SNP (Single Nucleotide Polymorphism) site related to color development of leaf pillow anthocyanin in seedling stage of millet, molecular marker and application of SNP site and molecular marker

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) site related to color development of leaf pillow anthocyanin in the seedling stage of millet, the SNP site is located at the 26876987 site of the No.7 chromosome of the millet, and the allelic variation of the SNP site is G / C. The invention provides an SNP site obviously related to the chromogenic character of the leaf pillow anthocyanin in the seedling stage of the millet, and develops the molecular marker related to the chromogenic character of the leaf pillow anthocyanin in the seedling stage of the millet, so that a genome DNA sequence is associated with the chromogenic character of the leaf pillow anthocyanin in the seedling stage of the millet, and establishment of a molecular marker-assisted breeding system of the millet is facilitated; and a direction and a basis can be provided for finer positioning and millet breeding.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biomolecules, and particularly relates to a SNP site related to millet seedling stage leaf pillow anthocyanin coloration, a molecular marker and application thereof. BACKGROUND

[0002] Millet (Setaria italica), also known as millet or millet in ancient times, is an annual herbaceous crop, and is one of important food crops in China and plays an irreplaceable role in the sustainable development of dry farming. Millet is drought-tolerant and water-saving, and is considered as a strategic reserve crop to cope with future drought environment and climate warming. The leaves of millet have leaf sheaths and leaf blades, and the leaf pillow is located at the outer edge of the joint of the leaf sheath and the leaf blade. The color of the leaf pillow is related to the content of anthocyanin contained therein, and anthocyanin is a natural pigment with various biological activities such as antioxidant and anti-inflammatory. The detection of the coloration of anthocyanin has certain practical significance for plant variety identification and screening. As a diploid self-pollinated crop, millet has a small genome, is convenient to operate, has a short breeding cycle, and has relatively simple genetics. At present, millet has a high-quality reference genome sequence, and the publication of the millet SSR genetic linkage map has laid a good foundation for genetic analysis of millet. Although the whole genome sequence of millet has been sequenced, there are few reports on the correlation of millet seedling stage leaf pillow anthocyanin coloration genes. Therefore, it is necessary to develop, utilize and identify the molecular markers of millet seedling stage leaf pillow anthocyanin coloration to breed more excellent varieties. SUMMARY

[0003] Based on the above background, the application provides a SNP site related to millet seedling stage leaf pillow anthocyanin coloration, a molecular marker and application thereof.

[0004] The technical scheme of the application is as follows:

[0005] The SNP site related to millet seedling stage leaf pillow anthocyanin coloration is located at position 26876987 of chromosome 7 of millet, and the allelic variation is G / C.

[0006] Based on the same inventive concept, the application provides an application of a substance for detecting the polymorphism or genotype of the SNP in the genome of millet in any one of the following applications, and the application comprises:

[0007] 1) an application in predicting millet seedling stage leaf pillow anthocyanin coloration;

[0008] 2) an application in identifying or assisting in identifying millet seedling stage leaf pillow anthocyanin coloration;

[0009] 3) an application in breeding or assisting in breeding related to millet seedling stage leaf pillow anthocyanin coloration;

[0010] The SNP site is located at 26876987 of chromosome 7 of the millet, and the allelic variation is G / C.

[0011] Based on the same inventive concept, the application provides a molecular marker related to the leaf pillow anthocyanin coloration of the seedling stage of the millet, which includes the site 26876987 of chromosome 7 of the millet;

[0012] The nucleotide sequence of the molecular marker is shown in SEQ ID No. 1. Specifically, the following can be seen:

[0013] CACAATTAAGTGTAAAAATTAGAGCTTACATTGGT[C / G]TCATACTCGTAGCCCCTCATTATCACCAGGATCCC, and the 36th base is G / C allelic variation.

[0014] Based on the same inventive concept, the application also provides applications of the molecular marker related to the leaf pillow anthocyanin coloration of the seedling stage of the millet in any of the following:

[0015] 1) application in predicting the leaf pillow anthocyanin coloration of the seedling stage of the millet;

[0016] 2) application in identifying or assisting in identifying the leaf pillow anthocyanin coloration of the seedling stage of the millet;

[0017] 3) application in the breeding or assisted breeding related to the leaf pillow anthocyanin coloration of the seedling stage of the millet

[0018] Based on the same inventive concept, the application also provides a method for predicting the leaf pillow anthocyanin coloration of the seedling stage of the millet, which uses a specific probe or chip of the SNP site to detect the genomic DNA of the prediction object, obtains the base condition of the allelic variation site of the SNP site, and predicts the leaf pillow anthocyanin coloration of the seedling stage of the millet according to the base condition.

