MiRNA biomarker composition and kit for detecting brucellosis

By detecting the expression levels of miR-20a-5p, miR-93-5p and miR-320a-3p in serum exosomes, a brucellosis detection kit was constructed, which solved the problems of long diagnostic time and poor accuracy of existing diagnostic methods and achieved efficient and accurate brucellosis diagnosis.

CN120796529APending Publication Date: 2025-10-17GUANGZHOU KINGMED CENTER FOR CLINICAL LABORATORY CO LTD +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511032819.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-24
Publication Date
2025-10-17

AI Technical Summary

Technical Problem

Existing brucellosis diagnostic methods have the problems of long time, poor objectivity, and limited genomic targets, making it difficult to achieve rapid and accurate diagnosis.

Method used

Three miRNAs, miR-20a-5p, miR-93-5p, and miR-320a-3p, were used as biomarkers. By detecting their expression levels in serum exosomes, combined with specific primers and efficient amplification technology, a brucellosis detection kit was constructed to achieve rapid and accurate diagnosis.

Benefits of technology

The diagnostic accuracy of brucellosis has been improved, with an AUC value of up to 0.988. It has high sensitivity and specificity, can quickly identify patients with brucellosis, is suitable for minimally invasive liquid biopsy, reduces testing costs, and improves early diagnosis rates.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005517848530000071
    Figure BDA0005517848530000071
  • Figure BDA0005517848530000081
    Figure BDA0005517848530000081
  • Figure BDA0005517848530000082
    Figure BDA0005517848530000082
Patent Text Reader

Abstract

The invention relates to a miRNA (micro Ribonucleic Acid) biomarker composition and a kit for detecting brucellosis. The biomarker composition comprises miR-20a-5p and miR-93-5p, and is characterized in that the miR-20a-5p and the miR-93- A reagent for detecting the expression level of the biomarker composition in a biological sample can be used for preparing a brucellosis detection kit. Compared with a healthy control, the expression level of the biomarker composition in the serum exosome of a brucellosis patient is remarkably improved. A further ROC curve analysis result shows that the biomarker composition is high in AUC value and high in diagnosis accuracy when being used for brucellosis diagnosis, and brucellosis patients can be quickly and reliably identified. The biomarker composition can be used for detection in a liquid biopsy mode, has the advantages of being minimally invasive, capable of achieving real-time monitoring and the like, is low in detection reagent production cost and higher in universality, can be used for high-efficiency clinical diagnosis and differential diagnosis, improves the early diagnosis rate, and has high clinical application value and wide application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of biological detection, and particularly relates to a miRNA biomarker composition and kit for detecting brucellosis. BACKGROUND

[0002] Brucellosis is a bacterial disease caused by various Brucella, which is a zoonosis that seriously endangers human health and is a public health problem that needs to be addressed urgently. It is estimated that about 3.5 billion people in the world are at permanent risk of brucellosis, with 2.1 million new infections each year. Brucella infection is an important problem and is considered a zoonosis that has an adverse effect on the reproductive system and can cause infertility. Brucellosis is a systemic febrile disease, and due to its diversity of clinical spectrum, it is also considered a non-specific flu-like disease. In addition, brucellosis can exhibit similar clinical symptoms to other diseases. However, the existing brucellosis diagnosis methods have obvious shortcomings, such as long bacterial culture time, lack of objectivity in serological detection, and limited genomic targets for nucleic acid amplification detection, etc.

[0003] MicroRNA (miRNA) is a class of small non-coding RNAs with a length of about 18-24 nucleotides (nt), which regulates gene expression by binding to the 3' untranslated region (3'UTR) of the target mRNA, affecting cell differentiation, proliferation, apoptosis, and other processes. Currently, miRNA has been found to be used as a diagnostic biomarker for a variety of diseases. Finding miRNA biomarkers that can assist in the diagnosis of brucellosis has important value for early diagnosis and treatment of brucellosis. SUMMARY

[0004] Therefore, the purpose of the present application is to provide a miRNA biomarker composition and kit for detecting brucellosis, which can be used to assist in the diagnosis of brucellosis, has high accuracy, and the AUC value can be as high as 0.988.

[0005] The first aspect of the present application provides the use of a biomarker composition in the preparation of a brucellosis detection kit, wherein the biomarker composition comprises miR-20a-5p and miR-93-5p.

