in three segments called hypervariable regions (HVRs) both in the light chain and the heavy chain variable domains, i.e., HCDR1, HCDR2, HCDR3 in the variable region of the heavy chain (which can be referred to simply as CDR1, CDR2, CDR3 in heavy chain antibodies) and LCDR1, LCDR2, and LCDR3 in the variable region of the light chain. The more highly conserved portions of variable domains are called the framework regions (FRs). The variable domains of the naturally occurring heavy and light chains each comprise four FR regions, FR1, FR2, FR3, and FR4, mostly from beta-sheet formation, connected by three HVRs. The HVRs in each chain are held together in close proximity by the FR regions and, with the HVRs from the other chain, contribute to the formation of the antigen binding site of antibodies. Generally, the structure of a light chain variable region is FR1-LCDR1-FR2-LCDR2-FR3-LCDR3-FR4, and the structure of a heavy chain variable region is FR1-HCDR1-FR2-HCDR2-FR3-HCDR3-FR4. The constant domains do not participate directly in binding of an antibody to an antigen, but exhibit various effector functions, such as participation of the antibody in antibody-dependent cellular cytotoxicity. There are various numbering schemes for variable regions, including Chothia, Kabat, IMGT, and Contact. The IMGT numbering scheme is used illustratively herein.

[0073] The "Fc region" (fragment, crystallizable region) or "Fc domain" or "Fc" refers to the C-terminal region of the heavy chain of an antibody that mediates the binding of the immunoglobulin to host tissues or factors including binding to Fc receptors (FcR) located on various cells of the immune system (e.g., effector cells) or to the first component (Clq) of the classical complement system. In IgG, IgA, and IgD antibody isotypes, the Fc region is composed of two identical protein fragments from the CH2 and CH3 domains of each of the two heavy chains; the Fc region of IgM and IgE comprises three heavy chain constant domains (CH domains 2-4) in each polypeptide chain. While the boundaries of the Fc region of an immunoglobulin heavy chain might vary, the human IgG heavy chain Fc region is usually defined to stretch from an amino acid residue at position C226 or P230 of the heavy chain to the carboxy-terminus, wherein the numbering is according to the EU index as in Kabat. As used herein, the Fc region can be a native sequence Fc or a variant Fc.

[0074] An "antibody fragment" comprises a portion of an intact antibody, preferably the antigen binding and / or variable region of the intact antibody. Antibody fragments preferably are antigen binding fragments of antibodies. Examples of antibody fragments include Fab, Fab', F(ab')2, Fd, and Fv fragments, disulfide-linked Fvs; diabodies; linear antibodies; single-chain antibody molecules; scFv-Fc fragments; multispecific antibodies formed from antibody fragments; and any fragments capable of increasing the half-life of the antibody by chemical modification or by incorporation into a liposome. Antigen binding fragments can be produced by a variety of techniques, including, but not limited to, proteolytic digestion of intact antibodies, and expression in a host cell of a nucleic acid encoding the fragment.

[0075] "Fv" is the minimum antibody fragment that contains a complete antigen- recognition and -binding site. This fragment consists of a dimer of one heavy- and one light-chain variable domain. From the folding of these two domains emanate six hypervariable loops (3 loops each from the H and L chain) that contribute the amino acid residues for antigen binding and confer antigen binding specificity to antibodies. However, even a single variable domain (or half of an Fv comprising only three HVRs specific for an antigen) is sufficient for antigen recognition, although at a lower affinity than the entire binding site. "Single-chain Fv" also abbreviated as "sFv" or "scFv" are antibody fragments that comprise the VHand VLdomains of antibody, linked by a polypeptide linker as a single polypeptide chain. Preferably, the sFv polypeptide further comprises a polypeptide linker between the VHand VLdomains, which enables the sFv to form the desired structure for antigen binding. For a heavy chain antibody or nanobody, scFv is VHH.

[0076] The term "monoclonal antibody" as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally occurring mutations and / or post- translational modifications (e.g., isomerization, amidation) that can be present in minor amounts. Monoclonal antibodies are highly specific, being directed against a single antigenic site. In contrast to polyclonal antibody preparations (which typically include different antibodies directed against different determinants (epitopes)), each monoclonal antibody is directed against a single determinant on the antigen. In addition to their specificity, the monoclonal antibodies are advantageous in that they are synthesized by the hybridoma culture, which does not contain other immunoglobulins. The modifier "monoclonal" indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method. For example, the monoclonal antibodies to be used in accordance with the present application can be made by a variety of techniques, including, for example, the hybridoma method, the phage display method, recombinant DNA methods, and the technique of generating human or human-like antibodies in transgenic animals, single-cell sequencing methods.

[0077] Monoclonal antibodies also include "chimeric" antibodies in which a portion of the heavy and / or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired biological activity.

[0078] "Humanized" forms of non-human (e.g., murine) antibodies are chimeric antibodies that contain sequences derived from non-human immunoglobulin. Thus, "humanized antibodies" generally refer to non-human antibodies in which the variable domain framework regions have been exchanged for sequences found in human antibodies. Typically in humanized antibodies, the entire antibody (except the CDRs) is encoded by a polynucleotide of human origin or is identical to such an antibody (except the CDRs). The CDRs, some or all of which are encoded by nucleic acids derived from a non-human organism, are grafted into the beta-sheet framework of a human antibody variable region to create an antibody whose specificity is determined by the grafted CDRs. Methods for creating such antibodies are well known in the art, for example, using mice with a genetically engineered immune system. In the present invention, antibodies, single domain antibodies, heavy chain antibodies, etc. also include humanized variants of each of the recited antibodies.

[0079] "Human antibodies" refer to antibodies having an amino acid sequence corresponding to that of an antibody produced by a human and / or produced using any of the techniques disclosed herein for generating human antibodies. This definition of a human antibody specifically excludes humanized antibodies comprising non-human antigen-binding residues. Human antibodies can be produced using various techniques known in the art, including phage-display libraries.

[0080] In some embodiments, the present invention also provides a nanobody, heavy chain antibody, antibody or antigen binding fragment thereof (e.g. single domain antibody VHH) that competes with the antigen binding region of any anti-CD22 nanobody of the present invention for binding to the same epitope on human CD22, i.e. a nanobody, heavy chain antibody, antibody or antigen binding fragment thereof capable of cross- competing with the antigen binding region of any nanobody of the present invention for binding to CD22.

[0081] In particular embodiments of the present invention, the anti-CD22 single domain antibody contains a CDR1, CDR2 and CDR3 set as set forth in any of the SEQ ID NO. of any of the rows of Table 2:

[0082] Table 2, numbering of the sequences

[0083]

[0084]

[0085] The FR1, FR2, FR3 and FR4 of the anti-CD22 single domain antibodies described herein can be independently selected from the FR1, FR2, FR3 and FR4 shown in any of the rows of Table 2, respectively. Preferably, the FR regions of the anti-CD22 single domain antibodies are the FR regions of any of the VHHs selected from SEQ ID NOs: 113-134, i.e. the set of FR1, FR2, FR3 and FR4.

