TLR4 targeted nucleic acid aptamer, conjugate thereof and application of TLR4 targeted nucleic acid aptamer in preparation of medicine for preventing and treating xerophthalmia

Abstract

The invention relates to the technical field of biological medicine, in particular to a TLR4 targeted nucleic acid aptamer, a conjugate of the TLR4 targeted nucleic acid aptamer and application of the TLR4 targeted nucleic acid aptamer in preparation of drugs for preventing and treating xerophthalmia. The TLR4 targeted nucleic acid aptamer is high in specificity and affinity, and the TLR4 targeted nucleic acid aptamer and an E3 ligase ligand (CRBN ligand) are covalently linked through click chemistry (azide-alkyne cycloaddition reaction) to form a conjugate. The conjugate can be directionally combined with a TLR4 protein and recruits an E3 ubiquitin ligase complex, and TLR4 degradation is realized through a ubiquitin-proteasome system. Compared with a traditional anti-inflammatory inhibitor, the conjugate provided by the invention can more effectively prevent and / or treat xerophthalmia by accurately removing inflammation signal hub protein TLR4, regulating immune cell polarization and improving ocular surface microenvironment steady state.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological medicine, and particularly relates to a TLR4-targeting nucleic acid aptamer, a conjugate thereof and application of the TLR4-targeting nucleic acid aptamer and the conjugate thereof in preparing a medicament for preventing and treating dry eye. BACKGROUND

[0002] Dry eye is a multifactorial disease due to a loss of balance in the tear film homeostasis and ocular surface damage, leading to eye discomfort and visual disturbance, with characteristics of tear film instability and hyperosmolarity and inflammation as a major cause. Overuse of digital devices and deepening of aging will lead to more patients with dry eye disease, which seriously affects people's quality of life. However, dry eye is a systemic and multifactorial disease, and the lack of basic theoretical research makes the treatment of dry eye limited.

[0003] The types of dry eye drugs currently mainly include artificial tears, corneal repair drugs, mucin secretion promoting drugs and anti-inflammatory drugs. (1) Artificial tears are the most commonly used dry eye treatment drugs. In addition to water and salt, artificial tears also contain a small amount of polymers such as sodium hyaluronate, carboxymethyl cellulose, hydroxypropyl methyl cellulose and hydroxypropyl cellulose. It is a kind of eye drops developed by imitating the composition of human tears, and its efficacy is usually limited to mild dry eye. (2) Corneal repair drugs can be used for light to moderate dry eye caused by corneal epithelial defects and punctate keratopathy by stimulating the proliferation and migration of corneal epithelial cells and accelerating the repair of damage. For example, Belos, RGN 259. (3) Mucin secretion promoting drugs can improve dry eye symptoms by promoting the secretion of mucin and tears, so as to restore the tear film to normal. However, the above drugs can only temporarily relieve symptoms and cannot solve the underlying cause.

[0004] Dry eye patients with tear secretion and drainage system dysfunction can cause tear film component balance to be destroyed to cause ocular surface inflammation to occur. Anti-inflammatory drugs are a broad-spectrum ophthalmic drug that can inhibit the action of inflammatory mediators in dry eye to reduce dry eye symptoms. For example, cyclosporine A is currently the most important drug for the treatment of dry eye disease in the world, which can inhibit the apoptosis of lacrimal gland acinar cells and conjunctival goblet cells, promote the apoptosis of lymphocytes, inhibit the inflammatory response of the ocular surface, enhance the immune function of corneal cells, thereby promoting tear secretion and playing a role in treating dry eye. However, the therapeutic effect of such drugs is limited and has many side effects, such as corneal epithelial defects, periorbital dermatitis, allergies, corneal epithelial punctate lesions and other adverse reaction symptoms. The anti-inflammatory drugs for dry eye on the market are essentially inhibitors, such as cyclosporine A, which is a calcineurin inhibitor, and Tanfanercept, which is a TNF-alpha inhibitor. However, the above drugs are based on the traditional strategy of "inhibiting enzyme activity" or "antagonizing receptors", which has two common defects: (1) continuous occupation of the target is required to maintain efficacy, leading to drug resistance; (2) interfering with physiological repair signals (such as the IL-10 / TGF-beta pathway), leading to immune monitoring imbalance. Therefore, the treatment of dry eye still faces great challenges, and new drug development is necessary. Research has found that at the initial stage of dry eye, TLR4, as the core hub of the inflammatory cascade reaction of dry eye, is positively correlated with the degree of ocular surface damage. The expression of IL-12a in the conjunctiva is enhanced after the activation of the protein, which can promote Th1 differentiation and lead to the worsening of ocular surface disease. Although traditional small molecule inhibitors can temporarily block receptor activation signals, they cannot eliminate the continuous activation of pre-existing proteins. The present application first introduces the PROTAC technology into ophthalmic drug design, and realizes the root regulation of the inflammatory microenvironment through nucleic acid aptamer-mediated TLR4 targeted degradation. SUMMARY

[0005] Therefore, the present application provides a TLR4-targeted nucleic acid aptamer, a conjugate thereof, and the use thereof in the preparation of a drug for preventing and treating dry eye. The TLR4-targeted nucleic acid aptamer provided by the present application has high specificity and high affinity. The PROTAC molecule made of the TLR4-targeted nucleic acid aptamer and a ligand targeting E3 ligase can trigger endocytosis, efficiently deliver the PROTAC to the intracellular to achieve ubiquitination and degradation of TLR4, and ultimately effectively prevent and treat dry eye (i.e., xerophthalmia).

[0006] The present application screens a high-affinity TLR4-targeted nucleic acid aptamer, which has a nucleotide sequence as shown in SEQ ID NO: 1 or a nucleotide sequence having at least 80% homology thereto.

[0007] The present application also provides a TLR4 nucleic acid aptamer conjugate comprising the TLR4 nucleic acid aptamer and an E3 ligase ligand.

[0008] The PROTAC technology is an innovative molecular design strategy for disease treatment by inducing ubiquitination and degradation of target proteins. A prerequisite for the efficacy of PROTAC is that it must cross the cell membrane into the cytoplasm. This characteristic seriously limits the application of the technology in membrane-bound proteins (such as Toll-like receptor 4, TLR4). As a typical type I transmembrane protein, the extracellular domain of TLR4 is anchored to the cell membrane. The transmembrane efficiency of traditional PROTAC is extremely low due to passive diffusion, and it lacks active internalization mechanism, resulting in insufficient intracellular effective concentration to start the degradation program.

