Efficient detection technology for double CRISPR (clustered regularly interspaced short palindromic repeats) coupled isothermal amplification

By employing dual CRISPR coupled isothermal amplification technology, utilizing a pair of Cas12a variant-guide RNA complexes and fluorescence resonance energy transfer nucleic acid probes, the challenges of CRISPR isothermal amplification in multiplex detection and field readiness have been overcome. This enables rapid, sensitive, and specific nucleic acid detection, suitable for field detection of foodborne pathogens.

CN120796447APending Publication Date: 2025-10-17SOUTHEAST UNIV
View PDF 0 Cites 1 Cited by

Patent Information

Application Number
CN202510908372.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-02
Publication Date
2025-10-17

AI Technical Summary

Technical Problem

Existing CRISPR combined with isothermal amplification technologies present challenges in terms of multiplex detection and field readiness, especially since traditional methods require large thermal cyclers and the two-step approach is prone to aerosol contamination.

Method used

The dual CRISPR coupled isothermal amplification technology uses a pair of highly efficient Cas12a variant-guide RNA complexes and an isothermal amplification system, combined with fluorescence resonance energy transfer nucleic acid probes and bovine serum albumin, to achieve a one-pot reaction, activate the trans-cleavage activity of the Cas12a variant to generate a highly specific fluorescence signal, and avoid aerosol contamination.

Benefits of technology

It enables rapid, sensitive, and specific nucleic acid detection, and can perform multiple target detection without the need for large instruments, making it suitable for on-site detection of foodborne pathogens.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120796447A_ABST
    Figure CN120796447A_ABST
Patent Text Reader

Abstract

The invention discloses a double-CRISPR (clustered regularly interspaced short palindromic repeats) coupled isothermal amplification efficient detection technology, and a double-CRISPR coupled isothermal amplification reagent provided by the invention comprises a pair of efficient Cas12a variant-guide RNA (Ribonucleic Acid) complexes, an isothermal amplification system, bovine serum albumin, a fluorescence resonance energy transfer single-stranded DNA (Deoxyribose Nucleic Acid) probe, a reaction buffer solution and target nucleic acid to be detected, the double CRISPR coupling isothermal amplification detection technology disclosed by the invention has the remarkable advantages of high reaction speed, high signal-to-noise ratio, high sensitivity and strong specificity, can efficiently detect low-copy or low-quality target nucleic acid, and can be combined with a 3D printing chip to realize reagent freeze-drying and simultaneous detection of multiple types of target nucleic acid; the method shows a great application prospect, and particularly has a great potential in detection of bacteria deployed on site.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of molecular biology, in particular to a high-efficiency detection technology of double CRISPR coupled isothermal amplification. BACKGROUND

[0002] Due to the characteristics of sensitivity, specificity and simple operation, nucleic acid amplification detection technology is widely used in pathogen detection and clinical diagnosis. However, the nucleic acid amplification detection technology centered on polymerase chain reaction (PCR) is heavily dependent on large thermal cycler, which is difficult to meet the current demand for on-site detection and home use. Due to the programmable precision of Cas protein and target-specific guide RNA, CRISPR-based detection has become the next generation of molecular diagnostic technology. However, the detection sensitivity of trans-cleavage activity is low, so the method of combining CRISPR with isothermal amplification has more excellent performance and has been applied to the detection of pathogens, gene mutations, etc.

[0003] In the technology of combining CRISPR with isothermal amplification, the two-step method refers to pre-amplification of the target as the first step, and then amplicon detection, but the two-step method has the step of transferring the amplicon, which is easy to cause aerosol pollution. In contrast, one-pot simplifies the procedure and reduces aerosol pollution. Since LAMP usually starts at 60-65℃, a thermophilic CRISPR / Cas system is required, which leads to the need for long guide RNA of more than 100 nt, which complicates the system. Therefore, using MIRA (usually at 37-42℃ and requiring shorter guide RNA) and a thermophilic CRISPR / Cas system (such as CRISPR / Cas12a) can better improve the detection efficiency. However, one-pot MIRA-CRISPR / Cas12a detection still has challenges in performance, multiplex detection and on-site readiness. SUMMARY

[0004] The technical problem solved by the present application is that the present application provides a high-efficiency detection technology of double CRISPR coupled isothermal amplification, which has the advantages of strong detection fluorescence signal, fast speed and high sensitivity, and can eliminate the dependence on large instruments, and can realize on-site detection of foodborne pathogens.

[0005] Technical scheme: The first object of the present application is to provide a composition of double CRISPR coupled isothermal amplification (EOD-CRISPR), which comprises a pair of high-efficiency Cas12a variant-guide RNA complex, an isothermal amplification system, bovine serum albumin, a fluorescence resonance energy transfer nucleic acid probe, a reaction buffer and a target nucleic acid to be detected.