[0086] wherein the sequences of the VHHs are shown in Table 3:

[0087] Table 3 Sequences of VHHs

[0088]

[0089]

[0090] When the single domain antibody is linked to a heavy chain constant region, the nanobody is a heavy chain antibody comprising the single domain antibody described herein. The heavy chain constant region can be the constant region of a camelid heavy chain antibody, comprising CH2 and CH3. Preferably, the antibody constant region is derived from the constant region of any of IgGl, IgG2, IgG3, IgG4, IgA, IgM, IgE and IgD, more preferably from the constant region of any of IgGl, IgG2, IgG3, IgG4. In one or more embodiments, the heavy chain constant region is CH2 and CH3 of human IgG Fc, for example CH2 and CH3 of IgG4, as shown in SEQ ID NO: 135.

[0091] The CD22 binding molecules described herein can be monovalent or multivalent nanobodies or single domain antibodies, or multispecific nanobodies or single domain antibodies comprising one, two or more of the anti-CD22 nanobodies or single domain antibodies described herein. The multispecificity can be against CD22 and another antigen, or against two different epitopes of CD22.

[0092] The present application also includes derivatives and analogs of the binding molecules described. By "derivative" and "analog" is meant a polypeptide that substantially retains the same biological function or activity of the binding molecules of the present application. Derivatives or analogs of the present application can be (i) a polypeptide having a substitution group at one or more amino acid residues, or (ii) a polypeptide formed by fusing the mature polypeptide to another compound, such as a compound that prolongs the half-life of the polypeptide, for example, polyethylene glycol, or (iii) a polypeptide formed by fusing additional amino acid sequences to the polypeptide sequence, such as a leader or secretion sequence or a sequence or protein for purification of the polypeptide or a proprotein sequence, or a fusion protein with a 6His tag. These derivatives and analogs are within the scope of those skilled in the art in light of the teachings herein.

[0093] Without materially affecting the activity of the binding molecule, one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more) amino acids can be altered in the sequence of a binding molecule of the application by one skilled in the art to obtain a variant of the sequence of the binding molecule or a functional fragment thereof. These variants include, but are not limited to, deletion, insertion, and / or substitution of one or more (typically 1-50, preferably 1-30, more preferably 1-20, most preferably 1-10) amino acids, as well as addition of one or several (typically within 20, preferably within 10, more preferably within 5) amino acids at the C-terminus and / or the N-terminus. In the art, conservative substitutions with similar or identical properties are often made without altering the function of the protein. For example, amino acids with similar properties are substituted in the FR and / or Fc regions. Amino acid residues that can be conservatively substituted are well known in the art. Such substituted amino acid residues can or can not be encoded by the genetic code. Also, addition of one or several amino acids at the C-terminus and / or the N-terminus often does not alter the function of the protein. All of these are considered to be within the scope of the application.

[0094] Variants of the binding molecules described herein include homologous sequences, conservative variants, allelic variants, natural mutants, induced mutants, proteins encoded by DNA that hybridizes to the DNA encoding the binding molecules of the application under high or low stringency conditions, and polypeptides or proteins obtained using antisera against the binding molecules of the application. In some embodiments, the sequences of the variants of the application can have at least 95%, 96%, 97%, 98%, or 99% identity to the sequences from which they are derived. The sequence identity of the sequences of the application can be measured using sequence analysis software, for example, the computer program BLAST, particularly BLASTP or TBLASTN, using default parameters. The application also includes molecules having the variable region of the heavy chain of an antibody with CDRs, as long as the CDRs have more than 90% (preferably more than 95%, most preferably more than 98%) homology to the CDRs identified herein.

[0095] The binding molecules of the application (e.g., nanobodies) can be prepared using methods conventional in the art, such as hybridoma technology, phage display technology. Alternatively, the nanobodies of the application can be expressed in other cell lines. A suitable mammalian host cell can be transformed with a sequence encoding a binding molecule of the application, and the host cell is then cultured and the binding molecule purified. Transformation can be performed using any known method, including, for example, packaging the polynucleotide in a virus (or viral vector) and transducing a host cell with the virus (or vector). The transformation procedure used depends on the host to be transformed. Methods for introducing heterologous polynucleotides into mammalian cells are well known in the art, including dextran-mediated transfection, calcium phosphate precipitation, polybrene-mediated transfection, protoplast fusion, electroporation, encapsulation of the polynucleotide in liposomes, and direct microinjection of the DNA into nuclei, among others. Mammalian cell lines useful as hosts for expression are well known in the art, including, but not limited to, a variety of immortalized cell lines available from the American Type Culture Collection (ATCC), including, but not limited to, Chinese hamster ovary (CHO) cells, HeLa cells, baby hamster kidney (BHK) cells, monkey kidney cells (COS), human hepatocellular carcinoma cells (e.g., Hep G2), and the like.

[0096] The application also includes fusion proteins comprising the anti-CD22 binding molecules described herein and other polypeptides. In some embodiments, the other polypeptide is N-terminal and / or C-terminal to the binding molecule. In some embodiments, the other polypeptide comprises a polypeptide that localizes the binding molecule to a different organelle, a tag for purification or for an immune response, a transmembrane protein or transmembrane region thereof, a chimeric antigen receptor or component thereof (extracellular domain, hinge region, transmembrane region, signal transduction domain, costimulatory domain, etc.). In some embodiments, the fusion protein is a chimeric antigen receptor whose antigen binding domain comprises the CD22 binding molecule. The chimeric antigen receptor comprises: an optional signal peptide sequence, a CD22 binding molecule comprising a CD22 single domain antibody, a hinge region, a transmembrane region, an intracellular region.

[0097] The chimeric antigen receptor also has one or more features selected from the group consisting of:

[0098] The signal peptide comprises a CD8 signal peptide, a CD28 signal peptide, a CD4 signal peptide, or a light chain signal peptide,

[0099] The hinge region comprises a CD8 hinge region, an IgD hinge region, an IgG1 Fc CH2CH3 hinge region, or an IgG4 Fc CH2CH3 hinge region,

[0100] The transmembrane region comprises a CD28 transmembrane region, a CD8 transmembrane region, a CD3 zeta transmembrane region, a CD134 transmembrane region, a CD137 transmembrane region, an ICOS transmembrane region, or a DAP10 transmembrane region,

[0101] the intracellular signaling domain comprises a CD3ζ intracellular signaling domain or a FcεRIγ intracellular signaling domain.

[0102] the intracellular costimulatory domain comprises an intracellular domain of CD28, CD134 / OX40, CD137 / 4-1BB, lymphocyte-specific protein tyrosine kinase, inducible T-cell costimulator (ICOS), or DNAX-activation protein 10,

[0103] the intracellular signaling domain comprises a CD3ζ intracellular signaling domain or a FcεRIγ intracellular signaling domain.

[0104] nucleic acid

[0105] The present application also provides polynucleotides encoding the binding molecules described herein. The polynucleotides of the present application can be in the form of DNA or RNA. The DNA form includes cDNA, genomic DNA, or artificially synthesized DNA. The DNA can be single-stranded or double-stranded. The DNA can be the coding strand or the non-coding strand. The present application also includes degenerate variants of the polynucleotide sequences encoding the fusion proteins, i.e., nucleotide sequences that encode the same amino acid sequences but differ in nucleotide sequence. The RNA can be mRNA that expresses the binding molecules in vivo and / or in vitro.