[0009] The present application discloses a TLR4 aptamer with good internalization effect. The TLR4 aptamer is covalently coupled with a ligand small molecule targeting E3 ligase to form a bifunctional molecule (or called TLR4 aptamer conjugate, PROTAC molecule) for protein degradation targeting chimera technology (PROTAC). The bifunctional molecule specifically recognizes the extracellular domain of TLR4 through high-affinity aptamer and triggers endocytosis, efficiently delivering PROTAC into the cell to achieve ubiquitination and degradation of TLR4 (the degradation efficiency in vitro is 62% to 81%, which is 2 to 6 times higher than that of free aptamer). The present application attempts to use other target aptamers and other sequences of TLR4 aptamers, and finds that other aptamers (such as PD-1 aptamer) and other TLR4 aptamers do not have similar internalization effect. This strategy not only breaks through the technical barrier of membrane protein degradation, but also avoids the transmembrane limitation of traditional PROTAC through receptor-mediated endocytosis pathway, and shows significant efficacy in dry eye model mice, providing a new solution for eye microenvironment regulation related to TLR4 overactivation.

[0010] In the present application, the TLR4 aptamer and the E3 ligase ligand are connected by a chemical click reaction. Further, the chemical click reaction includes copper-free azide-alkyne cycloaddition, copper-catalyzed azide-alkyne cycloaddition, or tetrazine trans-cyclooctene cycloaddition.

[0011] In some embodiments, the chemical click reaction is copper-free azide-alkyne cycloaddition; the 3' end of the TLR4 aptamer is connected with a dibenzocyclooctyne group, and the modified azide group at the end of the E3 ligase ligand.

[0012] In the TLR4 aptamer conjugate of the present application, the E3 ligase ligand is a CRBN ligand. The CRBN ligand includes thalidomide, lenalidomide, or pomalidomide, or a derivative of any of the foregoing. In specific embodiments of the present application, the CRBN ligand is thalidomide, and the modified CRBN ligand is Thalidomide-O-amido-C4-N3.

[0013] The application also provides a preparation method of the TLR4 nucleic acid aptamer conjugate, comprising the following steps:

[0014] obtaining an E3 ligase ligand and a TLR4 nucleic acid aptamer which are respectively modified at the terminal with an azido group and a dibenzocyclooctyne group, or a TLR4 nucleic acid aptamer and an E3 ligase ligand which are respectively modified at the terminal with a dibenzocyclooctyne group and an azido group;

[0015] mixing the modified TLR4 nucleic acid aptamer and the modified E3 ligase ligand to perform a chemical click reaction, and obtaining the TLR4 nucleic acid aptamer conjugate.

[0016] In the application, the chemical click reaction is performed under constant temperature oscillation conditions. The temperature of the chemical click reaction is 37°C. The time of the chemical click reaction is 0.5-24h, and specifically can be 0.5h, 1h, 2h, 4h, 8h, 12h or 24h, and preferably 12h.

[0017] The application also provides application of the TLR4 nucleic acid aptamer conjugate in preparation of a medicine for preventing and / or treating dry eye.

[0018] In the application, the prevention and / or treatment includes recovery of lacrimal gland function, promotion of corneal tissue damage repair and / or improvement of corneal inflammatory microenvironment, and is specifically achieved through at least one aspect of (1)-(2) as follows:

[0019] (1) targeted degradation of TLR4 of corneal epithelial cells to hinder activation of downstream inflammatory signal pathways;

[0020] (2) inhibition of M1 macrophage polarization to reduce secretion of inflammatory cytokines and reconfigure the corneal inflammatory microenvironment.

[0021] In the application, the effective concentration of the TLR4 nucleic acid aptamer conjugate is 1-5μM.

[0022] The application also provides a medicine for preventing and treating dry eye, which comprises the TLR4 nucleic acid aptamer conjugate as described above.

[0023] The dosage form of the medicine comprises eye drops and gels.

[0024] The medicine described in the application also comprises a pharmaceutically acceptable excipient. The application does not have special requirements for the specific type of excipient, and the type commonly used in the art can be selected according to the dosage form.

[0025] The application also provides eye drops for preventing and treating dry eye, which comprise the TLR4 nucleic acid aptamer conjugate as described above.

[0026] The application also provides a preparation method of the eye drops, which comprises steps S1-S3.

[0027] S1, mixing the modified TLR4 aptamer and a first solvent to obtain a first solution;

[0028] S2, mixing the modified E3 ligase and a second solvent to obtain a second solution;

[0029] S3, mixing the first solution and the second solution to perform a chemical click reaction to obtain a product containing the TLR4 aptamer conjugate.

[0030] In step S1 of the present application, the first solvent (i.e., the binding solution) is a PBS buffer containing Ca 2+ , Mg 2+ , or sterile water.

[0031] In step S2 of the present application, the second solvent is a PBS buffer or artificial tears. The present application does not have special restrictions on the specific formula of artificial tears, and common ones in the art can be used, such as sterile purified water containing 0.65 mM calcium chloride monohydrate, 18.51 mM potassium chloride, 25.95 mM sodium bicarbonate, and 116.02 mM sodium chloride.

[0032] In step S3 of the present application, the chemical click reaction is performed under constant temperature and shaking conditions. In the present application, the temperature of the chemical click reaction is 37℃. In the present application, the time of the chemical click reaction is 0.5-24h, and specifically can be 0.5h, 1h, 2h, 4h, 8h, 12h, 24h, and preferably 12h, 24h, or any time value between 12h and 24h. Experiments show that incubation for 12h already has a relatively optimal TLR4 degradation effect, and the effect of incubation for 12h-24h has no significant difference.

[0033] In some embodiments, in step S3, the first solution and the second solution are mixed at a molar ratio of 1:(1-10) of the modified TLR4 aptamer and the modified E3 ligase; and the molar ratio can be specifically 1:1, 1:5, or 1:10.

[0034] In the present application, the specific concentration and mixing volume of the first solution and the second solution can be determined according to actual conditions or experimental requirements, and mixing at a molar ratio of 1:(1-10) of the modified TLR4 aptamer and the modified E3 ligase is sufficient.