[0006] The pair of high-efficiency Cas12a variant-guide RNA complexes comprises an upstream Cas12a variant-guide RNA complex and a downstream Cas12a variant-guide RNA complex, which respectively recognize an upstream sequence and a downstream sequence of the target nucleic acid to be detected, and can activate the Cas12a variant to produce high-efficiency transcleavage activity when combined with the target nucleic acid or an amplicon thereof;

[0007] The isothermal amplification system comprises one or more of a multi-enzyme constant-temperature nucleic acid rapid amplification (MIRA) system, a recombinase-mediated isothermal nucleic acid amplification (RAA) system, a recombinase polymerase amplification (MIRA) system, a loop-mediated isothermal amplification (LAMP) system, a cross primer amplification (CPA) system, a rolling circle amplification (RCA) system, a helicase-dependent amplification (HDA) system, a nucleic acid sequence-based amplification (NASBA) system, a recombinase transcription enzyme-mediated isothermal amplification system, and a strand displacement amplification (SDA) system, preferably, the isothermal amplification system is a multi-enzyme constant-temperature nucleic acid rapid amplification (MIRA) system, which can realize rapid amplification of the target nucleic acid to be detected.

[0008] The bovine serum albumin as an additive can enhance the signal-to-noise ratio of the EOD-CRISPR detection;

[0009] The fluorescence resonance energy transfer nucleic acid probe is a DNA, DNA-RNA, or DNA-DNA complex simultaneously modified with a fluorescent group and a quencher group, which does not produce strong fluorescence signals in a complete structure, but can produce strong fluorescence signals with high specificity for the target nucleic acid to be detected when cut by the high-efficiency transcleavage activity of the activated Cas12a variant, and has a length greater than or equal to 5 nucleotides or nucleotide pairs.

[0010] The reaction buffer is composed of tris-hydroxymethyl aminomethane hydrochloride, sodium chloride, and magnesium chloride, so as to maintain the high-efficiency performance of the EOD-CRISPR reagent.

[0011] As a preferred embodiment, the Cas12a variant is a variant derived from an amino acid coccobacillus Cas12a, which contains at least two amino acid mutation points of M537R and F870L, and is named uAsCas12a.

[0012] As a preferred embodiment, the guide RNA comprises an upstream guide RNA and a downstream guide RNA, wherein each guide RNA comprises a fixed sequence recognizable by the Cas12a variant and a variable sequence complementary to the target nucleic acid sequence, and the fixed sequence and the variable sequence can not form a strand, the fixed sequence or the variable sequence is RNA or an RNA-DNA complex, and has a length greater than or equal to 20 nucleotides.

[0013] As preferred, the multi-enzyme isothermal nucleic acid rapid amplification (MIRA) system comprises a primer pair, Tris-HCl, NaCl, KCl, MgCl2, dithiothreitol, polyvinylpyrrolidone, ATP, dNTPs, phosphoenolpyruvate, pyruvate kinase, bovine serum albumin, T4 phage DNA helicase gp41 protein, Streptomyces coelicolor RecA protein, single-strand binding protein, and E. coli DNA polymerase I.

[0014] As preferred, the target nucleic acid to be detected comprises a DNA single-stranded sequence, a DNA double-stranded sequence, and / or an RNA sequence.

[0015] As preferred, the reaction buffer is additionally added with a freeze-drying protective agent consisting of 0.01-1% (v / v) triton X-100, 0.5-50% (m / v) trehalose, 0.1-10% (m / v) glycine, and 0.25-25% (m / v) pullulan when achieving freeze-drying of the EOD-CRISPR reagent, so that the EOD-CRISPR reagent maintains high efficiency after freeze-drying.

[0016] A second object of the present application is to provide an EOD-CRISPR high-efficiency detection system based on a multi-enzyme isothermal nucleic acid rapid amplification (MIRA) system. The above-mentioned composition of a double-CRISPR coupled isothermal amplification (EOD-CRISPR) is composed of mixed liquids A and B, wherein the mixed liquid A comprises 0.1-1× reaction buffer, 0.05-5 μM upstream guide RNA, 0.05-5 μM downstream guide RNA, 0.05-5.0 mg / mL bovine serum albumin, 0.1-10 μM uAsCas12a, 0.2-20 μM fluorescence resonance energy transfer nucleic acid probe, and different concentrations of target nucleic acid to be detected, and the mixed liquid B comprises 0.05-5.0 μM each primer, 100-800 mM Tris-HCl, 10-150 mM NaCl, 10-150 mM KCl, 10-50 mM MgCl2, 5-15 mM dithiothreitol, 5-20% (w / v) polyvinylpyrrolidone, 10-20 mM ATP, 1-5 mM dNTPs, 10-50 mM phosphoenolpyruvate, 500-1500 ng / μL pyruvate kinase, 100-500 ng / μL bovine serum albumin, 50-200 ng / μL T4 phage DNA helicase gp41 protein, 100-500 ng / μL Streptomyces coelicolor RecA protein, 200-1000 ng / μL single-strand binding protein, and 50-200 ng / μL E. coli DNA polymerase I.