[0106] Therefore, the present application also relates to polynucleotides that hybridize to the above polynucleotide sequences and have at least 50%, preferably at least 70%, more preferably at least 80% identity between the two sequences. The present application particularly relates to polynucleotides that hybridize to the polynucleotides described in the present application under stringent conditions. In the present application, "stringent conditions" refer to: (1) hybridization and washing at low ionic strength and high temperature, such as 0.2 x SSC, 0.1% SDS, 60°C; or (2) hybridization with a denaturant, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficoll, 42°C, etc.; or (3) hybridization only occurs when the identity between the two sequences is at least 90%, more preferably 95% or more. Moreover, the polypeptides encoded by the hybridizable polynucleotides have the same biological functions and activities as the mature polypeptides.

[0107] The nucleotide full-length sequences of the binding molecules of the present application or fragments thereof can generally be obtained by PCR amplification, recombination, or artificial synthesis. One feasible method is to synthesize the relevant sequences by artificial synthesis, especially when the length of the fragments is relatively short. Generally, a long fragment can be obtained by first synthesizing multiple small fragments and then ligating them together. In addition, the coding sequence of the heavy chain can be fused with an expression tag (such as 6His) to form a fusion protein. The sequence of each part of the fusion protein can be obtained as described above, and then the full-length fusion protein can be obtained by ligation.

[0108] Once an appropriate sequence has been obtained, it can be obtained in large quantities using recombinant methods. This is typically done by cloning it into a vector, which is then transferred into a cell, and then isolated from the propagated host cell by conventional means. The biomolecules (nucleic acids, proteins, etc.) involved in the present application include those that exist in isolated form. At present, it is possible to obtain the DNA sequence encoding the protein (or fragment thereof, or derivative thereof) of the present application entirely by chemical synthesis. This DNA sequence can then be introduced into various existing DNA molecules (or as a vector) and cells known in the art. Furthermore, mutations can be introduced into the protein sequence of the present application by chemical synthesis. The portions of the fusion protein can be cloned sequentially into vectors or can be cloned as a full-length fusion protein.

[0109] The present application also relates to nucleic acid constructs comprising the polynucleotide sequences described herein, and one or more control sequences operably linked to these sequences, such as control sequences suitable for expressing DNA or RNA as a binding molecule in vivo or in vitro. The polynucleotide sequences described in the present application can be manipulated in a variety of ways to ensure their expression as the binding molecule. Manipulation of the nucleic acid construct prior to its insertion into a vector can be desirable or necessary depending on the chosen or desired expression vector.

[0110] The regulatory sequences can be a suitable promoter sequence. The promoter sequence is typically operably linked to the coding sequence of the protein to be expressed. The promoter can be any nucleotide sequence which shows transcriptional activity in the host cell of choice and includes mutant, truncated, and hybrid promoters, and can be derived from genes either homologous or heterologous to the host cell. One example of a suitable promoter is the immediate early cytomegalovirus (CMV) promoter sequence. This promoter sequence is a strong constitutive promoter sequence capable of driving high levels of expression of any polynucleotide sequence operably linked thereto. Another example of a suitable promoter is elongation factor- 1 alpha (EF-1 alpha). However, other constitutive promoter sequences can also be used, including but not limited to the simian virus 40 (SV40) early promoter, the mouse mammary tumor virus (MMTV), the human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, the MoMuLV promoter, the avian leukemia virus promoter, the Epstein-Barr virus immediate early promoter, the Rous Sarcoma Virus promoter, and human gene promoters such as, but not limited to, the actin promoter, the myoglobin promoter, the hemoglobin promoter, and the creatine kinase promoter. Further, the use of inducible promoters can also be contemplated. The use of inducible promoters provides a molecular switch that can turn on the expression of a polynucleotide sequence operably linked to the inducible promoter at a time of choice, and turn off the expression when expression is not desired. Examples of inducible promoters include, but are not limited to, the metallothionein promoter, the glucocorticoid promoter, the progesterone promoter, and the tetracycline promoter.

[0111] The regulatory sequences can also be a suitable transcription terminator sequence, a sequence recognized by a host cell for termination of transcription. The terminator sequence is operably linked to the 3' terminus of the nucleotide sequence encoding the polypeptide. Any terminator that is functional in the host cell of choice can be used in the present application. The regulatory sequences can also be a suitable leader sequence, an untranslated region of an mRNA important for translation by the host cell. The leader sequence is operably linked to the 5' terminus of the nucleotide sequence encoding the polypeptide. Any terminator that is functional in the host cell of choice can be used in the present application.

[0112] Other regulatory sequences that are suitable for in vivo or in vitro expression of DNA or RNA are routine in the art.

[0113] In certain embodiments, the nucleic acid construct is a vector, such as a cloning vector, an expression vector, and an integrating vector. Expression of the polynucleotide sequences of the application is typically achieved by operably linking the polynucleotide sequences of the application to an expression vector. Typical cloning vectors contain transcription and translation terminators, initiation sequences, and promoters useful for regulation of expression of the desired nucleic acid sequences. Integrating vectors contain components that allow for integration of the target sequences into the genome of a cell. These vectors can be used to transform appropriate host cells to enable them to express proteins. Vectors typically contain sequences for plasmid maintenance and for cloning and expression of foreign nucleotide sequences. The sequences, which in certain embodiments are collectively referred to as "flanking sequences," generally include one or more of the following nucleotide sequences: a promoter, one or more enhancer sequences, an origin of replication, a transcription termination sequence, a complete intron sequence containing donor and acceptor splice sites, a sequence encoding a leader sequence for polypeptide secretion, a ribosome binding site, a polyadenylation sequence, a polylinker region for insertion of nucleic acids encoding binding molecules to be expressed, and an optional marker element.

[0114] Furthermore, the type of vector is not limited, for example, plasmid, phagemid, phage derivative, animal virus, and cosmid, and can be changed depending on the host cell to be introduced. Viral vector technology is well known in the art and described in, for example, Sambrook et al. (2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York) and other virology and molecular biology manuals. Viruses that can be used as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses, and lentiviruses.

[0115] In order to assess expression of a polypeptide or portion thereof, the vector introduced into the cell can also contain either or both of a selectable marker gene or a reporter gene to facilitate identification and selection of the expressing cells from the population of cells sought to be transfected or infected by the viral vector.

[0116] Cells

[0117] Host cells suitable for introduction of the nucleic acid constructs described herein can be prokaryotic cells, such as bacterial cells; or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as mammalian cells. Representative examples include: E. coli, Streptomyces; bacterial cells of Salmonella typhimurium; fungal cells, such as yeast; insect cells, such as Drosophila S2 or Sf9; animal cells, such as CHO, COS7, 293 cells, and the like. Examples of mammalian cells include immune cells, preferably immune effector cells. An "immune effector cell" is an immune cell that can perform an immune effector function, including: T cells, NK cells, peripheral blood mononuclear cells (PBMCs), neutrophils, eosinophils, hematopoietic stem cells. T cells suitable for use in the application can be of various types and from various sources.