[0035] In some embodiments, in step S1, the concentration of the modified TLR4 aptamer in the first solution is preferably 1-10μM, and can be specifically 1μM, 2μM, 3μM, 5μM, 6μM, or 10μM.

[0036] In some embodiments, the concentration of the modified E3 ligase ligand in the second solution in step S2 is preferably 2-20 μM, and can be 2 μM, 4 μM, 6 μM, 8 μM, 10 μM, 15 μM, 20 μM, in particular.

[0037] In some embodiments, the volume ratio of the mixture in step S2 is 1:1.

[0038] In some embodiments, the first solution and the second solution are mixed in step S3 according to a molar ratio of 1:1 or 1:10 of the modified TLR4 aptamer and the modified E3 ligase ligand. In one embodiment, the concentration of the first solution and the second solution is 2 μM and 20 μM, respectively, and they are mixed in a volume ratio of 1:1, i.e. a molar ratio of 1:10. In another embodiment, the concentration of the first solution and the second solution is both 2 μM, and they are mixed in a volume ratio of 1:1, i.e. a molar ratio of 1:1.

[0039] The application also provides another preparation method of the eye drops, which comprises step S4:

[0040] S4, mixing the TLR4 aptamer conjugate or the TLR4 aptamer conjugate prepared by the preparation method of the application and a pharmaceutically acceptable adjuvant.

[0041] In one embodiment, the pharmaceutically acceptable adjuvant comprises at least one of water, PBS buffer, sodium chloride, phosphate buffer, and sodium hyaluronate.

[0042] In the preparation method of the application, step S3 further comprises the following steps before the mixing: annealing the first solution at 95℃ for 5 minutes, and cooling and renaturing at 0-4℃ for 30-60 minutes. In the application, the cooling and renaturing temperature can be 0℃, 1℃, 2℃, 3℃, or 4℃. In the application, the cooling and renaturing time can be 30 minutes, 35 minutes, 40 minutes, 45 minutes, 50 minutes, 55 minutes, or 60 minutes. In the application, there is no special requirement for the equipment providing the 95℃ constant temperature condition, which can be a constant temperature metal bath or a constant temperature water bath, or a constant temperature shaker, etc.

[0043] In the application, the water involved is sterile pure water.

[0044] The application also provides a method for preventing and treating dry eye, which comprises administering the TLR4 aptamer conjugate or the eye drops for preventing and treating dry eye of the application. In the application, the eye drops and the TLR4 aptamer conjugate are as described above.

[0045] The application provides a TLR4-targeting nucleic acid aptamer, a conjugate thereof and application of the TLR4-targeting nucleic acid aptamer and the conjugate thereof in preparation of prevention and treatment of dry eye. The TLR4-targeting nucleic acid aptamer has high specificity and high affinity, is covalently connected with an E3 ligase ligand (CRBN ligand) through click chemistry (azido-alkyne cycloaddition) to form a conjugate. The conjugate can be directionally combined with TLR4 protein and recruit an E3 ubiquitin ligase complex, so that TLR4 degradation is realized through a ubiquitin-proteasome system. Compared with traditional anti-inflammatory inhibitors, the conjugate can more effectively prevent and / or treat dry eye by accurately removing the inflammatory signal hub protein TLR4, regulating immune cell polarization and improving ocular surface microenvironment homeostasis.

[0046] Compared with the existing treatment scheme, the application has at least one of the following technical effects:

[0047] (1) The nucleic acid aptamer conjugate drug is synthesized through azido-alkyne cycloaddition reaction in one step, so that the preparation process does not require large instruments, the cost is low, the synthesis process is simple and large-scale production is facilitated.

[0048] (2) The TLR4-targeting nucleic acid aptamer has high specificity and high affinity and has internalization, so that the TLR4 nucleic acid aptamer conjugate prepared in this way can specifically recognize the extracellular domain of TLR4 and trigger endocytosis, efficiently deliver the PROTAC to the intracellular to realize ubiquitination degradation of TLR4, the degradation efficiency in vitro reaches 62-81%, which is 2-6 times higher than that of free nucleic acid aptamer, and has a significant prevention and treatment effect on dry eye. BRIEF DESCRIPTION OF DRAWINGS

[0049] Figure 1 It is a structure and treatment schematic diagram of the TLR4-targeting nucleic acid aptamer conjugate eye drop;

[0050] Figure 2 It is a confocal fluorescence imaging image of combination of the TLR4 nucleic acid aptamer and macrophages in Example 1, wherein green light is TLR4 nucleic acid aptamer labeled fluorescence;

[0051] Figure 3 It is a verification of internalization of the TLR4 nucleic acid aptamer in RAW264.7 cells in Example 1;

[0052] Figure 4 It is a verification of conjugation and proportion optimization of the TLR4 nucleic acid aptamer and the E3 ligase ligand in Example 1;

[0053] Figure 5 It is a TLR4 degradation effect of the TLR4 nucleic acid aptamer conjugate eye drop on HCE-T cells in Example 1;

[0054] Figure 6TLR4 nucleic acid aptamer conjugate eye drops of different concentrations in Example 1 on the degradation effect of TLR4 of macrophages;

[0055] Figure 7 TLR4 nucleic acid aptamer conjugate eye drops of different concentrations and time in Example 1 on the degradation effect of TLR4 of macrophages;

[0056] Figure 8 TLR4 nucleic acid aptamer conjugate eye drops in Example 2 on the degradation effect of TLR4 of dry eye model mice, wherein the brownish yellow signal is TLR4 protein;

[0057] Figure 9 Immune cell infiltration in the cornea of dry eye model mice after treatment in Example 2, wherein blue is a cell nucleus marker fluorescence, green is a M1 macrophage marker fluorescence, and red is a M2 macrophage marker fluorescence;

[0058] Figure 10 Inflammation factor content chart in the cornea of dry eye model mice after treatment in Example 2;

[0059] Figure 11 Tear secretion chart of dry eye model mice after treatment in Example 2;

[0060] Figure 12 Fluorescein sodium score of dry eye model mice after treatment in Example 2;

[0061] Figure 13 Corneal thickness change chart of dry eye model mice after treatment in Example 2. DETAILED DESCRIPTION

[0062] The present application provides a TLR4 targeted nucleic acid aptamer, its conjugate and its application in the preparation of drugs for preventing and treating dry eye. Those skilled in the art can improve the process parameters according to the content of the present application. It should be particularly pointed out that all similar substitutions and changes are obvious to those skilled in the art, and they are considered to be included in the present application. The methods and applications of the present application have been described by preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications herein without departing from the content, spirit and scope of the present application, to realize and apply the present application technology.

