Primer probe group for detecting novel porcine parvovirus and application of primer probe group
By designing a real-time fluorescence quantitative PCR primer probe set, the difficulty of detecting the new porcine parvoviruses PPV8 and PPV9 in the existing technology has been solved, and specific and sensitive dual fluorescence quantitative PCR detection has been achieved, supporting the diagnosis and prevention of porcine parvovirus.
Patent Information
- Application Number
- CN202511012736.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-22
- Publication Date
- 2025-10-17
AI Technical Summary
Existing technologies are difficult to effectively detect the new porcine parvoviruses PPV8 and PPV9, especially in the PCR detection method, which is difficult to diagnose and has false positive results, and lacks high-specificity and high-sensitivity detection methods.
A real-time fluorescence quantitative PCR primer-probe set was designed, including specific primers and probes for PPV8 and PPV9. PPV8 and PPV9 were detected separately or in combination using a dual fluorescence quantitative PCR method, using probes labeled with different fluorescent groups to avoid mutual interference.
It achieves specificity, sensitivity and rapid detection of PPV8 and PPV9, reduces false positive results, provides an effective diagnostic method, and supports the prevention and control of porcine parvovirus and epidemiological investigations.
Smart Images
Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of biotechnology, in particular, to a primer probe set for detecting novel porcine parvovirus and application thereof. BACKGROUND
[0002] Members of the Parvoviridae family are non-enveloped and very small viruses, linear single-stranded DNA viruses with genome sizes of 4-6 kb.
[0003] In recent years, with the development of high-throughput sequencing technology and metagenomics, some new parvoviruses have been found in different animals. According to the classification criteria of parvovirus reported by the International Committee on Taxonomy of Viruses (ICTV), the amino acid sequence homology within the genus of parvovirus NS1 protein is greater than 30%, and the homology within the species is greater than 85%. Eight different porcine parvoviruses (PPV1 to PPV8) have been identified in pig populations, and all these viruses are distributed in different virus genera in Parvovirinae. According to the sequence homology of NS1 protein, PPV1-PPV8 can be divided into four genera of parvovirus, Protoparvovirus (PPV1, PPV8), Tetraparvovirus (PPV2, PPV3), Copiparvovirus (PPV4-PPV6), Chapparvovirus (PPV7). Among them, PPV1 is the earliest discovered virus and can cause reproductive disorders in pigs. However, whether PPV2-PPV8 can cause diseases is still unclear, so it is very difficult to diagnose.
[0004] Developing an effective detection method for strains with unknown clinical manifestations is of great significance for the prevention and control of emerging infectious diseases, and is conducive to early detection and early prevention and treatment.
[0005] PCR technology has become a widely used molecular biology method in nucleic acid detection, but it has the disadvantage of false positive results due to non-specific amplification. Real-time fluorescent quantitative PCR, an advanced molecular biology detection method, can not only quickly and accurately detect pathogens, but also has strong specificity and high sensitivity, and is expected to be used in the development of parvovirus strain detection technology. SUMMARY
[0006] One of the purposes of the present application is to provide a real-time fluorescent quantitative PCR primer probe set and method for effectively detecting novel porcine parvovirus PPV8 / PPV9.
[0007] The present application provides a primer probe set for detecting porcine parvovirus, which comprises a first primer probe set and / or a second primer probe set; The first primer probe set comprises primers as shown in SEQ ID NO. 5-6 and a probe as shown in SEQ ID NO. 7. The second primer probe set comprises primers as shown in SEQ ID NO. 11-12 and a probe as shown in SEQ ID NO. 13.
[0008] SEQ ID NO. 5: CAAGCAGAATACAGCGAAC; SEQ ID NO. 6: GTTAATAGTGATAGAAGGAGCATT; SEQ ID NO. 7: TTTTGGATTAATTGCAGGACCCC; SEQ ID NO. 11: CCCATGGTTGGACTCTACCAG; SEQ ID NO. 12: TGCTTGYTGGCGTGGAAATA; SEQ ID NO. 13: CAGCAAGAGCACACGAYCAAG.