[0118] Methods for introducing nucleic acids or vectors into mammalian cells are known in the art, and the vectors can be introduced into the cells by physical, chemical, or biological means. When the host is a prokaryote, such as E. coli, a competent cell that can take up DNA can be harvested after the exponential growth phase and treated with CaCl2, using procedures well known in the art. When the host is a eukaryote, DNA transfection methods such as calcium phosphate co-precipitation, conventional mechanical methods such as microinjection, electroporation, liposome packaging, and the like can be used. In some embodiments, the transduced or transfected immune effector cells are propagated ex vivo after introduction of the nucleic acid or vector.

[0119] The fusion protein is a chimeric antigen receptor (CAR) whose antigen binding domain comprises the CD22 binding molecule. The chimeric antigen receptor-expressing cell can be prepared by: (1) activating the cell by contacting the cell with an activator; (2) introducing a nucleic acid molecule encoding the CAR into the cell by contacting the cell with the nucleic acid molecule encoding the CAR on a vector to introduce the nucleic acid molecule into the cell; and (3) harvesting the cell. The chimeric antigen receptor-expressing cell can be prepared in vitro by a viral vector or a non-viral vector, or directly generated in vivo in a patient by a viral vector. In some embodiments, the nucleic acid molecule encoding the CAR is DNA, and the vector is a plasmid vector. In some embodiments, the nucleic acid molecule encoding the CAR is RNA, such as mRNA, saRNA, and the vector is LNP, LPX, VLP, inorganic nanoparticle, or exosome. In some embodiments, the vector is a plasmid vector containing a transposon comprising the nucleic acid molecule encoding the CAR, and the step (2) further comprises contacting the cell with a transposase or a nucleic acid molecule encoding the transposase. The transposon and the transposase belong to the same transposon system, which is selected from the group consisting of: Tol1 transposon system, Tol2 transposon system, Frog Prince transposon system, Minos transposon system, Hsmar1 transposon system, Helraiser transposon system, ZB transposon system, BZ transposon system, Intruder transposon system, SPINON transposon system, TcBuster transposon system, Passer transposon system, JL transposon system, Yabusame-1 transposon system, Uribo2 transposon system, PiggyBac (PB) transposon system, Sleeping Beauty (SB) transposon system, and various variants or derivatives of the above transposon systems. In one or more embodiments, the transposon system is the PB transposon system, the BZ transposon system, or the JL transposon system. In some embodiments, the nucleic acid molecule encoding the transposase is DNA or RNA. In some embodiments, the cell is contacted with the transposase or the nucleic acid molecule encoding the transposase for cell transduction by electroporation. In some embodiments, the introduction is performed by electroporation. The step (2) comprises: contacting the cell with a DNA vector comprising a PB transposon and an mRNA encoding a PB transposase, the PB transposon comprising a CAR gene expression cassette and terminal inverted repeats flanking the CAR gene expression cassette. In some embodiments, the CAR gene expression cassette is loaded on a viral vector for infecting T cells, and the viral vector is injected into a patient to directly generate CAR-T in vivo.

[0120] The transformants obtained can be cultured in conventional methods for expression of the binding molecules encoded by the genes of the application. The culture medium used in the culturing can be selected from various conventional media, depending on the host cell used. The culturing is performed under conditions suitable for growth of the host cell. When the host cell has grown to an appropriate cell density, the cells are induced for a further period of time using a suitable method (e.g. temperature shift or chemical induction) for the selected promoter.

[0121] The polypeptides in the above methods can be expressed intracellularly, or on the cell membrane, or secreted outside the cell. If desired, the recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. Examples of these methods include, but are not limited to, conventional renaturation treatment, treatment with protein precipitants (salting-out method), centrifugation, osmotic lysis, ultratreatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC), and other various liquid chromatography techniques, and combinations of these methods.

[0122] Uses and methods

[0123] By constructing a nanobody library, the inventors screened for nanobodies and variants thereof that can bind CD22. The binding capacity of these antibodies to the antigen was verified by protein level binding assays, affinity assays, and competition blocking experiments and tissue cross reactivity.

[0124] All aspects of the binding molecules, encoding sequences, nucleic acid constructs, and cells described herein can be used to prepare a medicament for the prevention or treatment of various conditions and diseases described herein, which are diseases or conditions associated with CD22 expression, which refers to diseases directly or indirectly caused by abnormal expression of CD22, typically diseases caused by overexpression of CD22, such as cancer, including but not limited to: B-cell acute lymphoid leukemia ("BALL"), T-cell acute lymphoid leukemia ("TALL"), acute lymphocytic leukemia (ALL), chronic myelogenous leukemia (CML), chronic lymphocytic leukemia (CLL), non-Hodgkin's lymphoma, diffuse large B-cell lymphoma (DLBCL), multiple myeloma, follicular lymphoma, splenic, marginal zone lymphoma, mantle cell lymphoma, indolent B-cell lymphoma or Hodgkin's lymphoma, plasmablastic lymphoma, plasmacytoid dendritic cell neoplasm, relapsed or refractory acute lymphoblastic leukemia (r / r ALL), relapsed or refractory diffuse large B-cell lymphoma (r / r DLBCL), relapsed or refractory follicular lymphoma (r / r FL), and the like.

[0125] The binding molecules, nucleic acids, or cells of the present application can be administered alone or in combination with diluents and / or with other components such as related cytokines or cell populations as a pharmaceutical composition. In this respect, the pharmaceutical compositions can be prepared for administration by either the freeze-dried or aqueous solution form by mixing the active agent having the desired degree of purity with optional pharmaceutically-acceptable carriers, vehicles or diluents. The pharmaceutically-acceptable carriers, vehicles or diluents can include at least one of a buffer (e.g., neutral buffered saline, sulfate buffered saline), an antioxidant, a preservative, an isotonic agent, a stabilizer, a chelator (e.g., EDTA or glutathione), an adjuvant (e.g., aluminum hydroxide) and a surfactant, at the doses and concentrations employed. In addition, in order for the pharmaceutical compositions to be used for in vivo administration, they must be sterile. Sterility of the pharmaceutical compositions can be achieved by filtration through sterile filtration membranes.

[0126] In some embodiments, the pharmaceutical compositions can contain at least one additive of a cytotoxic agent, a chemotherapeutic agent, a cytokine, an immunosuppressive agent, a growth inhibitory agent, and an active agent required for the particular indication to be treated. The specific amount of additive added can be adjusted as necessary.