[0063] Unless otherwise specified, the test materials used in the present application are ordinary commercially available products, which can be purchased in the market.

[0064] The sequence information involved in the present application is as follows:

[0065] The nucleotide sequence of the TLR4 nucleic acid aptamer of the application is: GAGCATAAATCCCGGTTGGCT CATGTACGATTGCGCCGCTATACCAAATAACCGTGTGGAGTA (SEQ ID NO: 1).

[0066] The sequence of the PD-1 nucleic acid aptamer is: CGCACTATGTTTTACGAGCCGTTTCCTCG GCAGATAGTAAGTGCG (SEQ ID NO: 2).

[0067] The experimental supplies and detailed verification steps involved in the present specific embodiment are as follows:

[0068] (1) Chemical reagents: The nucleic acid sequences used in the experiment (see Table 1) were synthesized by Shanghai Shengong Biotechnology Co., Ltd. and purified by HPLC. Anti-fluorescence quenching mounting fluid, PBS, ammonium persulfate, 30% acrylamide, TBE, 4% paraformaldehyde, Western, and IP cell lysis buffer, Western transfer buffer, SDS-PAGE electrophoresis buffer were all purchased from Shanghai Biyun Tian Technology Co., Ltd. Dnase I was purchased from China Solabio Company. Lipopolysaccharide and bovine serum albumin were purchased from Sigma-Aldrich Company, USA. OTC gel was purchased from Japan Sakura. TLR4 antibody was purchased from Santa Cruz, USA. β-actin was purchased from CST, USA. Thalidomide-O-amido-C4-N3 was purchased from MCE, USA. Benzalkonium chloride (BAC) and sodium fluorescein were purchased from AbMole, USA. Phenol red cotton thread for tear detection was purchased from China Jingming New Technology Development Co., Ltd. CD206 antibody, CD86 antibody, and HE staining solution kit were purchased from Wuhan Saiver Biological Technology Co., Ltd. ELISA detection kit was purchased from Hangzhou Lianke Biological Technology Co., Ltd. Ultra-pure water was prepared by a Milli-Q water purification system (18.2 MΩ).

[0069] (2) Cell purchase: Human corneal epithelial cells (HCE-T) were purchased from Zhejiang Meisen Cell Technology Co., Ltd., and mouse monocyte macrophages (RAW264.7) were purchased from the Cell Bank of Shanghai Institute of Life Sciences, Chinese Academy of Sciences. HCE-T was cultured in DMEM / F-12 medium containing 10% FBS, 1% double antibody, 0.01% 100 μg / mL HEGF, and 0.05% 10 mg / mL recombinant human insulin. RAW264.7 was cultured in DMEM medium containing 10% FBS, 1% double antibody, 1% glutamine, and 1% sodium pyruvate. All cells were placed in a CO2 incubator and cultured at a constant temperature of 37°C and a CO2 concentration of 5%.

[0070] (3) Mouse purchase: 6-8 weeks C57BL6J strain mice are purchased from Fuzhou Wu's Experimental Animal Trading Co., Ltd.

[0071] Specifically, the preparation process of the eye drop of the TLR4-targeting nucleic acid aptamer in the application is as follows: (1) the TLR4 nucleic acid aptamer is diluted to the required concentration for the experiment, annealed in a constant-temperature metal bath at 95 DEG C for 5 minutes, and then renatured on ice for 30 minutes; (2) the E3 ligase ligand stock solution is diluted with PBS; (3) the TLR4 nucleic acid aptamer and the E3 ligase ligand are mixed according to a 1:1 assembly ratio, and placed in a constant-temperature incubation shaker for reaction at 37 DEG C for 12 hours.

[0072] Further, the conjugate prepared by the above method is subjected to SDS-PAGE gel to verify the conjugation effect.

[0073] Further, the nucleic acid aptamer conjugate is verified for degradation of cell TLR4 protein.

[0074] The structure and treatment schematic diagram of the eye drop of the TLR4-targeting nucleic acid aptamer prepared in the application are shown in Figure 1 .

[0075] The results show that the nucleic acid aptamer conjugate can inhibit M1 macrophage polarization by degrading TLR4 of corneal epithelial cells, reconfigure the corneal inflammatory microenvironment, and has a significant therapeutic effect on dry eye of the mouse dry eye model.

[0076] The application is further described below in combination with examples:

[0077] Example 1

[0078] Preparation method of the TLR4-targeting nucleic acid aptamer conjugate eye drop:

[0079] (1) The TLR4 nucleic acid aptamer-DBCO dry powder is centrifuged at room temperature (4000 rpm, 1 minute). The ultrapure water is used to prepare a 100 muM stock solution.

[0080] (2) The TLR4 nucleic acid aptamer stock solution is diluted with a binding solution (1 mM Ca 2+ , 3 mM Mg 2+ PBS) to the required concentration (1 muM, 2 muM, 3 muM, 5 muM, 6 muM, 10 muM) for the experiment, and then annealed in a constant-temperature metal bath at 95 DEG C for 5 minutes, and then renatured on ice for 30 minutes to obtain the TLR4 nucleic acid aptamer-DBCO solution.

[0081] (3) The E3 ligase ligand (Thalidomide-O-amido-C4-N3) stock solution (solvent: sterile water) is diluted with PBS to 2 muM, 6 muM, 10 muM, and 20 muM.

[0082] The 2 μM TLR4 aptamer-DBCO solution was mixed with 2 μM and 20 μM E3 ligase ligand respectively according to a volume ratio of 1:1 (also referred to as assembly ratio herein), and reacted at 37°C for 12 hours with oscillation, to obtain eye drops 1 and eye drops 2 of the application, which were used in subsequent experiments.