[0017] A third object of the present application is to provide a 3D printed chip-based EOD-CRISPR detection system with high efficiency based on the multi-enzyme isothermal nucleic acid rapid amplification (MIRA) system. The 3D printed chip contains 8 outer chambers and 4 inner chambers in structure, which are circularly distributed and share a common center. Each inner chamber is connected to two outer chambers by a fan-shaped channel. Each outer chamber corresponds to a plug, but the four inner chambers share a plug. The chambers are filled with glass fiber membranes to adsorb EOD-CRISPR reagents during lyophilization to prevent the formation of bubbles. The outer chamber adsorbs mixed solution A containing a freeze-drying protectant, and the inner chamber adsorbs mixed solution B containing a freeze-drying protectant but no magnesium chloride. The channel is modified with superhydrophobic material to prevent backflow of the outer chamber liquid. The chip-based detection steps include:

[0018] Step one: Add 10-50 μL of the target nucleic acid solution to be tested and 0.5-10 μL of a 10-50 mM magnesium chloride solution to each inner chamber.

[0019] Step two: Use ultraviolet curing glue to seal the inner chamber, and let it stand at room temperature for 0-20 min, then centrifuge.

[0020] Step three: Place the chip in a 25-50℃ environment for 5-30 min to simultaneously detect four different types of target nucleic acids to be tested.

[0021] A fourth object of the present application is to provide an application, which includes any of the following:

[0022] (1) The application of the EOD-CRISPR high-efficiency detection system based on the multi-enzyme isothermal nucleic acid rapid amplification (MIRA) system in detecting foodborne pathogens.

[0023] (2) The application of the 3D printed chip-based EOD-CRISPR high-efficiency detection system based on the multi-enzyme isothermal nucleic acid rapid amplification (MIRA) system in field detection.

[0024] Further, the EOD-CRISPR high-efficiency detection system based on the multi-enzyme isothermal nucleic acid rapid amplification (MIRA) system in the application of foodborne pathogens, the system contains the upstream primer, the downstream primer, the upstream guide RNA and the downstream guide RNA for detecting the gene of Bacillus cereus murB, the gene of Salmonella invA, the nuc gene of Staphylococcus aureus, and the rfbE gene of Escherichia coli O157:H7.

[0025] The upstream primer and downstream primer sequences for detecting the gene of B. cereus murB are shown as SEQ ID No. 1-2; the upstream guide RNA and downstream guide RNA sequences for detecting the gene of B. cereus murB are shown as SEQ ID No. 9-10;

[0026] The upstream primer and downstream primer sequences for detecting the gene of Salmonella invA are shown as SEQ ID No. 3-4; the upstream guide RNA and downstream guide RNA sequences for detecting the gene of Salmonella invA are shown as SEQ ID No. 11-12;

[0027] The upstream primer and downstream primer sequences for detecting the nuc gene of S. aureus are shown as SEQ ID No. 5-6; the upstream guide RNA and downstream guide RNA sequences for detecting the nuc gene of S. aureus are shown as SEQ ID No. 13-14;

[0028] The upstream primer and downstream primer sequences for detecting the rfbE gene of E. coli O157:H7 are shown as SEQ ID No. 7-8; the upstream guide RNA and downstream guide RNA sequences for detecting the rfbE gene of E. coli O157:H7 are shown as SEQ ID No. 15-16.

[0029] Advantages:

[0030] (1) The detection system provided by the present application can simultaneously detect four targets (B. cereus, Salmonella, S. aureus and E. coli), and is convenient, fast and easy to operate;

[0031] (2) The method provided by the present application has the advantages of strong detection fluorescence signal, fast speed and high sensitivity;

[0032] (3) The 3D printed chip detection provided by the present application only needs to put the target nucleic acid to be detected into the inner chamber (which has freeze-dried mixed solution B containing freeze-dried protectant but not magnesium chloride), after sealing and standing for 0-20 min, centrifugation is performed, mixed with freeze-dried mixed solution A containing freeze-dried protectant in the outer chamber, and after heating, four different types of target nucleic acids to be detected can be simultaneously detected, which can get rid of the dependence on large instruments, and has great potential in on-site deployment of bacterial detection.

[0033] (4) The present application, when amplifying the target nucleic acid to be detected, through the synergistic effect of a pair of high-efficiency uAsCas12a-guide RNA complex and the additive bovine serum albumin, the trans-cleavage activity of CRISPR-uAsCas12a is activated to cleave the fluorescence resonance energy transfer nucleic acid probe (such as Cy5-TTTTTT-BHQ2) to produce highly specific fluorescence of the target nucleic acid to be detected, which significantly enhances the speed, sensitivity and fluorescence signal, and avoids the two-step transfer of amplicons in the traditional CRISPR combined with isothermal amplification technology, which will not cause aerosol pollution. BRIEF DESCRIPTION OF DRAWINGS

[0034] The present application will be further described below in conjunction with the accompanying drawings.