[0127] The pharmaceutical compositions of the present application can be administered in an "immunologically effective amount," an "anti-tumor effective amount," a "tumor-inhibiting effective amount," or a "therapeutic amount." By "treatment" is meant the use of the therapeutic regimens described herein by a subject to achieve at least one positive therapeutic effect (e.g., a reduction in the number of cancer cells, a reduction in tumor size, a reduction in the rate of infiltration of cancer cells into peripheral organs or a reduction in the rate of tumor metastasis or tumor growth). When referring to an "immunologically effective amount," an "anti-tumor effective amount," a "tumor-inhibiting effective amount," or a "therapeutic amount," the precise amount of the composition of the present application to be administered can be determined by a physician with consideration for a patient's (subject's) age, body weight, tumor size, extent of infection or metastasis and individual 4 from 10 9 cells / kg body weight, preferably from 10 5 to 10 6 cells / kg body weight. The T cell composition can also be administered multiple times at these dosages. The cells can be administered by using infusion techniques well known in the art of immunotherapy (see, e.g., Rosenberg et al., New Eng. J. of Med. 319: 1676, 1988). The optimal dosage and treatment regimen for a particular patient can be readily determined by monitoring the patient's disease signs and adjusting the treatment accordingly by one of skill in the medical arts.

[0128] Administration of the compositions can be carried out in any convenient manner, including by spray, injection, ingestion, infusion, implantation or transplantation. The compositions described herein can be administered to a patient subcutaneously, intradermally, intratumorally, intranodally, intraspinally, intramuscularly, by intravenous injection or intraperitoneally. The compositions can be injected directly into a tumor, lymph node or site of infection.

[0129] In some embodiments of the application, the compositions of the application can be combined with other therapies known in the art. Such therapies include, but are not limited to, chemotherapy, radiation therapy and immunosuppressive agents. For example, treatment can be combined with radiation or chemotherapy agents known in the art to treat CD22-mediated diseases.

[0130] As used herein, "anti-tumor effect" refers to a biological effect that can be indicated by a decrease in tumor volume, a decrease in the number of tumor cells, a decrease in the number of metastases, an increase in life expectancy, or an improvement in various physiological symptoms associated with cancer.

[0131] "Patient," "subject," "individual," and the like are used interchangeably herein to refer to a living organism, such as a mammal, that can elicit an immune response. Examples include, but are not limited to, humans, dogs, cats, mice, rats, and transgenic species thereof.

[0132] The application is further described in detail by reference to the following experimental examples. These examples are provided for purposes of illustration only, and are not intended to be limiting unless otherwise specified. Thus, the application should in no way be construed as being limited to the following examples, but rather should be construed to encompass any and all variations which become evident as a result of the teaching provided herein. The methods and reagents used in the examples are routine in the art unless otherwise specified.

[0133] Diagnosis, Detection and Kits

[0134] The binding molecules of the application, because of their high affinity for CD22, can be used in assays, such as binding assays, to detect and / or quantify CD22 expressed in tissues or cells. The binding molecules, such as single domain antibodies, can be used in studies to further investigate the role of CD22 in disease. Methods of detecting CD22 are generally as follows: obtaining a sample of cells and / or tissue; detecting the level of CD22 in the sample.

[0135] The CD22 binding molecules of the application can be used for diagnostic purposes to detect, diagnose or monitor diseases and / or conditions associated with CD22. The application provides for detecting the presence of CD22 in a sample using classical immunohistological methods known to those of skill in the art. Detection of CD22 can be carried out in vivo or in vitro. Examples of methods suitable for detecting the presence of CD22 include ELISA, FACS, RIA, and the like.

[0136] For diagnostic applications, the binding molecule, e.g., single domain antibody, is typically labeled with a detectable label group. Suitable label groups include, but are not limited to, the following: a radioisotope or radionuclide (e.g.,3H,14C,15N,35S,90Y,99Tc,111In,125I,131I), a fluorescent group (e.g., FITC, rhodamine, lanthanide phosphor), an enzymatic group (e.g., horseradish peroxidase, β-galactosidase, luciferase, alkaline phosphatase), a chemiluminescent group, a biotin group, or a predetermined polypeptide epitope recognized by a secondary reporter (e.g., a leucine zipper pair sequence, a binding site for a secondary antibody, a metal binding domain, an epitope tag), an MRI (magnetic resonance imaging) or CT (computerized tomography) contrast agent. Various methods for labeling proteins are known in the art and can be used to practice the present application.

[0137] Another aspect of the present application provides a method of detecting the presence of a test molecule that competes with the binding molecule of the present application for binding to CD22. An example of such an assay would involve detecting the amount of free binding molecule in a solution containing a certain amount of CD22 in the presence or absence of the test molecule. An increase in the amount of free binding molecule (i.e., binding molecule that is not bound to CD22) would indicate that the test molecule is able to compete with the binding molecule for binding to CD22. In one embodiment, the antibody is labeled with a label group. Alternatively, the test molecule is labeled and the amount of free test molecule is monitored in the presence or absence of the binding molecule.

[0138] The present application also provides a test kit for detecting the level of CD22, which kit comprises a CD22 binding molecule, a lysing medium for lysing the sample, and general reagents and buffers required for detection, such as various buffers, detection labels, detection substrates, etc. The test kit can be an in vitro diagnostic device.

[0139] The present application will be illustrated hereinafter in the context of specific examples. It is to be understood that these examples are merely illustrative and are not intended to limit the scope of the present application. The methods and materials used in the examples are those that are conventional in the art, unless otherwise specified.

[0140] Example

[0141] Example 1, immunization of a llama

[0142] 1.1 Preparation of immunogen:

[0143] According to the query of CD22 protein sequence on NCBI, Human Siglec-2 / CD22 Protein, Llama IgG2b Fc Tag protein (Acro / SI2-H525a) from ACRO company was purchased as the immunization protein, and the protein was identified, the electrophoresis band was correct, and the purity was > 90%.

[0144] 1.2 Llama immunization:

[0145] The first immunization antigen (CD22 Protein, Llama IgG2b Fc) was 400 μg, mixed with adjuvant (GERBU FAMA), and the llama was selected for subcutaneous injection at four points on the back, with an immunization amount of 1 mL per point. The second to tenth immunization: the amount of immunization antigen was 200 μg, and the llama was selected for subcutaneous injection at four points on the back, with an immunization amount of 1 mL per point. The interval between each immunization was one week.

[0146] 1.3 Serum titer detection:

[0147] 1.3.1 Protein level titer detection

[0148] CD22.His antigen was coated at 4°C overnight, after blocking and washing, gradient-diluted serum was added to the ELISA plate for incubation, then anti-llama IgG HRP (Abeam) antibody was used for incubation, after washing, TMB color developing liquid was added for color development, 2M HCl was used to terminate the reaction, then the OD450 nanometer absorbance value was detected by the enzyme label instrument. The experimental results are shown in Figure 1 After 7 times of immunization, the llama titer reached a high level (> 243000).

[0149] 1.3.2 Cell level titer detection

[0150] Raji cells were plated in a 96-well plate, with a cell amount of 3×10 5 cells / well. Then 3-fold gradient-diluted serum was used for incubation with the cells. After incubation and washing, anti-llama IgG PE (Jackson) antibody was added for incubation, after washing, the cells were resuspended with PBS, then the fluorescence intensity (MFI) was detected by flow cytometry (Beckman). The results are shown in Figure 2 After 7 times of immunization, the llama titer reached 80000 at the cell level.