[0083] In the eye drops 1, the molar ratio of the reaction system of the TLR4 aptamer and the E3 ligase ligand was 1:1, and the concentration of the TLR4 aptamer-E3 ligase conjugate was 1 μM. In the eye drops 2, the molar ratio of the reaction system of the TLR4 aptamer and the E3 ligase ligand was 1:10, and the conjugation molar ratio was 1:1, which was prepared from 2 μM TLR4 aptamer-DBCO solution and 20 μM E3 ligase ligand according to a volume ratio of 1:1. The concentration of the prepared conjugate eye drops was 1 μM.

[0084] The 6 μM TLR4 aptamer-DBCO solution was mixed with 6 μM E3 ligase ligand according to a volume ratio of 1:1, and reacted at 37°C for 12 hours with oscillation, to obtain eye drops 3 of the application, i.e. a nucleic acid aptamer conjugate eye drop with a concentration of 3 μM, which was used in subsequent experiments.

[0085] The 10 μM TLR4 aptamer-DBCO solution was mixed with 10 μM E3 ligase ligand according to a volume ratio of 1:1, and reacted at 37°C for 12 hours with oscillation, to obtain eye drops 4 of the application, i.e. a nucleic acid aptamer conjugate eye drop with a concentration of 5 μM, which was used in subsequent experiments.

[0086] The TLR4 aptamer-DBCO solution and the E3 ligase ligand solution were mixed according to an assembly ratio of 1:1 in terms of volume ratio, and reacted at 37°C for 12 hours with oscillation, to obtain the eye drops of the application.

[0087] The base sequence of the modified TLR4 aptamer involved in this embodiment is as follows:

[0088] Table 1 Base sequence of the TLR4 aptamer used in Example 1

[0089]

[0090]

[0091] (I) Related experimental process

[0092] A. TLR4 aptamer and cell binding verification:

[0093] 5.0×10 4RAW264.7 cells were seeded in confocal dish for 24 hours, then 1 pg / mL of lipopolysaccharide (LPS) was added to stimulate for 24 hours, the supernatant was discarded and 400 nM of TLR4 aptamer-Cy3 was added to incubate with cells at 37 °C for 20 minutes in the dark. After incubation, cells were washed with PBS once and imaged by confocal microscopy.

[0094] B. Verification of TLR4 aptamer internalization:

[0095] 3.0 x 10 4 RAW264.7 cells were seeded in 24-well plates for 24 hours, then 1 pg / mL of lipopolysaccharide (LPS) was added to stimulate for 24 hours, the supernatant was discarded and 400 nM of Cy3-TLR4-DBCO and Cy3-PD-1-DBCO aptamer was added to incubate with cells at 37 °C for 20 minutes in the dark. After incubation, 0.5 U / pL of Dnase I was added to incubate with cells at 37 °C for 6 minutes in the dark, and then the cells were washed with PBS and digested. The cells were analyzed by flow cytometry.

[0096] C. Characterization of TLR4 aptamer and E3 ligase ligand coupling and ratio optimization:

[0097] 2 mM TLR4 aptamer-DBCO solution was mixed with 2 mM and 20 mM E3 ligase ligand at a volume ratio of 1:1 (hereinafter referred to as assembly ratio) (i.e., the molar ratio of TLR4 aptamer-DBCO to E3 ligase ligand was 1:1, 1:10), and placed in a constant temperature incubator shaker at 37 °C for 0.5, 4, and 12 hours, respectively. 20% PAGE gel was added with 10 pL of aptamer coupling eye drops per well, and electrophoresis was performed at room temperature at 100 V for 5 hours. After running the gel, Gelred nucleic acid dye was used to stain at room temperature in the dark for 15 minutes, and finally a chemical gel imager was used for analysis. Further, TLR4 aptamer-DBCO and E3 ligase ligand were optimized for reaction time at an assembly ratio of 1:1, 16% PAGE gel was added with 10 pL of aptamer coupling eye drops per well, and electrophoresis was performed at room temperature at 100 V for 3 hours. After running the gel, Gelred nucleic acid dye was used to stain at room temperature in the dark for 15 minutes, and finally a chemical gel imager was used for analysis.

[0098] D. TLR4 aptamer coupling eye drops for TLR4 degradation assay:

[0099] HCE-T cells: 2.0 x 10 5HCE-T cells were seeded in 12-well plates for 24 hours. Cells were stimulated with LPS for 12 hours, and then different groups were added and incubated for another 12 hours. After incubation, the supernatant was discarded, and the cells were washed once with PBS. 50 μL of cell lysis solution was added to each well, and the plate was placed on ice. The protein was scraped with a cell scraper. The plate was centrifuged at 4°C (12000 rpm, 15 minutes), and the protein supernatant was quantified.

[0100] Macrophages: 2.0 x 10 5 RAW264.7 cells were seeded in 12-well plates for 12 hours, and then 1 μg / mL LPS was added for 12 hours. Different concentrations of aptamer-coupled eye drops were added, and the incubation was continued for another 12 hours. The supernatant was discarded, and the cells were washed once with PBS. 60 μL of cell lysis solution was added to each well, and the plate was placed on ice. The cells were scraped with a cell scraper, and the plate was centrifuged at 4°C (12000 rpm, 15 minutes). The protein supernatant was recovered.

[0101] The protein was separated using a 10% sodium dodecyl sulfate polyacrylamide gel (SDS-PAGE) and transferred to a PVDF membrane. The membrane was transferred at 100V for 90 minutes on ice. After the transfer, the blocking solution (5% skim milk powder) was incubated at room temperature for 90 minutes. Then, the primary antibody (1:1000) was incubated at 4°C overnight. The primary antibody was recovered, and the membrane was washed with 1 x TBST buffer for 3 times, each for 10 minutes. The secondary antibody (1:2000) was incubated at room temperature for 90 minutes. After incubation, the membrane washing step was repeated. Finally, the chemiluminescent solution was added, and the imaging analysis was performed using a chemical gel imager.

[0102] After incubation, the cell supernatant was removed, and the cells were washed twice with PBS. The cells were fixed with 4% paraformaldehyde at room temperature for 10 minutes, and then washed with pre-cooled PBS for 3 times. The blocking solution (PBST containing 1% BSA) was incubated for 30 minutes. Finally, the TLR4 primary antibody (1:500) was added to the cells and incubated at 4°C overnight. The cells were washed with PBS for 3 times, each for 5 minutes. The secondary antibody (goat anti-mouse IgG H&L, 1:500) was incubated at room temperature for 1 hour in the dark. The cells were washed with PBS for 3 times, each for 10 minutes. The cells were incubated with the cell membrane dye working solution (1:2000) at 37°C for 10 minutes in the dark. The cells were washed with PBS for 3 times. Finally, the cells were placed under a confocal microscope (60x) for imaging analysis.