[0035] Figure 1 It is a schematic diagram of the principle of the method of the present application (taking the EOD-CRISPR high-efficiency detection technology based on the MIRA system as an example).

[0036] Figure 2 It is a result graph of the influence of the additive bovine serum albumin (BSA) and uAsCas12a on the detection of the target nucleic acid by the method of the present application. (A) The influence of 13 additives on the detection effect of EOD-CRISPR. 1 and 0.1 ng of Staphylococcus aureus genomic DNA were detected. The fluorescence intensity change fold (Fold) is the average fluorescence ratio of 3 repeats (n = 3) positive and no target control (NTC). (B) Comparison of LbaCas12a and uAsCas12a in the detection of different concentrations of Staphylococcus aureus genomic DNA by EOD-CRISPR detection of real-time fluorescence change (Figures (a) and (c)), 10 min end-point fluorescence (Figures (b)) and time to reach saturation FI (Figures (d)). *, P < 0.05; **, P < 0.01; ****, P < 0.0001; N.D., not detected.

[0037] Figure 3 It is the sensitivity experiment result of using the method of the present application to detect Bacillus cereus murB gene (A), Salmonella invA gene (B), Staphylococcus aureus nuc gene (C), and Escherichia coli O157:H7 rfbE gene (D) in the tube; NTC is the blank control group without target nucleic acid molecules.

[0038] Figure 4Specificity test results of the method of the present application for detecting Bacillus cereus murB gene, Salmonella invA gene, Staphylococcus aureus nuc gene and Escherichia coli O157:H7 rfbE gene in tubes; NTC is a blank control group without target nucleic acid molecules.

[0039] Figure 5 3D printing chip design diagram for using the method of the present application for chip detection. (A-D) are the complete view, top view, rear view and lateral perspective view of the chip, respectively, wherein the number 1 is the chip body, the number 2 is the inner chamber plug, the number 3 is the outer chamber plug, the number 4 is the inner chamber, the number 5 is the outer chamber, and the number 6 is the centrifugal hole.

[0040] Figure 6 Sensitivity test results of the method of the present application for detecting Bacillus cereus murB gene, Salmonella invA gene, Staphylococcus aureus nuc gene and Escherichia coli O157:H7 rfbE gene in 3D printing chip detection; NTC is a blank control group without target nucleic acid molecules. Among them, (a-d) in (A) are the detection sensitivity results of Bacillus cereus murB gene, Salmonella invA gene, Staphylococcus aureus nuc gene and Escherichia coli O157:H7 rfbE gene when using chip imaging analysis, and the number of repeated tests is 3; (a-d) in (B) are the detection sensitivity results of Bacillus cereus murB gene, Salmonella invA gene, Staphylococcus aureus nuc gene and Escherichia coli O157:H7 rfbE gene when using Image J software to quantify the red fluorescence obtained by imaging the chip chamber, and the number of repeated tests is 6, and the normalized fluorescence intensity value is used as the quantification index.

[0041] Figure 7The specificity experiment results of the method of the application for 3D printing chip detection of the murB gene of Bacillus cereus, the invA gene of Salmonella, the nuc gene of Staphylococcus aureus, and the rfbE gene of Escherichia coli O157:H7; NTC is a blank control group without target nucleic acid molecules. Among them, (a-d) in (A) are respectively the detection specificity experiment results of the murB gene of Bacillus cereus, the invA gene of Salmonella, the nuc gene of Staphylococcus aureus, and the rfbE gene of Escherichia coli O157:H7 when chip imaging analysis is used, and the number of repeated tests is 3; (a-d) in (B) are respectively the detection specificity experiment results of the murB gene of Bacillus cereus, the invA gene of Salmonella, the nuc gene of Staphylococcus aureus, and the rfbE gene of Escherichia coli O157:H7 when the red fluorescence obtained by imaging the chip chamber is quantified by using ImageJ software, and the number of repeated tests is 6, and the normalized fluorescence intensity value is used as the quantification index. DETAILED DESCRIPTION

[0042] The application will be further described below in conjunction with the drawings and specific embodiments.

[0043] The technical solutions in the embodiments of the application will be described clearly and completely below in conjunction with the drawings in the embodiments of the application. Obviously, the described embodiments are only part of the embodiments of the application, rather than all the embodiments of the application. Based on the embodiments in the application, all other embodiments obtained by a person of ordinary skill in the art without creative labor fall within the protection scope of the application.

[0044] In the following examples, the test methods used are conventional methods unless otherwise specified, and the materials, reagents, etc. used are reagents and materials that can be obtained commercially unless otherwise specified.