[0019] Or using the DNA of the single leaf or seed of the millet as a template, using the primers corresponding to the above-mentioned molecular marker to perform PCR amplification, sequencing and identifying the amplification product, and predicting the leaf pillow anthocyanin coloration of the seedling stage of the millet according to the identification result.

[0020] Compared with the prior art, the application has the following beneficial effects:

[0021] The application provides a SNP site significantly related to the leaf pillow anthocyanin coloration of the seedling stage of the millet, and develops a molecular marker related to the leaf pillow anthocyanin coloration of the seedling stage of the millet based on the same inventive concept, so as to link the genomic DNA sequence with the leaf pillow anthocyanin coloration of the seedling stage of the millet, which is beneficial to the establishment of the molecular marker assisted breeding system of the millet, and can provide a direction and basis for more fine positioning and millet breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is the millet population structure analysis of Example 1 of the present invention;

[0023] Figure 2 This is the LD attenuation distribution diagram of Example 1 of the present invention. DETAILED DESCRIPTION

[0024] In order to make the objectives, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with its embodiments; it should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0025] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0026] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0027] Example 1: Determination of SNP sites and molecular markers associated with anthocyanin coloration in millet leaves at the seedling stage

[0028] In this example, 230 millet materials provided by Zhangjiakou Academy of Agricultural Sciences were selected, and the varieties of the millet materials included the following: Xiaofannuo, Sugu, Hongguzi, Dogtail Millet, Huangxu, Longzhuahuang, Xiangyanggu, Huanggu, Dahuanggu, Maomaohuang, Longgu 26, Longgu 30, Longgu 31, Longgu 17, Longgu 18, Longgu 19, Henggu 10, Henggu 11, Henggu 12, Henggu 21 varieties from various provinces across the country, and Liuwa Honggu × Henan 4·2SE165. A total of 230 millet accessions, including hybrids of 5·Xiaomaohuang·Xia1, Chaoxianggu x Xuandasui 5·2SE Hybrid·8, Liuwahonggu x Henan 4·2SE1655·Xiaomaohuang·Xia1, and Liuwahonggu x Henan 4·2SE1655·Xiaomaohuang·Xia1, were sown in the experimental fields of the Zhangjiakou Academy of Agricultural Sciences in mid-May 2023. Field trials were conducted, with each accession planted in two rows, with a 2-m row length, 50-cm row spacing, and 3-5-cm plant spacing. Field traits of each accession were measured at the seedling stage according to local management practices.

[0029] DNA samples were extracted from 230 foxtail millet accessions (leaves). After passing DNA quality testing, quantitative and qualitative analysis was performed using a NanoDrop ND-2000 (Thermo Scientific), and DNA integrity was assessed by gel electrophoresis. DNA amplification, fragmentation, precipitation, resuspension, microarray hybridization, and washing were performed according to standard microarray protocols.

[0030] 1) Original millet chip data processing

[0031] Firstly, the raw data scanned by GeneTitan system was imported into software Affymetrix Power Tools, and the raw data was clustered and genotyped by using the software. Finally, the PLINK format data was exported by Affymetrix Power Tools software for subsequent data analysis. Further, the PLINK format data was converted into SNP VCF format data by PLINK program, and the VCF format data was further analyzed.

[0032] 2) Conversion of chip SNP data

[0033] The above total SNP VCF file was screened, and the SNP VCF file of seedling stage traits was obtained according to the number of samples with phenotypes at different times. Vcftools was used for processing.

[0034] 3) Analysis of sample population structure

[0035] Principal component analysis was performed by ADMIXTURE program to obtain the population clustering of samples.

[0036] 4) Analysis of linkage disequilibrium (LD)

[0037] The linkage disequilibrium coefficient (r2) was used to measure the linkage disequilibrium level between SNP sites on the chromosome. When r2=0, it indicates that the population is in linkage equilibrium or without LD. The larger the r2, the closer the distance between SNP sites. Generally, when r2 is greater than or equal to 0.8, it is considered that the two sites belong to linkage disequilibrium. The distance between the sites corresponding to the half of the r2 decay is used as the linkage disequilibrium decay distance. The VCFtools software was used to calculate the decay value of linkage disequilibrium, and a trend graph of r2 decay with the increase of physical distance between SNP sites was drawn by using a nonlinear regression model.