[0006] In some embodiments thereof, the biomarker composition further comprises miR-320a-3p.

[0007] The second aspect of the present application provides the use of a reagent for detecting the expression level of the biomarker composition as described above in a biological sample in the preparation of a brucellosis detection kit.

[0008] In some embodiments, the reagent for detecting the expression level of the biomarker composition in a biological sample includes a primer composition, which includes an upstream primer for the nucleotide sequence of miR-20a-5p as shown in SEQ ID NO: 13 and an upstream primer for the nucleotide sequence of miR-93-5p as shown in SEQ ID NO: 14.

[0009] In some embodiments, the primer composition further comprises an upstream primer targeting the nucleotide sequence of miR-320a-3p as shown in SEQ ID NO: 15.

[0010] In some embodiments, the biological sample is exosomes, preferably serum exosomes.

[0011] The third aspect of the present invention is to provide a brucellosis detection kit, which comprises reagents for detecting the expression level of the biomarker composition as described above in a biological sample.

[0012] In some embodiments, the kit includes a primer composition, which includes an upstream primer for the nucleotide sequence of miR-20a-5p as shown in SEQ ID NO: 13 and an upstream primer for the nucleotide sequence of miR-93-5p as shown in SEQ ID NO: 14.

[0013] In some embodiments, the primer composition further comprises an upstream primer targeting the nucleotide sequence of miR-320a-3p as shown in SEQ ID NO: 15.

[0014] In some embodiments, the kit further comprises a primer pair for detecting the expression level of an internal reference gene;

[0015] Preferably, the internal reference gene is U6.

[0016] The present invention has obtained a specific biomarker composition that can be used to assist in the diagnosis of brucellosis through research. The biomarker composition is miR-20a-5p and miR-93-5p, or miR-20a-5p, miR-93-5p and miR-320a-3p. Compared with healthy controls, the expression level of the biomarker composition in the serum exosomes of brucellosis patients is significantly increased. Further ROC curve analysis results show that the biomarker composition has a high AUC value (up to 0.988) when used for the diagnosis of brucellosis, has high diagnostic accuracy, and can quickly and reliably identify brucellosis patients. Therefore, the reagent for detecting the expression level of the biomarker composition in a biological sample can be used to prepare a brucellosis detection kit.

[0017] In addition, the application also provides an upstream primer with high sensitivity, good specificity and high amplification efficiency for the biomarker composition, which can be combined with a universal downstream primer for detecting miRNA to rapidly, accurately and efficiently realize detection of the biomarker composition.

[0018] The biomarker composition has the advantages of minimally invasive and real-time monitoring, and the detection reagent has low production cost and high universality, so that efficient clinical diagnosis and differential diagnosis can be performed, the early diagnosis rate is improved, and the biomarker composition has high clinical application value and wide application prospect. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 Characteristics of serum exosomes purified by ultracentrifugation method; A: structure and morphology of serum exosomes, B: number and diameter distribution of serum exosomes, C: protein expression level of CD9 and CD63 in serum exosomes.

[0020] Figure 2 Volcano plot of miRNA differential analysis of high-throughput sequencing results of serum exosomes of healthy person samples and brucellosis patient samples.

[0021] Figure 3 RT-qPCR verification results of serum exosome miRNAs of the training set; A: 12 miRNAs with the most significant up-regulation in serum exosomes of brucellosis patients, B: RT-qPCR detection results of 12 miRNAs of exosomes, C: area under the receiver operating characteristic curve (ROC) of single miRNA of 12 miRNAs of exosomes.

[0022] Figure 4 Logistic regression analysis and performance comparison of diagnostic combinations; A: visualization of the process of Logistic regression analysis, B: AUC of all subsets of the set containing miR-93-5p, miR-320a-3p and miR-20a-5p, C: area under the receiver operating characteristic curve (ROC) of combination 1 (miR-20a-5p+miR-320a-3p+miR-93-5p) and combination 2 (miR-20a-5p+miR-93-5p).

[0023] Figure 5 RT-qPCR verification results of serum exosome miRNAs of the verification set; A: RT-qPCR detection results of 3 miRNAs obtained by Logistic regression analysis, B: area under the receiver operating characteristic curve (ROC) of combination 1 and combination 2.