[0045] Referring to Figure 2 The double-CRISPR coupled isothermal amplification detection (EOD-CRISPR) technology used in the embodiments of the specification has the significant advantages of fast reaction speed, high signal-to-noise ratio, high sensitivity, and strong specificity, which benefits from the synergistic effect of a pair of efficient uAsCas12a-guide RNA complexes and the additive bovine serum albumin. Figure 2 A shows that bovine serum albumin can significantly enhance the fluorescence signal-to-noise ratio; Figure 2 B shows that uAsCas12a is significantly stronger than the traditional LbaCas12a in terms of speed, signal-to-noise ratio, and sensitivity.

[0046] Referring to Figure 5The 3D printed chip structure mentioned in the embodiments of the present specification is as follows: the 3D printed chip is integrally formed by a stereolithography 3D printer, comprising a chip main body 1, an inner chamber plug 2 and an outer chamber plug 3, wherein the chip main body 1 comprises 8 outer chambers 5 and 4 inner chambers 4, each inner chamber 4 is connected to two outer chambers 5 in one direction, 4 kinds of mixed solutions A containing freeze-drying protectants for 4 kinds of foodborne pathogenic bacteria are placed in the 4 inner chambers 4, and 4 kinds of mixed solutions B containing freeze-drying protectants but not containing magnesium chloride for 4 kinds of foodborne pathogenic bacteria are placed in the two outer chambers 5 connected by the inner chamber 4. The inner chamber 4 and the outer chamber 4 are provided with a 3 mm glass fiber membrane inside to adsorb the reagents of the reaction system to prevent bubbles from being generated during freeze-drying; the channel connecting the outer chamber 5 and the inner chamber 4 is modified with super-hydrophobic material to prevent backflow of the outer chamber liquid. The 4 inner chambers 4 share one sealing plug (the inner chamber plug 2), and each of the 8 outer chambers 5 corresponds to one sealing plug (the outer chamber plug 3).

[0047] Example 1

[0048] The EOD-CRISPR high-efficiency detection system based on the multi-enzyme isothermal nucleic acid rapid amplification (MIRA) system was used in the tube to detect Bacillus cereus, Salmonella, Staphylococcus aureus and Escherichia coli O157:H7. Figure 1 The principle schematic diagram is as follows, and the specific steps are as follows:

[0049] (1) The multi-enzyme isothermal nucleic acid rapid amplification (MIRA) primers and guide RNA were designed for the murB gene of the Bacillus cereus conservative sequence, the invA gene of the Salmonella conservative sequence, the nuc gene of the Staphylococcus aureus conservative sequence and the rfbE gene of the Escherichia coli O157:H7 conservative sequence. The conservative sequence was found through the BLAST function in NCBI, the primers were designed by using Oligo7 software, and the sequences were as follows:

[0050] murB-F-MIRA: ACATTCACCATAAATCCAGCGTGTTTTAAAGA (SEQ ID No. 1)

[0051] murB-R-MIRA: TTTAAGCGTGAGTCAAAACAGCCTCTAG (SEQ ID No. 2)

[0052] invA-F-MIRA: CGTCTACGTAGTCAGTTCTTTATTGATTAT (SEQ ID No. 3)

[0053] invA-R-MIRA: CATCAAATCAAAATAGACCGTAAATTGTTC (SEQ ID No. 4)

[0054] nuc-F-MIRA: GCATCACAAACAGATAACGGCGTAAATAGAAG (SEQ ID No. 5)

[0055] nuc-R-MIRA: ACATTAATTTAACCGTATCACCATCAATCGCT (SEQ ID No. 6)

[0056] rfbE-F-MIRA: TTGGATGGTCTCAATTCTAACTAGGACCGCAGA (SEQ ID No. 7)

[0057] rfbE-R-MIRA: GTGCTTTTGATATTTTTCCGAGTACATTGGCAT (SEQ ID No. 8)

[0058] murB-upstream guide RNA: UAAUUUCUACUAAGUGUAGAUAAGGUAAGCGAAUUGGUGGA (SEQ ID No. 9)

[0059] murB-downstream guide RNA: UAAUUUCUACUAAGUGUAGAUACGCUACCACAUGAAGGAUAU (SEQ ID No. 10)

[0060] invA-upstream guide RNA: UAAUUUCUACUAAGUGUAGAUACUUCCGGCAGGCGCACGCC (SEQ ID No. 11)

[0061] invA-downstream guide RNA: UAAUUUCUACUAAGUGUAGAUUGAUUAAUGAGAUCCGUGU (SEQ ID No. 12)

[0062] nuc-upstream guide RNA: UAAUUUCUACUAAGUGUAGAUAAGUUGCACUAUAUACUGUUGG (SEQ ID No. 13)

[0063] nuc-downstream guide RNA: UAAUUUCUACUAAGUGUAGAUAUUACAUAAAGAACCUGCGA (SEQ ID No. 14)

[0064] RfbE-upstream guide RNA: UAAUUUCUACUAAGUGUAGAUCAAGGUGAUUCCUUAAUUCCUC (SEQ ID No. 15)

[0065] RfbE-downstream guide RNA: UAAUUUCUACUAAGUGUAGAUAACAAGGCCAGUUUUUUACC (SEQ ID No. 16)

[0066] (2) EOD-CRISPR detection was performed in a tube with total DNA or plasmid as template.