[0038] 5) GWAS analysis of chip data and prediction of candidate genes

[0039] Based on the customized SNP chip (Affymetrix chip) with 82738 sites, at least 57877 SNP sites related to seedling stage were obtained by further screening SNP sites present in 95% of samples. In the formal GWAS analysis, the R package GWASpoly analysis process was used to analyze the correlation between various phenotypes at different development stages. In the 1-dom and additive modes, the mixed linear Q+K algorithm (population structure+kinship) was used to find the significant SNP of the phenotype correlation, and the genes within the 10kb range upstream and downstream of the SNP site were annotated. The results showed that the significant SNP of the leaf nodule anthocyanin coloration of the millet seedling stage was located at position 26876987 on chromosome 7. The polymorphism of this site was G / C, and the additive was 24.18. Figure 1 It can be seen that the clustering of ADMIXTURE needs to calculate the CV error (error of correlation) at different K values. The trend of K value is first decreasing and then increasing ( Figure 1 ), and the K value at which the increase begins is the optimal number of ancestral clusters with similar genetic backgrounds. In this experiment, the millet genome can be divided into approximately 35 ancestral clusters. Figure 2 It can be seen that the LD decay distance of the millet genome in this embodiment is 9M. Smaller LD decay distance is conducive to reducing the candidate region of subsequent association analysis and improving the accuracy of the association results.

[0040] In embodiment 2, a molecular marker related to the leaf nodule anthocyanin coloration of the millet seedling stage is developed based on the SNP site located in embodiment 1, and the molecular marker includes the 26876987 site on chromosome 7.

[0041] The nucleotide sequence of the molecular marker is shown as SEQ ID No. 1, and is specifically as follows:

[0042] CACAATTAAGTGTAAAAATTAGAGCTTACATTGGT[C / G]TCATACTCGTAGCCCCTCATTATCACCAGGATCCC, and the 36th base is G / C allelic variation.

[0043] The above molecular marker can be applied to predict the leaf nodule anthocyanin coloration of the millet seedling stage. Specifically, according to conventional operations, molecular primers corresponding to the molecular marker are designed by using Primer Premier (this is a conventional technology, which will not be described here, and Beijing Complin Biotechnology Co., Ltd. is entrusted to design), and the genome of millet is used as a template. Specifically, the DNA of millet leaves or seeds can be used as a template, PCR amplification is performed by using primers, the amplification product is sequenced and identified, and the leaf nodule anthocyanin coloration of the millet seedling stage is predicted according to the identification results.

[0044] Example 3: SNP marker verification

[0045] The 230 materials of Example 1 were counted for the anthocyanin coloration state of the leaf cushion at the seedling stage. Among them, 219 materials showed no or very weak anthocyanin coloration of the leaf cushion at the seedling stage, and the SNP site showed G allelic variation by molecular marker detection; the rest showed coloration, and the SNP site showed C allelic variation by molecular marker detection.

[0046] The above only describes the preferred embodiments of the present application, and it should be noted that for ordinary skilled persons in the art, some improvements and refinements can be made without departing from the principles of the present application, and these improvements and refinements should also be considered within the protection scope of the present application.

Claims

1. Use of a substance for detecting polymorphism or genotype of a SNP site in a millet genome in any of the following applications, characterized in that: The applications include: 1) Application in predicting the color development of anthocyanins in the leaves of millet seedlings; 2) Application in the identification or auxiliary identification of the color development of anthocyanins in the leaves of millet seedlings; 3) Application in breeding or auxiliary breeding related to the color development of anthocyanins in the leaf pulvinar of millet seedlings; The SNP site is located at position 26876987 of chromosome 7 of foxtail millet, and its allele variation is G / C.

2. A molecular marker related to the coloration of anthocyanins in the leaf pulvinus of millet seedlings, characterized in that: The molecular marker includes the 26876987th position of chromosome 7 of millet; The nucleotide sequence of the molecular marker is shown in SEQ ID No. 1: CACAATTAAGTGTAAAAATTAGAGCTTACATTGGT[C / G]TCATACTCGTAGCCCCTCATTATCACCAGGATCCC, the 36th base is a G / C allele variation.

3. Use of the molecular marker related to the coloration of anthocyanins in millet leaf pulvinus at the seedling stage according to claim 2 in any of the following applications, characterized in that: The applications include: 1) Application in predicting the color development of anthocyanins in the leaves of millet seedlings; 2) Application in the identification or auxiliary identification of the color development of anthocyanins in the leaves of millet seedlings; 3) Application in breeding or auxiliary breeding related to the color development of pulvinar anthocyanins in millet seedlings.

4. A method for predicting the color development of anthocyanins in millet pulvinus at the seedling stage, characterized in that: Using a specific probe or chip for detecting the SNP site described in claim 1, the genomic DNA of the millet to be predicted is detected to obtain the base situation of the allelic variation site of the SNP site described in claim 1, and the color development of anthocyanins in the leaf of millet seedlings is predicted based on the base situation; Alternatively, the DNA of a single leaf or seed of millet is used as a template, and primers corresponding to the molecular marker of claim 2 are used for PCR amplification. The amplified product is sequenced and identified, and the color development of anthocyanin in the leaf of millet seedlings is predicted based on the identification results.

Images