[0151] Example 2, Construction and Screening of Nanobody Immunization Library for Antigen

[0152] (1) After 6 times of immunization, 100 mL of peripheral blood lymphocytes of the llama were extracted and total RNA was extracted. The extraction of RNA was carried out according to the instructions of RNAiso reagent of TAKARA company.

[0153] (2) With RNA as template, oligo dT as primer, and according to the reverse transcriptase instruction of TAKARA company, the first strand of cDNA was synthesized.

[0154] (3) The variable region coding gene of heavy chain antibody was obtained by nest PCR using PrimeSTAR high fidelity DNA polymerase. The variable region fragment of heavy chain antibody was amplified by nest PCR:

[0155] First round PCR:

[0156] Upstream primer: GTCCTGGCTGCTCTTCTACAAGGC

[0157] Downstream primer: GGTACGTGCTGTTGAACTGTTCC

[0158] The fragment between the guide peptide of heavy chain antibody and CH2 of antibody was amplified by annealing at 55℃ for 30 cycles. The DNA fragment of about 600 bp was recovered as the template for the second round of PCR.

[0159] Second round PCR:

[0160] Upstream primer: GATGTGCAGCTGCAGGAGTCTGGRGGAGG

[0161] Downstream primer: GGACTAGTGCGGCCGCTGGAGACGGTGACCTGGGT

[0162] The fragment between the FR1 region of heavy chain antibody and the long and short hinge regions (long fragment and short fragment) was amplified by annealing at 55℃ for 30 cycles. The target fragment was recovered. The result showed that the size of the fragment was about 500 bp, i.e. the electrophoresis band of nanobody gene was about 500 bp.

[0163] (4) The phagemid pME207 and the PCR amplification product were double digested with Sfi I and Not I (NEB) respectively. After recovery and quantification, the two fragments were ligated with T4 DNA ligase (TaKaRa) at a molar ratio of 1:3 at 16℃ overnight.

[0164] (5) After ethanol precipitation, the ligation product was dissolved in 100 μL sterile water. The E. coli TG1 was transformed by electroporation in ten times. After dilution, 100 μL of the bacteria liquid was spread on the ampicillin LB culture plate. The library capacity was calculated. The rest was spread on the ampicillin 2xYT culture plate at 37℃ for 13-16 h. After washing the bacterial lawn on the culture plate with 10 mL 2xYT medium, 25% glycerol was added to the final concentration. The mixture was aliquoted and stored at -80℃ for later use. The library capacity was 4.3x10 9To detect the insertion rate of the library, 48 clones were randomly selected for colony PCR, and the results showed that the insertion rate had reached more than 90%.

[0165] (6) Based on the calculated reservoir capacity, 10 times the reservoir capacity of live cells was inoculated into 200 mL of 2×YT (containing 2% glucose and 100 μg / mL ampicillin) and cultured at 37°C, 200 rpm until the OD600 reached 0.5. Helper phage was added at a multiplicity of infection of 20:1. The cells were allowed to stand at 37°C for 30 min and then incubated at 37°C, 200 rpm for 30 min. The culture was centrifuged and the pellet was resuspended in 200 mL of 2×YT (containing 100 μg / mL ampicillin and 50 μg / mL kanamycin). After overnight incubation at 37°C and 250 r / min, the supernatant was centrifuged at 8000 rpm, 5×PEG / NaCl solution was added, the culture was placed on ice for 60 min, and the supernatant was centrifuged at 8000 rpm for 30 min. The pellet was resuspended in 5 mL of PBS to obtain an anti-CD22 single domain heavy chain antibody (VHH) immune library. 10 μL was taken for titer determination, and the rest was aliquoted and stored at -80°C for later use.

[0166] (7) Using Human Siglec-2 / CD22 Protein, Llama IgG2b Fc Tag protein (Acro / SI2-H525a), CD22 was coated on the enzyme-labeled plate at 2 μg / mL, 100 μL per well, and placed at 4°C overnight. A negative control was also set up. The next day, 200 μL of 3% BSA was added to each of the five wells and blocked at room temperature for 2 hours. After 2 hours, the plate was washed three times with PBST (PBS containing 0.05% Tween 20). After washing the plate, 100 μL of phage (2 to 3 × 10 11 The cells were screened using a tfu-immunized camel nanobody phage display gene library) and allowed to react at room temperature for 1.5 hours. The supernatant after negative screening was then transferred to the target antigen-coated wells and allowed to react at room temperature for 1.5 hours. The cells were washed 12 times with PBST (PBS containing 0.05% Tween 20) to remove unbound phages. Phages specifically bound to CD22 were dissociated with Glycine (SIGMA), and the eluted phages were neutralized with Tris (Invitrogen, 1M, PH 8.0) and infected with TG1 in the logarithmic phase. After propagation and amplification, the next round of "adsorption-elution" was performed. The eluted phages were then infected with TG1, and IPTG (Thermo) was used to induce TG1 to express nanobodies. ELISA plates were coated with CD22 protein, and the supernatant was taken for ELISA detection. Clones with OD450>0.5 were selected for sequencing.

[0167] (8) After sequence analysis, a total of 14 clones that could bind to CD22 protein were obtained, as shown in Table 4.

[0168] Table 4 Clones binding to CD22 protein

[0169]

[0170]

[0171] Note: "-" means no binding, "+" means binding (OD450≤1.0), "++" means moderate binding (2>OD450>1), "+++" means strong binding (OD450>2).

[0172] Example 3, expression and purification of candidate antibodies

[0173] Nanobodies were constructed into pCDNA3.4-IgG4 vector, then expressed by ExpiCHO TM (Thermo Fisher) expression system, and the supernatant was collected after one week of expression for Protein A (GE) purification. Then the protein concentration was detected by Nanodrop, and the protein purity was detected by HPLC. The obtained protein purity and yield met the needs of subsequent experiments.

[0174] Example 4, characterization of candidate antibodies

[0175] Protein level affinity detection: the binding kinetics and affinity of heavy chain antibodies to human CD22.His antigen were determined using surface plasmon resonance technology (SPR). The purified antibodies were flowed through a sensor chip pre-fixed with protein A, and the antibodies were captured by protein A. Then 5 different concentrations of CD22.His protein were used as the flow phase, and the binding time and dissociation time were 30 min and 60 min respectively. The association rate (kon), dissociation rate (koff) and equilibrium constant (KD) were analyzed using Biacore Evaluation Software 2.0 (GE). The m971 antibody binding to CD22 protein was selected as a positive control (NBL526-BMK) (Xiaodong Xiao et al., 2009, mAbs, 1:3, 297-303). The results are shown in Table 5.

[0176] Table 5 Protein level affinity detection

[0177]

[0178]

[0179] Cell level affinity detection: CD22-expressing HEK293T cells were plated in 96-well plates at 3x10 5HEK293T CD22-Ш cells, after half an hour incubation, add detection secondary antibody anti-human IgG PE (Jackson Immuno Research, Code: 109-117-008, Lot: 145501) for incubation, then use CytoFLEX flow cytometer for detection. Calculate the EC50 of the antibody by fitting the curve. The results are shown in Table 4 and Table 5. Figure 3 and Table 6. Figures 3-6 The antibody number in Table 4 and Table 5 omits "NBL526-".