[0067] The EOD-CRISPR detection system is as follows: mixture A contains 0.2x reaction buffer (same components as Buffer 2.1 from the United States NEB company), 0.5 μM upstream guide RNA, 0.5 μM downstream guide RNA, 0.2 mg / mL BSA, 0.64 μM uAsCas12a and 2 μM nucleic acid probe (Cy5-TTTTTT-BHQ2); mixture B is MIRA system (purchased from Jiangsu Changzhou Amp Future Company), containing 5.9 μL of hydrated freeze-dried solution (here is the solution obtained after hydration of the freeze-dried powder, no unit of concentration), 0.5 μM upstream primer, 0.5 μM downstream primer. Mixture B (8.5 μL) is mixed with 1 μL of total DNA or plasmid extract (using the total DNA or plasmid extraction kit provided by Kangwei Century) and 0.5 μL of 280 mM MgCl2, and then mixed with mixture A after standing for 15 minutes, to form a total of 10 μL of reaction system. All concentrations are calculated based on the volume of 10 μL after mixing. Reaction parameters: 42 °C for 40 min.

[0068] (3) Freeze-dried EOD-CRISPR detection was performed in a 3D printed chip with total DNA or plasmid as template.

[0069] The lyophilized EOD-CRISPR reaction system is as follows: the mixture A containing the freeze-drying protective agent is present in 8 outer chambers, and the lyophilized liquid volume of each chamber is 10 μL, which contains 0.2× reaction buffer (the same composition as Buffer 2.1 from NEB, USA), 0.5 μM upstream guide RNA, 0.5 μM downstream guide RNA, 0.2 mg / mL BSA, 0.64 μM MuAsCas12a and 2 μM nucleic acid probe (Cy5-TTTTTT-BHQ2), 0.1% (v / v) Triton X-100, 5% (m / v) trehalose, 1% (m / v) glycine and 2.5% (m / v) pullulan; the mixture B containing the freeze-drying protective agent but without magnesium chloride is present in 4 inner chambers, and the lyophilized liquid volume of each chamber is 30 μL, which contains 5.9 μL of hydrated lyophilized solution (here is the solution obtained after the hydration of the lyophilized powder, no concentration unit), 0.5 μM upstream primer, 0.5 μM downstream primer, 0.1% (v / v) Triton X-100, 5% (m / v) trehalose, and 1% (m / v) glycine. All of these reagents were lyophilized to a dry powder. For detection, 30 μL of the target nucleic acid extract and 2 μL of 280 mM MgCl₂ were added to each of the four inner chambers. The inner chambers were sealed with UV-curable adhesive, allowed to stand for 15 minutes, and then centrifuged. Finally, 10 μL of the reaction mixture was placed in each of the eight outer chambers. Reaction parameters: 42°C for 40 minutes.

[0070] (4) Determination of test results

[0071] For reaction tube and chip imaging analysis, samples that emit strong red fluorescence under the stimulation of red excitation light emitted by the fluorescence imager are positive samples, while samples that emit weak red or no fluorescence are negative samples; for the fluorescence intensity of the reaction tube, a fluorescence quantitative PCR instrument is used to measure the red fluorescence value; for the fluorescence intensity of the chip chamber, a fluorescence imager is used to image and then quantify the red fluorescence using Image J software, with the normalized fluorescence intensity value used as the quantitative indicator.

[0072] The sensitivity results in the tube are as follows Figure 3 As shown in the figure, by measuring the red fluorescence value with a PCR instrument and observing the reaction tube on a fluorescence imager, we can see that after 20 minutes of reaction, the EOD-CRISPR method can stably detect the DNA of Bacillus cereus, Salmonella, Staphylococcus aureus and Escherichia coli O157:H7, with the concentrations as low as 10 -3 , 10 -4 , 10 -3 ng / μL and 1 copy / μL. Therefore, the EOD-CRISPR detection method has high sensitivity.

[0073] Tube specificity results as shown in Figure 4 By using a PCR instrument to measure the red fluorescence value and taking its average value for hotspot analysis, we can see that EOD-CRISPR detection only shows high fluorescence intensity change fold when the corresponding target nucleic acid exists, as shown in

[0074] On-chip sensitivity results as shown in Figure 6 We can see that EOD-CRISPR chip detection can stably detect 10 -3 ng / μL of genomic DNA extracted from Bacillus cereus, Staphylococcus aureus and Salmonella, and 100 copy / μL of Escherichia coli O157:H7 DNA, as shown in

[0075] On-chip specificity results as shown in Figure 7 We can see that EOD-CRISPR chip detection has high consistency for the type of target nucleic acid to be detected, and no cross-reaction phenomenon is observed. Therefore, EOD-CRISPR chip detection method has high specificity.