[0103] (B) Related experimental results

[0104] A. TLR4 aptamer and cell binding verification:

[0105] As Figure 2As shown, no obvious fluorescence was observed on the cell surface without LPS stimulation; after the addition of LPS stimulation, obvious fluorescence was observed on the cell surface. RAW264.7 cells without LPS stimulation almost do not express TLR4 protein, so the binding ability of TLR4 aptamer to RAW264.7 cells is weak; after the addition of LPS stimulation, RAW264.7 cells highly express TLR4, and the nucleic acid aptamer can specifically bind to RAW264.7 cells.

[0106] B. Verification of internalization of TLR4 nucleic acid aptamer:

[0107] As shown in Figure 3 , after the TLR4 nucleic acid aptamer and the PD-1 nucleic acid aptamer were co-incubated with RAW264.7 cells and then the surface nucleic acid aptamer was digested by DNAase, the intracellular fluorescence intensity was observed. The RAW264.7 cells treated with the TLR4 nucleic acid aptamer can produce internalization, so there is still part of the intracellular fluorescence intensity after the membrane nucleic acid aptamer is degraded by DNAase, while the PD-1 nucleic acid aptamer has no internalization ability, so there is almost no fluorescence after the membrane nucleic acid aptamer is degraded by DNAase. Therefore, the TLR4 nucleic acid aptamer of the present application has internalization effect.

[0108] C. Verification of coupling of TLR4 nucleic acid aptamer and E3 ligase ligand and optimization of ratio:

[0109] The TLR4 nucleic acid aptamer solution and the E3 ligase ligand solution are reacted to synthesize eye drops according to different assembly ratios, and analyzed by 20% non-denaturing PAGE. Figure 4 As shown in (a), after 5 hours of electrophoresis, two bands appeared in the remaining lanes compared with the nucleic acid aptamer lane alone. The higher band is the nucleic acid aptamer assembled with the E3 ligase ligand. Therefore, the upward band indicates that the synthesis of eye drops is successful.

[0110] In addition, we conducted additional investigation on the 1:1 assembly ratio by gel electrophoresis, and the results are shown in Figure 4 (b). By different reaction times, we found that the synthesis efficiency of eye drops increased with the increase of reaction time, and tended to be stable at about 12 hours of reaction time, indicating that a stable covalent bond was formed during the reaction of TLR4 nucleic acid aptamer and E3 ligase ligand. In view of the above experimental results, the TLR4 nucleic acid aptamer and the E3 ligase ligand will be selected to react for 12 hours to synthesize eye drops according to the assembly ratio of 1:1 in the subsequent experiments.

[0111] D. Verification of TLR4 degradation of corneal cells and immune cells by TLR4 nucleic acid aptamer coupled eye drops:

[0112] As shown in Figure 5(a), (c) showed that after adding eye drops of different concentrations, the content of TLR4 was significantly lower than that of the LPS treatment group, while the TLR4 nucleic acid aptamer and E3 ligase ligand alone had no obvious degradation effect on TLR4, indicating that the degradation of TLR4 was due to the function of the nucleic acid aptamer coupled eye drops. The TLR4 expression of each group was quantitatively analyzed, such as Figure 5 (b) and (d) in the middle, the eye drop group has a significant TLR4 degradation effect.

[0113] Macrophages are a typical model of inflammatory cells, which can be stimulated by LPS to form inflammatory cells. Western blotting experiment verified that the nucleic acid aptamer coupled eye drops degraded the TLR4 protein of macrophages. As shown in Figure 6 (a), (c) showed that after adding eye drops, the content of TLR4 was significantly lower than that of the control group. Among them, eye drop 4 with a final concentration of 5 μM can achieve a degradation rate of 81%. However, the control group TLR4 protein did not have obvious degradation. We quantified the expression of TLR4, and compared with the control group stimulated by LPS alone, the TLR4 content of the eye drop group was significantly reduced, such as Figure 6 (b) and (d) in the middle.

[0114] We analyzed the degradation effect of TLR4 protein by laser confocal fluorescence imaging, in which green fluorescence FITC labeled cell membrane protein TLR4, and red fluorescence Cy3 labeled cell membrane. The results are shown in Figure 7 As shown in the figure, after incubating different concentrations of nucleic acid aptamer coupled eye drops with macrophages for 6h, the cell membrane surface still had relatively obvious green fluorescence intensity compared with the LPS group. When the incubation time was extended to 12h, the green fluorescence intensity of the cell membrane surface under different concentrations of incubation began to decrease significantly compared with the LPS group. Through the analysis of fluorescence co-localization in the merged image, at this time the cell surface was mainly red fluorescence labeled cell membrane; when the incubation time reached 24 hours, the green fluorescence intensity of the cell membrane surface did not change much compared with 12 hours, indicating that the nucleic acid aptamer coupled eye drops had a relatively good TLR4 degradation effect when incubated with macrophages for 12 hours.

[0115] Example 2

[0116] The TLR4 nucleic acid aptamer coupled eye drops prepared in Example 1 were used for the following experiments:

[0117] (I) Related experimental process

[0118] A. Mouse dry eye model construction and drug administration process:

[0119] Before the experiment, the health of each mouse eye surface was checked to exclude external factors interference. The mice were randomly divided into groups: blank group, BAC group, BAC + TLR4 aptamer group (control group), eye drop group. Modeling and drug administration steps: 5 μL of 0.2% benzalkonium chloride (BAC) was dropped into the right eye of the mouse, and the drug was given 2 times a day (9 o'clock, 21 o'clock) for 7 days. After the dry eye model was induced, BAC was stopped, and different drug treatments were performed according to different groups, 5 μL of drug was given to each mouse right eye, 4 times a day (9 o'clock, 13 o'clock, 17 o'clock, 21 o'clock), and the drug was given for 7 days. During the drug treatment period, the tear secretion of the mice and the degree of corneal injury were evaluated. After the drug administration period ended, the eyeballs and organs of the mice were collected for analysis.