[0180] Table 6 Cell level affinity detection

[0181]

[0182]

[0183] (3) Detection of tumor cell CD22 binding: two tumor cells, Raji and Duadi, expressing CD22 were plated in 96-well plates at 3x10 5 HEK293T CD22-Ш cells, after half an hour incubation, add detection secondary antibody anti-human IgG PE (Jackson Immuno Research, Code: 109-117-008, Lot: 145501) for incubation, then use CytoFLEX flow cytometer for detection. Calculate the EC50 of the antibody by fitting the curve. The results are shown in Table 4 and Table 5. Figure 4 、 Figure 5 and Table 7.

[0184] Table 7 Tumor cell CD22 binding detection

[0185]

[0186] Example 5, epitope competition experiment

[0187] Instrument: Biacore T200 (GE), temperature: 25℃, buffer: 1x HBS-EP+ (10 mM HEPES, 150 mM NaCl, 3 mM EDTA and 0.05% v / v Surfactant P20, GE), flow rate: 30ul / min. CD22-His was dissolved in acetate buffer, pH 4.0 (Biacore Amine Coupling Kit, GE) to a final concentration of 10 ug / ml, and was immobilized on CM5 chip (GE) channel 2 (FC-2) according to the product manual of the Amine Coupling Kit, about 21 RU. Channel 1 (FC-1) was used as blank control. The candidate and BMK antibodies were diluted in 1x HBS-EP+ to the target concentration, and one of them was injected into the above-mentioned CD22-immobilized chip FC-1 and FC-2 to the saturation level, and then the other was injected to the saturation level to evaluate the competition between the two antibodies. After the injection of the second antibody was completed, the complex was dissociated for 400 s. Finally, the chip surface was regenerated by injecting 50 mM NaOH for 15 s. The data were processed using Biacore Evaluation Software 2.0 (GE), and the sensorgrams were recorded using double-reference subtraction, and the FC2-1 signal was recorded. The results are shown in Table 8. The results show that the epitopes of the candidate molecules and BMK are basically different, and there is basically no epitope cross between the selected candidate molecules.

[0188] Table 8: Epitope competition detection of candidate antibodies and m971 antibody

[0189]

[0190] Note: "C" means epitope competition, "N" means epitope non-competition.

[0191] Example 6, species cross test

[0192] Different species (human, cynomolgus monkey) CD22 proteins (ACROBiosystems) were coated on the enzyme-labeled plate at a concentration of 1 ug / ml and placed at 4℃ overnight. After blocking and washing, the diluted antibodies were added to the enzyme-labeled plate, and incubated at room temperature for 2 hours. After washing, goat anti-human IgG-Fc fragment antibody HRP (Bethyl) secondary antibody was added and incubated at room temperature for 1 hour. After washing, TMB color developing solution was added, and then the reaction was terminated with 2M HCl, and the OD450 value was read using an enzyme-labeled instrument.

[0193] Table 9: Antibody binding to human and cynomolgus monkey CD22 proteins

[0194] Antibody Number Human Monkey NBL526-241 +++ + NBL526-270 +++ - NBL526-275 +++ - NBL526-314 +++ ++ NBL526-590 ++ - NBL526-998 +++ - NBL526-1009 +++ +++ NBL526-1011 +++ +++ NBL526-BMK +++ -

[0195] Note: “-” indicates no binding, “+” indicates binding (OD450≤1.0), “++” indicates moderate binding (2>OD450>1), and “+++” indicates strong binding (OD450>2).

[0196] Example 7: Tissue Cross-Reactivity

[0197] 34 tissues were selected for frozen sections, dried at room temperature, and fixed with acetone. Blocking was performed using reagents A and B of the endogenous biotin blocking kit (Sangong, E674001). The biotin-labeled antibody sample was incubated for 30 minutes, washed, and then incubated with horseradish peroxidase-labeled streptavidin (Abcam, ab7403) for 15 minutes. DAB was used for color development and hematoxylin counterstaining, the slides were sealed with neutral plastic, and air-dried before microscopic examination. The positive control was Abcam Anti-CD22 antibody (ab112182), the negative control was a biotin-labeled IgG4 isotype control, BMK3 was CD22 (CN114107212A) in the CD19 / CD22 dual-target CAR-T of Autolus, and BMK4 was NCI m971. The results are shown in Table 10, indicating that NBL526-314 and NBL526-278 did not show obvious positive staining on the cells. NBL526-291 showed occasional positive lymphoid staining only in the spleen; NBL526-41, NBL526-65, NBL526-184, NBL526-241, NBL526-270, NBL526-275, and NBL526-590 all had good specificity. NBL526-601 showed extensive nonspecific staining in a variety of tissues. NBL526-BMK, NBL526-998, NBL526-1009, and NBL526-1011 showed positive lymphoid staining in the lymphocyte-rich tonsil tissue; occasional lymphoid staining was also observed in the spleen. NBL526-998 showed occasional positive lymphoid staining in the lymph nodes.

[0198] Table 10 Tissue cross-reactivity

[0199]

[0200]

[0201]

[0202]

[0203]

[0204]

[0205] Example 8: CD22 CAR-T

[0206] CAR-T preparation:

[0207] Fresh or frozen PBMCs (Aoneng) were electroporated using a Lonza 4D electroporator. The electroporation process was optimized according to the electroporator manual. 5 × 10 6 to 7×10 6 For PBMC cells, 6 μg of pC23S-CD22 plasmid was added to the cell suspension. 20 μg of PB mRNA (PB enzyme mRNA, the amino acid sequence of which is described in SEQ ID: 136) and 200 IU of RNase inhibitor were added to the electroporation system, and electroporation was performed using the FI-115 protocol. The electroporated PBMCs were added to 12-well plates containing 2 ml of 37°C pre-warmed AIM-V (+2% FBS) culture medium and cultured for 4-6 hours. The cells were then transferred to antigen-coated six-well plates (5 μg / ml CD28 antibody + 5 μg / ml CD22 antigen). The culture medium was replenished to 4 ml, and IL-2 was added to a final concentration of 500 IU / ml. The electroporated PBMCs were cultured in the above medium for 5 days before the first passage. Thereafter, passages were performed every 2-3 days, and CAR-T cell production was completed on day 13. PBMCs were cultured in AIM-V medium containing 2% FBS and 100 IU / ml IL-2 at a cell density of 5 × 10 5 / ml.

[0208] The pC23S-CD22 plasmid contains the coding sequence for the CD22 CAR (from N-terminus to C-terminus, it contains the CD8 signal peptide, CD22 nanobody, CD8 hinge region, CD28 transmembrane region, CD28 costimulatory domain, and CD3ζ intracellular signaling domain). Taking the NBL526-998 nanobody as an example, the amino acid sequence of the CD22 CAR is shown in SEQ ID: 137. The remaining nucleotide sequence of the pC23S-CD22 plasmid is shown in SEQ ID: 138. NCI m971 was used as a positive control (NBL526-BMK4). A total of three CD22 nanobody CAR-Ts and one BMK4 CAR-T were prepared, namely the CAR-Ts of NBL526-22, NBL526-998, and NBL526-1011.