[0009] According to the wild boar virus group result, the present application identifies a new porcine parvovirus (PPV9 / LNwb1) in a wild boar that is healthy in Liaoning, and through the multiple sequence comparison of NS1 amino acid, it is found that it has the highest homology of 58.6% with PPV8 in the known porcine parvovirus, and the second is PPV1 of 38.0% (PPV8 and PPV1 are the two known porcine parvoviruses in Liaoning) Figure 1 According to the parvovirus classification standard reported by ICTV, it is shown that it is a different virus species of the same virus genus (PPV1 and PPV8) (PPV1 and PPV8 are the two known porcine parvoviruses in Liaoning) Protoparvovirus ) of PPV1 and PPV8, so it is named as PPV9 (PPV9 / LNwb1). Meanwhile, according to the genetic evolution analysis of NS1 amino acid, it is shown that PPV9 is in the same large branch as PPV8 and PPV1, and in a small branch with PPV8, which indicates that it has a closer evolutionary relationship with PPV8 (PPV8 and PPV1 are the two known porcine parvoviruses in Liaoning) Figure 2 However, PPV8 and PPV9 are two newly identified porcine parvoviruses, and whether they can cause clinical symptoms of pigs is unknown, and it is difficult to diagnose. Therefore, it is particularly important to establish a rapid, simple, specific, sensitive and reliable PPV8 and / or PPV9 detection and identification method for the prevention and control and epidemiological investigation of the new porcine parvovirus.
[0010] Therefore, the present application establishes a real-time fluorescent quantitative PCR method, which can realize the separate detection of PPV8 or PPV9, and also can realize the joint detection of PPV8 and PPV9.
[0011] The first primer probe set is designed according to the NS1 gene sequence of PPV8. The second primer probe set is designed according to the NS1 gene sequence of PPV9 strain isolated from a wild boar which appears healthy. The target of the first primer probe set is shown as SEQ ID NO. 1, and the target of the second primer probe set is shown as SEQ ID NO. 3.
[0012] The first primer probe set can be used for the detection of PPV8, and the second primer probe set can be used for the detection of PPV9. When the first primer probe set and the second primer probe set are used for duplex real-time fluorescent quantitative PCR, the detection effects of the two groups of primer probes will not affect each other, and PPV8 or PPV9 can be detected alone, or PPV8 and PPV9 can be detected simultaneously, and the positive samples carrying PPV8 / PPV9 can be identified from pig tissue samples from different regions, thereby providing an effective and feasible diagnostic method for the diagnosis of PPV8 and PPV9 of pigs.
[0013] The primer probe set of the present application can be used for detection in different real-time fluorescent quantitative PCR reaction systems.
[0014] In the primer probe set of the present application, the probe is labeled with a fluorescent group; When the primer probe set simultaneously comprises the first primer probe set and the second primer probe set, the probe shown as SEQ ID NO. 7 and the probe shown as SEQ ID NO. 13 are respectively labeled with fluorescent groups of different fluorescent colors.
[0015] In the primer probe set of the present application, the fluorescent group is selected from any one of FAM, TAMRA, HEX, Texas Red, CY5, TET, JOE, CY3, ROX, LC RED640 and LC RED705.
[0016] As a specific embodiment, the 5' end of the probe shown as SEQ ID NO. 7 is labeled with HEX, and the 3' end is labeled with BHQ1. The 5' end of the probe shown as SEQ ID NO. 13 is labeled with FAM, and the 3' end is labeled with BHQ1.
[0017] The selection of the fluorescent group does not constitute a limitation to the present application, and any fluorescent group can be selected by a person skilled in the art according to the needs.
[0018] The present application further provides a target sequence for detecting porcine parvovirus, and the target sequence is shown as SEQ ID NO. 1 or 3.
[0019] The target sequence shown as SEQ ID NO. 1 can be used for the detection of PPV8, and the target sequence shown as SEQ ID NO. 3 can be used for the detection of PPV9.
[0020] The application also provides application of the primer probe set or the target sequence in the preparation of a detection kit for porcine parvovirus.
[0021] The application also provides a detection kit for porcine parvovirus, which comprises the primer probe set.
[0022] Preferably, the kit of the application further comprises a positive plasmid standard; the positive plasmid standard is a plasmid carrying the sequence shown in SEQ ID NO. 1 and / or a plasmid carrying the sequence shown in SEQ ID NO. 3. When the first primer probe set is used (to detect PPV8), a plasmid carrying the sequence shown in SEQ ID NO. 1 is used correspondingly. When the second primer probe set is used (to detect PPV9), a plasmid carrying the sequence shown in SEQ ID NO. 3 is used correspondingly.
[0023] Preferably, the kit further comprises other reagents required for real-time fluorescent quantitative PCR detection, and the reagents can be packaged separately or mixed in the form of a premix (Mix).
[0024] The application also provides a method for detecting porcine parvovirus for non-disease diagnosis and treatment purposes, which comprises using the DNA of a sample to be tested as a template and performing real-time fluorescent quantitative PCR by using the primer probe set or the kit, so as to determine whether the sample to be tested contains porcine parvovirus and / or the level of porcine parvovirus according to the amplification curve and the Ct value.