[0076] The above shows and describes the basic principles, main features and advantages of the present application. Those skilled in the art should understand that the present application is not limited to the above examples, and the above examples and descriptions in the specification are only to illustrate the principles of the present application. Without departing from the spirit and scope of the present application, various changes and improvements can be made to the present application, and these changes and improvements all fall within the scope of the claimed present application.

Claims

1. A dual CRISPR coupled isothermal amplification (EOD-CRISPR) composition, characterized in that The composition includes a pair of high-efficiency Cas12a variant-guide RNA complexes, an isothermal amplification system, bovine serum albumin, a fluorescence resonance energy transfer nucleic acid probe, a reaction buffer, and a target nucleic acid to be detected; The pair of efficient Cas12a variant-guide RNA complexes include an upstream Cas12a variant-guide RNA complex and a downstream Cas12a variant-guide RNA complex, which respectively recognize the upstream sequence and downstream sequence of the target nucleic acid to be tested, and when bound to the target nucleic acid or its amplicon, the Cas12a variant can be activated to produce efficient trans-cleavage activity; The isothermal amplification system includes one or more of a multi-enzyme isothermal rapid nucleic acid amplification (MIRA) system, a recombinase-mediated isothermal nucleic acid amplification (RAA) system, a recombinase polymerase amplification (MIRA) system, a loop-mediated isothermal amplification (LAMP) system, a cross primer amplification (CPA) system, a rolling circle amplification (RCA) system, a helicase-dependent amplification (HDA) system, a nucleic acid sequence-dependent amplification (NASBA) system, a recombinase transcriptase-mediated isothermal amplification system, and a strand displacement amplification (SDA) system; The bovine serum albumin as an additive can enhance the signal-to-noise ratio of EOD-CRISPR detection; The fluorescence resonance energy transfer nucleic acid probe is a DNA, DNA-RNA and DNA-DNA complex modified with a fluorescent group and a quenching group. It does not produce a strong fluorescent signal under the complete structure, but when cut by the efficient trans-cutting activity of the Cas12a variant in the activated state, it can produce a strong fluorescent signal that is highly specific to the target nucleic acid to be tested, and its length is greater than or equal to 5 nucleotides or nucleotide pairs; The reaction buffer consists of tris (hydroxymethyl)aminomethane hydrochloride, sodium chloride, and magnesium chloride to maintain the high efficiency of the EOD-CRISPR reagent.

2. A dual CRISPR coupled isothermal amplification (EOD-CRISPR) composition according to claim 1, characterized in that The Cas12a variant is a variant derived from the genus Acidococcus Cas12a, containing at least two amino acid mutation points, M537R and F870L, and is named uAsCas12a.

3. The dual CRISPR coupled isothermal amplification (EOD-CRISPR) composition according to claim 1, characterized in that The guide RNA is divided into upstream guide RNA and downstream guide RNA, wherein each guide RNA comprises a fixed sequence that can be recognized by the Cas12a variant and a variable sequence that can be complementary to the target nucleic acid sequence, and the fixed sequence and the variable sequence may not form a chain, and the fixed sequence or the variable sequence is RNA or an RNA-DNA complex, and its length is greater than or equal to 20 nucleotides.

4. The dual CRISPR coupled isothermal amplification (EOD-CRISPR) composition according to claim 1, characterized in that The multi-enzyme isothermal rapid nucleic acid amplification (MIRA) system comprises a primer pair, tris (hydroxymethyl)aminomethane hydrochloride, sodium chloride, potassium chloride, magnesium chloride, dithiothreitol, polyvinylpyrrolidone, ATP, dNTPs, phosphoenolpyruvate, pyruvate kinase, bovine serum albumin, T4 phage DNA helicase gp41 protein, Streptomyces coelicolor RecA protein, single-strand binding protein, and Escherichia coli DNA polymerase I.

5. The dual CRISPR coupled isothermal amplification (EOD-CRISPR) composition according to claim 1, characterized in that The target nucleic acid to be detected includes a single-stranded DNA sequence, a double-stranded DNA sequence and / or an RNA sequence.

6. The dual CRISPR coupled isothermal amplification (EOD-CRISPR) composition according to claim 1, characterized in that When freeze-drying the EOD-CRISPR reagent, the reaction buffer is additionally added with a freeze-drying protectant consisting of 0.01-1% (v / v) Triton X-100, 0.5-50% (m / v) trehalose, 0.1-10% (m / v) glycine, and 0.25-25% (m / v) pullulan, so that the EOD-CRISPR reagent maintains high efficiency after freeze-drying.