[0024] Figure 6 Performance test for diagnostic combination; A: residual analysis, B: cross-validation.

[0025] Figure 7 Summary of experimental design. DETAILED DESCRIPTION

[0026] For the purpose of promoting the understanding of the present application, a more complete description of the present application will be rendered. It is to be understood that the present application is not limited to the embodiments described herein which are presented as non-limiting examples only. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the application to those skilled in the art.

[0027] The experimental methods in the following examples, unless otherwise specified, are generally carried out according to the conventional conditions or according to the conditions recommended by the manufacturers. The various common chemical reagents used in the examples are commercially available products.

[0028] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present application belongs. The terminology used in the description of the application herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the application. The use of the terms "and / or" includes a combination of one or more of the associated listed items.

[0029] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present application belongs. The terminology used in the description of the application herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the application. The use of the terms "and / or" includes a combination of one or more of the associated listed items.

[0030] Extracellular vesicles (EVs) are small membrane-bound vesicles that can be secreted by all cells and play an important role in intercellular communication. Extracellular vesicles exist in all biological fluids, including blood, and serve as a transport system for various molecular components of their cell sources, including miRNAs.

[0031] The present application will be further described in detail below in conjunction with specific examples.

[0032] According to the diagnostic criteria of "Brucellosis Diagnosis and Treatment Scheme" 2023 edition published by the National Health Commission of the People's Republic of China (NHC), suspected or clinically diagnosed cases, and any one of the positive cases in the pathogenic or serological confirmation test can be diagnosed as brucellosis. In the following examples, patients with brucellosis were included according to this diagnostic standard.

[0033] Example 1 Screening of miRNAs with significant differential expression in brucellosis based on serum exosome data

[0034] I. Experimental methods

[0035] Serum samples from 20 confirmed brucellosis patients and 20 healthy people were collected as retrospective samples.

[0036] 1. Extraction of serum exosomes

[0037] Exosomes of serum samples were isolated using differential ultracentrifugation method, and the specific steps were as follows:

[0038] (1) The serum sample was centrifuged at 700 x g for 10 min, and the supernatant was collected to remove the cells in the sample;

[0039] (2) The sample was centrifuged at 2000 x g for 10 min, and the supernatant was collected to remove the cell debris in the sample;

[0040] (3) The sample was centrifuged at 10000 x g for 60 min, the supernatant was collected, and a 0.22 μm diameter filter was used for treatment to remove large particles such as apoptotic bodies in the sample;

[0041] (4) Using an ultracentrifuge, 120000 x g centrifugation for 90 min, remove the supernatant, resuspend the precipitate with sterile PBS, collect the serum exosomes, get the case group serum exosome sample (B-EVs) and control group sample (N-EVs), and store at -80℃ for standby or immediate use.

[0042] 2. Identification of serum exosomes

[0043] (1) Transmission electron microscope detection of the structure and morphology of serum sample exosomes

[0044] About 10 μL of serum exosomes were added to the sample-loaded copper mesh, and the excess liquid was absorbed from the side of the copper mesh with filter paper; 1 drop of 3% phosphotungstic acid solution (v / v) was added to the copper mesh, and the excess liquid was absorbed from the side of the copper mesh with filter paper; the sample in the copper mesh was observed under a transmission electron microscope (FEI Tecnai G2 Sprit Twin TEM) after drying.

[0045] (2) Nanoparticle tracking analysis for detecting the number and diameter distribution of serum exosomes

[0046] The serum exosome sample was diluted 200-1000 times to reach the detection range of the instrument; 1 mL of exosome sample was slowly injected into the connecting tube with a 1 mL syringe, and the Nanosight NS 300 instrument was used for imaging and detecting the particle size range and particle concentration of serum exosome particles.

[0047] (3) Western blot experiment for detecting exosome marker proteins

[0048] The RIPA lysis buffer and protease inhibitor were added to the serum exosome sample, and the sample CD9 and CD63 protein concentration was detected by BCA kit. The protein loading buffer was added to the sample solution, and after mixing, it was denatured in boiling water for 5 min. Through the experimental steps of loading, electrophoresis, membrane transfer, blocking, primary antibody incubation, secondary antibody incubation, and development, the protein bands of exosome markers were detected.