[0209] CAR-T cell killing in vitro:

[0210] CAR-T cell killing effect on tumor cells was detected by xCELLigence RTCA device (Roche Applied Science, Canada) according to the device operation manual. 5000 target cells (CD22KO_Raji cell) were resuspended in 50ul culture solution and inoculated into the microplate of RTCA device. The tumor cells were cultured on the RTCA device for about 24h, and when the cell index (CI, indicating cell growth) reached about 1.5, different amounts of effector cells (CD22 CAR-T cells) were resuspended in 50ul culture solution according to different effector-target ratios (effector cells: target cells), mixed with tumor cells, and continued to be cultured on the RTCA device for 3-5 days. Cell killing curve was recorded by RTCA device, and data was analyzed by RTCA Pro 2.3.0 software. Figure 6 After 96h of CAR-T killing tumor cells at different effector-target ratios (left 16:1 and right 8:1 in each group of columns in the figure), different degrees of tumor cell lysis were caused. Compared with Mock-T and CD22BMK4, NBL526-99 nanobody CAR-T had the best tumor lysis rate.

[0211] The above only describes the preferred embodiments of the present application and is not intended to limit the present application. For those skilled in the art, the present application can have various modifications and changes. Any modification, equivalent replacement, improvement, etc. within the spirit and principles of the present application shall be included in the protection scope of the present application.

[0212] Part of the sequence in this paper

[0213]

[0214]

Claims

1. A CD22 binding molecule comprising an anti-CD22 nanobody or an antigen-binding fragment thereof, wherein the complementarity determining region (CDR) of the anti-CD22 nanobody comprises CDR1, CDR2 and CDR3, wherein the CDR1 comprises the sequence shown in any one of SEQ ID NOs: 1-20, the CDR2 comprises the sequence shown in any one of SEQ ID NOs: 21-37, and the CDR3 comprises the sequence shown in any one of SEQ ID NOs: 38-58, Preferably, the CDR1, CDR2 and CDR3 contained in the anti-CD22 nanobody are the sequences shown in the group of CDR1, CDR2 and CDR3 shown in SEQ ID NO in any row of Table 1.

2. The CD22 binding molecule according to claim 1, wherein The FR1 of the anti-CD22 nanobody comprises a sequence as shown in any one of SEQ ID NOs: 59-72; FR2 comprises a sequence as shown in any one of SEQ ID NOs: 73-89; FR3 comprises a sequence as shown in any one of SEQ ID NOs: 90-106; FR4 comprises a sequence as shown in any one of SEQ ID NOs: 107-112, and / or The heavy chain variable region sequence of the anti-CD22 nanobody is as shown in any one of SEQ ID NOs: 113-134, and / or The CD22 binding molecule is a monovalent or multivalent nanobody or single domain antibody, or a multispecific nanobody or single domain antibody comprising one, two or more anti-CD22 nanobodies or antigen-binding fragments thereof, and / or The Nanobody further comprises a heavy chain constant region, and / or The CD22 binding molecule is a chimeric antibody or a fully human antibody.

3. A fusion protein comprising the CD22 binding molecule according to any one of claims 1 or 2 and another polypeptide, Preferably, the other polypeptide is located at the N-terminus and / or C-terminus of the binding molecule, Preferably, the other polypeptide is selected from polypeptides that localize the binding molecule to different organelles, tags for purification or tags for immune response, transmembrane proteins or their transmembrane regions, chimeric antigen receptors or their components, more preferably, the fusion protein is a chimeric antigen receptor.

4. A nucleic acid molecule having a sequence selected from any one of the following: (1) The coding sequence of the CD22-binding molecule according to any one of claims 1 or 2 or the fusion protein according to claim 3; (2) The complementary sequence of (1); (3) A 5-50 bp fragment of any sequence in (1) or (2), Preferably, the fragment is a primer.

5. A nucleic acid construct comprising the nucleic acid molecule according to claim 4, Preferably, the nucleic acid construct is a cloning vector, an expression vector or an integration vector.

6. A phage comprising the CD22-binding molecule according to any one of claims 1 or 2 or the fusion protein according to claim 3.

7. A host cell selected from: (1) expressing and / or secreting the CD22 binding molecule according to any one of claims 1 or 2 or the fusion protein according to claim 3; (2) comprising the nucleic acid molecule according to claim 4; and / or (3) comprising the nucleic acid construct according to claim 5, Preferably, the host cell is an immune effector cell, more preferably a T cell.

8. A method for producing the CD22-binding molecule of any one of claims 1 or 2 or the fusion protein of claim 3, comprising: Culturing the host cells described herein under conditions suitable for producing the CD22 binding molecule or the fusion protein, and optionally purifying the CD22 binding molecule from the culture, or The nucleic acid molecule encoding the CD22 binding molecule or the fusion protein is incubated under conditions suitable for translation of DNA or RNA in a cell-free system (eg, solution).

9. A pharmaceutical composition comprising the CD22-binding molecule of any one of claims 1 or 2 or the fusion protein of claim 3, the nucleic acid molecule of claim 4, the nucleic acid construct of claim 5, the phage of claim 6 or the host cell of claim 7, and a pharmaceutically acceptable excipient.

10. Use of the CD22 binding molecule according to any one of claims 1 or 2, the fusion protein according to claim 3, the nucleic acid molecule according to claim 4, the nucleic acid construct according to claim 5, the phage according to claim 6, or the host cell according to claim 7 in preparing activated immune cells. Preferably, the immune cells are T cells.

11. Use of the CD22 binding molecule according to any one of claims 1 or 2, the fusion protein according to claim 3, the nucleic acid molecule according to claim 4, the nucleic acid construct according to claim 5, the phage according to claim 6, or the host cell according to claim 7 in the preparation of a medicament for preventing or treating a disease or condition associated with CD22 expression. Preferably, the disease or condition is cancer.

12. A kit for detecting CD22, comprising the CD22 binding molecule according to any one of claims 1 or 2 or the fusion protein according to claim 3, the nucleic acid molecule according to claim 4, the nucleic acid construct according to claim 5, or the host cell according to claim 7, Preferably, the kit further comprises a reagent for detecting the binding of CD22 to the CD22 binding molecule. More preferably, the binding detection agent is a detectable label that can be linked to the CD22 binding molecule.

13. A non-diagnostic method for detecting the presence of CD22 in a sample, the method comprising: The CD22 binding molecule according to any one of claims 1 or 2 or the fusion protein according to claim 3 is incubated with the sample, and the binding of CD22 to the CD22 binding molecule is detected to determine the presence of CD22 in the sample, wherein the detection is preferably an enzyme-linked immunosorbent assay.

14. Use of the CD22-binding molecule according to any one of claims 1 or 2, the fusion protein according to claim 3, the nucleic acid molecule according to claim 4, the nucleic acid construct according to claim 5, or the host cell according to claim 7 in the preparation of a kit for detecting CD22 in a sample, evaluating the efficacy of drug treatment, or diagnosing cancer.

Images