7. An efficient EOD-CRISPR detection system based on a multi-enzyme constant-temperature rapid nucleic acid amplification (MIRA) system, characterized by: A dual CRISPR coupled isothermal amplification (EOD-CRISPR) composition according to claim 1, consisting of mixed solutions A and B, wherein mixed solution A includes 0.1-1× reaction buffer, 0.05-5 μM upstream guide RNA, 0.05-5 μM downstream guide RNA, 0.05-5.0 mg / mL bovine serum albumin, 0.1-10 μM uAsCas12a, 0.2-20 μM fluorescence resonance energy transfer nucleic acid probe and different concentrations of target nucleic acid to be detected, and mixed solution B includes 0.05-5.0 μM of each primer, 100-800 mM tris hydrochloride, 10-150 mM sodium chloride, 10-150 mM potassium chloride, 10-50 mM magnesium chloride, 5-15 mM dithiothreitol, 5-20% (w / v) polyvinyl pyrrolidone, 10-20 mM ATP, 1-5 mM dNTPs, 10-50 mM phosphoenolpyruvate, 500-1500 ng / μL pyruvate kinase, 100-500 ng / μL bovine serum albumin, 50-200 ng / μL T4 phage DNA helicase gp41 protein, 100-500 ng / μL Streptomyces coelicolor RecA protein, 200-1000 ng / μL single-stranded binding protein, 50-200 ng / μL Escherichia coli DNA polymerase I.

8. An efficient 3D printed chip-based EOD-CRISPR detection system based on a multi-enzyme constant temperature rapid nucleic acid amplification (MIRA) system, characterized by: Based on the EOD-CRISPR efficient detection system based on the multi-enzyme constant temperature rapid nucleic acid amplification (MIRA) system described in claim 7, the 3D printed chip structurally contains 8 outer chambers and 4 inner chambers, the chambers are distributed in a circle and share a center, wherein each inner chamber is connected to two outer chambers in a fan shape through a channel outward, each outer chamber corresponds to a plug but the four inner chambers share one plug, the chambers are filled with glass fiber membranes to adsorb EOD-CRISPR reagents during freeze-drying to prevent bubbles, wherein the outer chamber adsorbs a mixture A containing a freeze-drying protective agent, and the inner chamber adsorbs a mixture B containing a freeze-drying protective agent but not magnesium chloride, the channel is modified with a superhydrophobic material to prevent backflow of the outer chamber liquid, and the chip-type detection steps include: (1) Add 10-50 μL of the target nucleic acid solution and 0.5-10 μL of 10-50 mM magnesium chloride solution to each inner chamber; (2) Seal the inner chamber with UV-curable adhesive, let it stand at room temperature for 0-20 min, and centrifuge; (3) After the chip is placed at 25-50°C for 5-30 minutes, four different types of target nucleic acids can be detected simultaneously.

9. An application, comprising any one of the following: (1) Application of the EOD-CRISPR high-efficiency detection system based on the multi-enzyme constant-temperature rapid nucleic acid amplification (MIRA) system as described in claim 7 in the detection of foodborne pathogens; (2) Application of the EOD-CRISPR high-efficiency 3D printed chip-based detection based on the multi-enzyme constant temperature rapid nucleic acid amplification (MIRA) system described in claim 8 in on-site detection.

10. The use according to claim 9, characterized in that The EOD-CRISPR high-efficiency detection system based on the multi-enzyme constant-temperature rapid nucleic acid amplification (MIRA) system is used in the application of foodborne pathogens. The system includes upstream primers, downstream primers, upstream guide RNA, and downstream guide RNA for detecting the murB gene of Bacillus cereus, the invA gene of Salmonella, the nuc gene of Staphylococcus aureus, and the rfbE gene of Escherichia coli O157:H7; The upstream primer and downstream primer sequences for detecting the murB gene of Bacillus cereus are shown in SEQ ID Nos. 1-2; the upstream guide RNA and downstream guide RNA sequences for detecting the murB gene of Bacillus cereus are shown in SEQ ID Nos. 9-10; The upstream primer and downstream primer sequences for detecting the Salmonella invA gene are shown in SEQ ID Nos. 3-4; the upstream guide RNA and downstream guide RNA sequences for detecting the Salmonella invA gene are shown in SEQ ID Nos. 11-12; The upstream primer and downstream primer sequences for detecting the nuc gene of Staphylococcus aureus are shown in SEQ ID Nos. 5-6; the upstream guide RNA and downstream guide RNA sequences for detecting the nuc gene of Staphylococcus aureus are shown in SEQ ID Nos. 13-14; The upstream primer and downstream primer sequences for detecting the rfbE gene of Escherichia coli O157:H7 are shown in SEQ ID Nos. 7-8; the upstream guide RNA and downstream guide RNA sequences for detecting the rfbE gene of Escherichia coli O157:H7 are shown in SEQ ID Nos. 15-16.

Citation Information

Cited By

  • Biological aerosol automatic detection platform, detection method and application

    CN121592473A