[0120] B. TLR4 aptamer coupled eye drops on TLR4 degradation of mouse dry eye model:

[0121] After drug administration, the eyeballs of mice in each group were placed in PBS (containing protease inhibitors), and the corneal tissue was removed under a binocular stereomicroscope and frozen ground (60 Hz, 5 minutes, pause 15 s, cycle 2 times). Centrifugation at 4°C (12000 rpm, 15 minutes), and the supernatant was quantified. The membrane protein TLR4 was characterized by Western blotting, and the protein expression of each group under different treatments was investigated.

[0122] C. TLR4 aptamer coupled eye drops on the influence of inflammatory microenvironment of mouse dry eye model:

[0123] The prepared paraffin sections were deparaffinized to water and then placed in antigen retrieval solution for antigen retrieval: 3% hydrogen peroxide solution for 15 minutes, water washing. Goat serum was blocked at room temperature for 30 minutes, and PBS was washed. Incubate CD206 primary antibody (1:1000) at 4°C overnight, 37°C for 30 minutes, PBS washing 3 times, 5 minutes each time, add enzyme-labeled goat anti-rabbit-HRP polymer (100 μL / sample), 37°C constant temperature incubation for 30 minutes, PBS washing 3 times, 5 minutes each time. Add N520 TSA fluorescein (1:600), 37°C constant temperature incubation for 1 minute, then place the sections in EDTA solution for TSA reaction termination step. Incubate CD86 primary antibody (1:1000) at room temperature for 60 minutes, and PBS is washed. Add enzyme-labeled goat anti-rabbit-HRP polymer (100 μL / sample) at 37°C for 30 minutes, and PBS is washed. Add N570 TSA fluorescein (1:600), 37°C constant temperature incubation for 1 minute, then wash the sections with water, and mount them with anti-fluorescence quenching mounting agent (containing DAPI).

[0124] The eyeballs of each group of mice were dissected, the lenses were removed under a binocular stereomicroscope, and 9 times the volume of PBS (containing protease inhibitors) was added at a ratio of weight (g) : volume (mL) = 1 : 9. The eyeball tissue was ground in a cryogenic grinder (60 Hz, 5 minutes, pause 15 s, cycle 2 times). Centrifugation was performed at 4°C (12000 rpm, 15 minutes), and the supernatant was aspirated. The expression levels of inflammatory factors in each treatment group were detected according to the ELISA kit instructions for each index.

[0125] D. Detection of the extent of ocular surface damage and analysis of related indicators for dry eye evaluation:

[0126] (1) Tear test: Before modeling (day 0), each mouse was tested for tear secretion using a phenol red cotton thread to ensure that the mouse was in a normal state. Then, the test was performed on the 4th, 7th, 10th, and 14th days. Five mice were measured in each group. Measurement method: The mice were anesthetized by intraperitoneal injection of 1% sodium pentobarbital, fixed, and the lower eyelid was gently pulled to expose the conjunctival sac. A 1 mm end of a phenol red cotton thread was placed in the lower eyelid at the 1 / 3 conjunctival sac position. After 30 seconds, the thread was removed, and the red part of the thread soaked with tears was the measurement area. The measurement was repeated every 10 minutes, and the average value was recorded after repeating the measurement 3 times for each eye. After the measurement was completed, the mouse's eyes were gently closed to reduce excessive exposure and irritation.

[0127] (2) Tear film break-up time test: Each group of mice was intraperitoneally injected with 1% sodium pentobarbital to anesthetize and fix them. Then, 1 μL of 0.1% fluorescein sodium was added to the right eye of each mouse. After 3 times of artificial blinking, the corneal fluorescein sodium staining was observed under a cobalt blue light slit lamp microscope.

[0128] (3) Corneal histological analysis: After the drug administration period, the mice were sacrificed, and the eyeballs of each group of mice were dissected for paraffin embedding. Paraffin sections were prepared using a pathological sectioning machine, and the sections were deparaffinized to water. Then, hematoxylin and eosin staining was performed, followed by dehydration and mounting. The prepared tissue sections were observed under an inverted microscope to observe the corneal tissue morphology.

[0129] (B) Related experimental results

[0130] A. Verification of TLR4 degradation in a mouse dry eye model by TLR4 aptamer conjugated eye drops:

[0131] To verify the ability of the eye drops to degrade TLR4 in the cornea, we performed immunohistochemical analysis of the mouse cornea after drug administration. As shown in Figure 8 TLR4 was highly expressed in the corneal epithelium of the BAC group, and a large amount of TLR4 expression was observed in the control group. After the addition of eye drops, no TLR4 protein was observed in the corneal epithelium and stroma. Therefore, the aptamer conjugated eye drops can effectively reduce the TLR4 content in the corneal tissue.

[0132] B. Effect of TLR4 aptamer conjugated eye drops on inflammatory microenvironment of dry eye model in mice:

[0133] To verify that the eye drops can effectively alleviate the inflammatory response of the dry eye model in mice, we investigated the expression of macrophages in the corneal tissue by immunofluorescence experiment. From Figure 9 We can see that the CD86 fluorescence signal of the BAC group and the control group is significantly enhanced. This indicates that the M1 macrophages in the corneal tissue significantly increase after BAC-induced dry eye, while the CD86 fluorescence signal of the eye drop group is relatively less; At the same time, we also observed that the corneal epithelial layer of the eye drop group has obvious CD206 fluorescence signal aggregation, indicating that the eye drop treatment not only inhibits the activation of M1 macrophages, but also promotes the secretion of M2 macrophages, which plays an important role in alleviating the inflammatory environment of dry eye.

[0134] We explored the expression of inflammatory factors in the corneal tissue after eye drop treatment by enzyme-linked immunosorbent assay. From Figure 10 It can be seen that after BAC-induced dry eye, the expression of pro-inflammatory factors IL-6, IL-1β and MMP-9 significantly increases. The control group does not effectively inhibit the secretion of pro-inflammatory factors. After eye drop treatment, the expression of these inflammatory factors is significantly decreased, further proving that the present application can reduce the expression of pro-inflammatory cytokines and effectively alleviate the inflammatory microenvironment of dry eye.