[0049] 3. miRNA high-throughput sequencing and screening confirmation

[0050] The small RNA high-throughput sequencing was performed on B-EVs and N-EVs to screen out differential miRNAs, and the specific steps were as follows:

[0051] (1) The RNA extraction of exosomes was performed by using spin column chromatography, and the exosome RNA concentration obtained from the serum sample was greater than 5 ng;

[0052] (2) The RNA sample integrity was detected by Agilent 2100 bioanalyzer, 3' and 5' adapters were added, reverse transcription and PCR enrichment were performed, fragments were selected, library quality control was performed, and sequencing was performed on HiSeq2500 sequencing platform by Meiji Biotech Co., Ltd.

[0053] II. Experimental results

[0054] The identification results of serum exosomes are shown in Figure 1 . Transmission electron microscopy showed that the exosomes exhibited typical disc-shaped morphology characteristics Figure 1 A). Nanoparticle size analysis showed that the size distribution of most vesicles separated from the serum was between 50-500 nm Figure 1 B). In addition, the expression of exosome markers CD9 and CD63 in N-EVs and B-EVs samples was positive by Western Blot Figure 1 C). These results showed that serum exosomes of the two groups of samples were successfully extracted.

[0055] The sequencing results were analyzed by bioinformatics analysis method, and the analysis conditions of fold change>2 and p-value<0.05 were constructed, 52 miRNAs with significant differential expression were obtained, and all of them were significantly up-regulated in the serum exosomes of brucellosis patients Figure 2 .

[0056] Example 2. RT-qPCR verification of the expression accuracy of serum exosome high-throughput sequencing miRNAs

[0057] I. Experimental method

[0058] Serum samples of 12 confirmed brucellosis patients and 12 healthy people were used as the training set samples for RT-qPCR verification.

[0059] 1. Primer design

[0060] From the 52 miRNAs with significant differential expression, 12 miRNAs with the most significant up-regulation were selected (Table 1). Figure 3 A) The website http: / / www.mirbase.org was accessed to obtain the mature nucleotide sequences of the 12 miRNAs with the most significant up-regulation (Table 1), and primers with high sensitivity, specificity and amplification efficiency were further designed.

[0061] Table 1 Mature nucleotide sequences of 12 miRNAs

[0062] miRNA name Nucleotide sequence (5'-3') SEQ ID NO: miR-20a-5p UAAAGUGCUUAUAGUGCAGGUAG SEQ ID NO: 1 miR-93-5p CAAAGUGCUGUUCGUGCAGGUAG SEQ ID NO: 2 miR-320a-3p AAAAGCUGGGUUGAGAGGGCGA SEQ ID NO: 3 let-7b-5p UGAGGUAGUAGGUUGUGUGGUU SEQ ID NO: 4 miR-374a-5p UUAUAAUACAACCUGAUAAGUG SEQ ID NO: 5 miR-186-5p CAAAGAAUUCUCCUUUUGGGCU SEQ ID NO: 6 let-7d-5p AGAGGUAGUAGGUUGCAUAGUU SEQ ID NO: 7 miR-19b-3p UGUGCAAAUCCAUGCAAAACUGA SEQ ID NO: 8 miR-151a-3p CUAGACUGAAGCUCCUUGAGG SEQ ID NO: 9 miR-98-5p UGAGGUAGUAAGUUGUAUUGUU SEQ ID NO: 10 miR-181b-5p AACAUUCAUUGCUGUCGGUGGGU SEQ ID NO: 11 miR-361-5p UUAUCAGAAUCUCCAGGGGUAC SEQ ID NO: 12

[0063] The designed RT-qPCR specific upstream primers are shown in Table 2, and the miRNA First Strand Synthesis kit from Takara was used to obtain U6 Forward Primer, U6 Reverse Primer and miRNA universal downstream primer mRQ3'Prime, respectively.