[0135] C. Detection of ocular surface damage and analysis of dry eye evaluation related indicators:

[0136] We used phenol red cotton thread to evaluate tear secretion. As shown in Figure 11 (a) and (b), the wet length of the phenol red cotton thread measured on the ocular surface of the BAC-induced dry eye mice was significantly reduced compared with the blank group. During the treatment period, the control group did not promote tear secretion, indicating that TLR4 aptamer alone does not have the effect of treating dry eye; The tear secretion of the eye drop group mice was significantly increased compared with the control group, and the average secretion amount reached about 7 mm on the 14th day, close to the tear secretion level of healthy mice.

[0137] On the 0th, 1st, 3rd, 5th and 7th day of treatment, the corneal epithelium of each group was stained with sodium fluorescein to evaluate the corneal defect. As Figure 12 shown, after adding sodium fluorescein on the ocular surface of the blank group, the cornea was clear and had no obvious aggregation patches. The cornea of the BAC group mice became obviously opaque, and green fluorescent sodium fluorescein was observed under cobalt blue light. On the 3rd day of treatment, the sodium fluorescein of the eye drop group mice had a more obvious regression; On the 7th day of treatment, no aggregation patches or obvious patch staining were observed on the surface of the mouse cornea. The results show that the eye drops have excellent therapeutic effect and can promote the repair of corneal tissue.

[0138] To evaluate the structural changes after treatment, we then performed histological examinations on the mouse corneas after treatment. Figure 13 As shown in (a) and (b), the corneal tissue structure of the blank group was intact, and the corneal epithelial cells were arranged neatly; the corneal epithelium of the BAC group was significantly thinner than that of the blank group, the cells were not arranged neatly, and there were defects; the corneal epithelium of the control group also had defects, the corneal surface was not smooth, the corneal stroma was significantly thickened, the cells were disordered, and the number of cells increased significantly. The corneal epithelium thickness of the eye drop group increased significantly, and the surface was relatively smooth and flat; the morphology of the corneal stroma was also close to normal, and the number of cells in the stroma decreased. The above results show that the eye drops of the present invention have a significant promoting effect on the repair of corneal tissue damage.

[0139] The above are only preferred embodiments of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A TLR4 nucleic acid aptamer, characterized in that: It has the nucleotide sequence shown in SEQ ID NO: 1 or a nucleotide sequence having at least 80% homology thereto.

2. A TLR4 aptamer conjugate, characterized in that: The method comprises the TLR4 nucleic acid aptamer and the E3 ligase ligand according to claim 1.

3. The TLR4 nucleic acid aptamer conjugate according to claim 2, characterized in that The TLR4 nucleic acid aptamer and the E3 ligase ligand are connected through a chemical click reaction; the chemical click reaction includes a copper-free catalyzed azide-alkyne cycloaddition reaction, a copper-catalyzed azide-alkyne cycloaddition reaction or a tetrazine trans-cyclooctene cycloaddition reaction.

4. The TLR4 nucleic acid aptamer conjugate according to claim 3, characterized in that The chemical click reaction is a copper-free catalyzed azide-alkyne cycloaddition reaction; the 3' end of the TLR4 nucleic acid aptamer is modified with a dibenzocyclooctyne group; the end of the E3 ligase ligand is modified with an azide group; and the TLR4 nucleic acid aptamer and the E3 ligase ligand are modified with different groups.

5. The TLR4 nucleic acid aptamer conjugate according to any one of claims 2 to 4, wherein the E3 ligase ligand is a CRBN ligand; The CRBN ligand is thalidomide, lenalidomide, pomalidomide or a derivative thereof.

6. The method for preparing the TLR4 nucleic acid aptamer conjugate according to any one of claims 2 to 5, characterized in that: include: Obtaining an E3 ligase ligand and a TLR4 nucleic acid aptamer whose ends are modified with an azide group and a dibenzocyclooctyne group, respectively, or a TLR4 nucleic acid aptamer and an E3 ligase ligand whose ends are modified with a dibenzocyclooctyne group and an azide group, respectively; The modified TLR4 nucleic acid aptamer and the modified E3 ligase ligand are mixed to perform a chemical click reaction to obtain a TLR4 nucleic acid aptamer conjugate.

7. The preparation method according to claim 6, characterized in that The chemical click reaction comprises: reacting under constant temperature shaking conditions of 24° C.-37° C. for 0.5 to 24 hours.

8. Use of the TLR4 nucleic acid aptamer conjugate according to any one of claims 2 to 5 or the TLR4 nucleic acid aptamer conjugate prepared by the preparation method according to any one of claims 6 to 7 in the preparation of a drug for preventing and / or treating dry eye.

9. Eye drops for preventing and treating dry eyes, characterized in that: The invention comprises the TLR4 nucleic acid aptamer conjugate according to any one of claims 2 to 5 or the TLR4 nucleic acid aptamer conjugate prepared by the preparation method according to any one of claims 6 to 7.

10. The method for preparing the eye drops according to claim 9, characterized in that: It includes steps S1 to S3: S1. mixing the modified TLR4 nucleic acid aptamer and a first solvent to obtain a first solution; S2, mixing the modified E3 ligase ligand with a second solvent to obtain a second solution; S3, mixing the first solution and the second solution to perform a chemical click reaction to obtain a product containing the TLR4 nucleic acid aptamer conjugate of the present invention; or, including step S4: S4. Mixing the TLR4 nucleic acid aptamer conjugate according to any one of claims 2 to 5 or the TLR4 nucleic acid aptamer conjugate prepared by the preparation method according to any one of claims 6 to 7 and a pharmaceutically acceptable auxiliary agent.

11. The preparation method according to claim 10, characterized in that: In step S1, the first solvent is Ca-containing 2+ Mg 2+ PBS buffer, or sterile water; and / or In step S2, the second solvent is PBS buffer or artificial tears; and / or In step S3, the chemical click reaction includes: reacting at a constant temperature of 24°C to 37°C under shaking conditions for 0.5 to 24 hours; and / or The mixing is performed in a molar ratio of the modified TLR4 nucleic acid aptamer to the modified E3 ligase ligand of 1:1 to 10; and / or In step S4, the pharmaceutically acceptable excipient includes at least one of water, PBS buffer, sodium chloride, phosphate buffer, and sodium hyaluronate.

12. The preparation method according to claim 11, characterized in that In step S3, before the mixing, the method further includes the steps of annealing the first solution at 95° C. for 5 minutes and cooling the solution at 0-4° C. for 30-60 minutes.

Images