[0064] Table 2 RT-qPCR specific upstream primers

[0065]

[0066]

[0067] 2. Extraction of exosome RNA

[0068] (1) According to Example 1, serum exosome samples were extracted, and Trizol was added to the samples to make up 1 mL; keep at 15-30°C, stand for 5 min;

[0069] (2) Add 200 μL of chloroform, vortex to mix for 15 s, stand at room temperature for 5 min, then centrifuge at 4°C at 12000 x g for 15 min. After centrifugation, there are 3 layers, and the upper colorless transparent RNA layer is collected for standby;

[0070] (3) Transfer the RNA layer to a new RNAase-free EP tube, add isopropanol to precipitate the RNA molecules, and the volume of isopropanol is the same as that of the RNA layer in step (2). Stand at 15-30°C for 5 min, then centrifuge at 4°C at 12000 x g for 10 min, and the bottom of the centrifuge tube shows a gel-like precipitate;

[0071] (4) Discard the supernatant, add 1 mL of 75% ethanol solution (v / v) for washing, vortex after shaking, 4℃ 12000xg ultracentrifugation for 5 min; repeat the washing once, then the EP tube is inverted on the filter paper until the ethanol is completely volatilized;

[0072] (5) Add 15 μL DEPC water to dissolve the RNA precipitate, use a pipette to blow the precipitate, 55-60℃ for 10 min to promote RNA dissolution, use Nano Drop 2000 ultramicro spectrophotometer to determine the RNA quality and concentration, and the exosome RNA is obtained.

[0073] 3. cDNA synthesis

[0074] Refer to the miRNA First Strand Synthesis operation manual of Takara Company, reverse transcribe the extracted exosome RNA to synthesize the required cDNA.

[0075] 4. RT-qPCR reaction

[0076] The RT-qPCR reaction system and amplification program are shown in Table 3 and Table 4 respectively, and the fluorescence threshold is set to 0.08903.

[0077] Table 3 RT-qPCR reaction system

[0078]

[0079] Table 4 RT-qPCR amplification program

[0080]

[0081] 5. Amplification product analysis

[0082] Each sample is set with three replicate wells, the Ct value of each sample is read, and the expression level of each sample corresponding to 12 miRNAs is calculated by 2 -ΔΔCt

[0083] 6. Statistical analysis, selection of diagnostic cutoff

[0084] Use MedCalc 19.6.0 statistical analysis software for analysis and processing, and calculate the relative expression of 12 miRNAs according to 2 -ΔΔCt

[0085] II. Experimental results

[0086] The results are as follows Figure 3 ​​RT-qPCR analysis results showed that compared with the healthy control group, the expression levels of 10 exosomal miRNAs (186-5p, let-7d-5p, 151a-3p, 361-5p, 93-5p, 20a-5p, 320a-3p, 1et-7b-5p, 374a-5p, 98-5p) in the serum exosomes of brucellosis patients were significantly upregulated ( Figure 3 The AUC values ​​of single miRNAs were all above 0.7, with the largest being miRNA-361-5p, with an AUC value of 0.917 ( Figure 3 Middle C).

[0087] Example 3 Screening of serum exosome differentially expressed miRNAs combinations with optimal evaluation efficiency

[0088] To investigate whether there is a combined model with better diagnostic performance, we performed logistic regression analysis on the 10 miRNAs in Example 2.

[0089] 1. Experimental Methods

[0090] Logistic regression analysis and performance test of the diagnostic combination were performed on the data of the training set in Example 2 (serum samples of 12 confirmed brucellosis patients and serum samples of 12 healthy people).

[0091] Logistic regression analysis was performed on the training set data to identify three miRNAs (miR-93-5p, miR-320a-3p, and miR-20a-5p). All subsets were constructed and the area under the receiver operating characteristic curve (AUC) of each subset was compared. RT-qPCR was performed on the validation set using the same method as in Example 2 to obtain validation data. The selected combinations were validated using the area under the receiver operating characteristic curve (AUC) of the validation set. Residual analysis and cross-validation were then performed to further compare the diagnostic performance of the combinations.

[0092] 2. Experimental Results

[0093] We performed logistic regression analysis on these 10 miRNAs. Figure 4Figure 3A is a visualization of the logistic regression analysis process. After analysis, a set of all elements with significant (miR-20a-5p, miR-320a-3p, miR-93-5p) was obtained. The AUC values of all subsets were calculated, and their diagnostic performance was evaluated using ROC analysis. The AUC values of two models in seven subsets reached 1.0, namely combination 1 (miR-20a-5p+miR-320a-3p+miR-93-5p) and combination 2 (miR-20a-5p+miR-93-5p) Figure 4 Figure 3B Figure 4 Figure 3C). And the detection sensitivity and specificity of combination 1 and combination 2 both reached 1.0 respectively. It is illustrated that combination 1 and combination 2 have better diagnostic performance for brucellosis, and high diagnostic accuracy.

[0094] Example 4 Verification of diagnostic performance of combination

[0095] The serum samples of 12 confirmed brucellosis patients and 12 healthy people were re-collected as verification set samples to verify the diagnostic performance of combination 1 and combination 2 obtained in Example 3.

[0096] The expression levels of serum exosomal miR-20a-5p, miR-320a-3p and miR-93-5p in the verification set were detected again using qRT-PCR (the method is the same as in Example 2), and the diagnostic performance of combination 1 and combination 2 was evaluated using ROC curve analysis.

[0097] The results show that the expression levels of the three miRNAs in serum exosomes of brucellosis patients are significantly up-regulated compared with healthy people Figure 5 Figure 3A). Combination 1 (miR-20a-5p+miR-320a-3p+miR-93-5p) and combination 2 (miR-20a-5p+miR-93-5p) also have high AUC values in the verification set, among which the AUC value of combination 2 (AUC=0.988) is greater than that of combination 1 (AUC=0.914) Figure 5 Figure 3B); the sensitivity of the two combinations is 1.0, and the specificity of combination 2 (specificity=0.889) is greater than that of combination 1 (specificity=0.778). In addition, residual analysis and cross-validation prove that combination 2 (miR-20a-5p+miR-93-5p) has better diagnostic performance Figure 6 Figure 3A Figure 6 Figure 3B). The results further confirm that combination 1 and combination 2 can be used as high-accuracy detection biomarker compositions for brucellosis, and can be used for auxiliary diagnosis of brucellosis, and the diagnostic performance of combination 1 is better.

[0098] Figure 7 A general diagram for experiment design of the present application is shown.

[0099] In summary, the biomarker composition of the present application has a high AUC value (up to 0.988) when used for the diagnosis of brucellosis, has high diagnostic accuracy, and can quickly and reliably identify brucellosis patients.

[0100] The above examples only express several embodiments of the present application, which are described in more detail and in more detail, but cannot be understood as limiting the scope of the patent. It should be noted that for ordinary skilled in the art, without departing from the concept of the present application, several modifications and improvements can be made, which belong to the protection scope of the present application. Therefore, the protection scope of the present application patent should be subject to the appended claims.

Claims

1. The use of a biomarker composition in preparing a brucellosis detection kit, characterized in that: The biomarker composition includes miR-20a-5p and miR-93-5p.

2. The use according to claim 1, characterized in that The biomarker composition also includes miR-320a-3p.

3. Use of a reagent for detecting the expression level of the biomarker composition according to claim 1 or 2 in a biological sample in the preparation of a brucellosis detection kit.

4. The use according to claim 3, characterized in that The reagent for detecting the expression level of the biomarker composition in a biological sample includes a primer composition, which includes an upstream primer for the nucleotide sequence of miR-20a-5p as shown in SEQ ID NO: 13 and an upstream primer for the nucleotide sequence of miR-93-5p as shown in SEQ ID NO:

14.

5. The use according to claim 4, characterized in that The primer composition further includes an upstream primer whose nucleotide sequence is shown as SEQ ID NO: 15 and is directed to miR-320a-3p.

6. The use according to any one of claims 3 to 5, characterized in that The biological sample is exosomes, preferably serum exosomes.

7. A brucellosis detection kit, characterized in that, The kit comprises reagents for detecting the expression level of the biomarker composition according to claim 1 or 2 in a biological sample.

8. The kit according to claim 7, wherein The kit includes a primer composition, which includes an upstream primer targeting the nucleotide sequence of miR-20a-5p as shown in SEQ ID NO: 13 and an upstream primer targeting the nucleotide sequence of miR-93-5p as shown in SEQ ID NO:

14.

9. The kit according to claim 8, wherein The primer composition further includes an upstream primer whose nucleotide sequence is shown as SEQ ID NO: 15 and is directed to miR-320a-3p.

10. The kit according to any one of claims 7 to 9, wherein The kit also includes a primer pair for detecting the expression level of an internal reference gene; Preferably, the internal reference gene is U6.