[0025] The specific determination method comprises: When PPV8 and PPV9 are detected, if there is a clear amplification curve and the Ct values are less than 36.01 and 37.82 respectively, it is determined that both are positive; if there is no amplification curve and no Ct value, it is determined that both are negative; if PPV8 and PPV9 are detected, if there is a clear amplification curve and the Ct values are in the ranges of 36.01-40 and 37.82-40 respectively, it is determined to be suspicious and needs to be re-confirmed.
[0026] The method for detecting porcine parvovirus of the application can be used for drug research and development (in vitro determination of drug efficacy) of porcine parvovirus and other non-disease diagnosis and treatment purposes.
[0027] In the method of the present application, the reaction system of the real-time fluorescent quantitative PCR includes 2 µL of template, 12.5 µL of 2X Premix Ex Taq, 0.4 µL of each of primers shown in SEQ ID NO. 5-6 with a concentration of 10 µM and / or 0.4 µL of each of primers shown in SEQ ID NO. 11-12 with a concentration of 10 µM, 0.6 µL of a probe shown in SEQ ID NO. 7 with a concentration of 10 µM and / or 0.6 µL of a probe shown in SEQ ID NO. 13 with a concentration of 10 µM, and the rest is ddH2O.
[0028] In the method of the present application, the reaction program of the real-time fluorescent quantitative PCR is 95℃, 180 s; 95℃, 10 s, 60℃, 60 s, 40 cycles.
[0029] The present application has at least the following beneficial effects: The present application provides a real-time fluorescent quantitative PCR primer probe set for porcine parvovirus, which can realize specific, sensitive and rapid detection of porcine parvovirus PPV8 and / or PPV9, has important significance for the diagnosis and prevention and control of porcine parvovirus infection, and has good application prospect. BRIEF DESCRIPTION OF DRAWINGS
[0030] Figure 1 Figure 6 is the result of multiple sequence comparison of parvovirus NS1 amino acid homology.
[0031] Figure 2 Figure 7 is the result of genetic evolution analysis of parvovirus NS1 amino acid.
[0032] Figure 3 Figure 10 is the specificity experiment of the fluorescent quantitative PCR method, wherein A: PPV8 and PPV9 positive mixed plasmid; B-M: PPV1, PPV7, PCV2, PCV3, PBoV3, ASFV, CSFV, RABV, PRV-A, BVDV, PRRSV and ddH2O.
[0033] Figure 4 Figure 11 is the sensitivity test result of the duplex real-time fluorescent quantitative PCR of PPV8, wherein 1-8 are respectively 1.0×10 7 -1.0×10 0 copies / µL of positive standard plasmid detection result, and 9 is a negative control.
[0034] Figure 5 Figure 12 is the standard curve of the duplex real-time fluorescent quantitative PCR of PPV8.
[0035] Figure 6 Figure 13 is the sensitivity test result of the duplex real-time fluorescent quantitative PCR of PPV9, wherein 1-8 are respectively 1.0×107 -1.0 x 10 0 copies / µL of positive standard plasmid detection results, 9 is negative control.
[0036] Figure 7 Standard curve of duplex real-time fluorescent quantitative PCR for PPV9. DETAILED DESCRIPTION
[0037] The preferred embodiments of the present application will be described in detail below with reference to the examples. It should be understood that the following examples are given only to illustrate the present application and are not intended to limit the scope of the present application. Those skilled in the art can make various modifications and replacements to the present application without departing from the spirit and principles of the present application.
[0038] The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained from commercial channels or prepared according to conventional methods in the art unless otherwise specified.
[0039] In the embodiments of the present application, the main reagents and instruments include: pMD™ 18-T Vector Cloning Kit and Premix Ex Taq™ (Probe qPCR) (Bodipy Biotech (Beijing) Co., Ltd., item number 6011 and RR390A), real-time fluorescent quantitative PCR instrument (Agilent Corporation, USA, model Strategene Mx3005P).
[0040] Example 1 Design and synthesis of porcine parvovirus primer and probe According to the known porcine parvovirus type 8 (PPV8) and one strain of porcine parvovirus type 9 (PPV9) identified by virus group (see SEQ ID NO. 17: PPV8 / GDJM2021 (OP021638.1) gene; SEQ ID NO. 18: PPV9 / wbLN01 (PV855286) gene) in the relatively conserved region (see SEQ ID NO. 17: PPV8 / GDJM2021 (OP021638.1) gene; SEQ ID NO. 18: PPV9 / wbLN01 (PV855286) gene and part of gene) Design primers and probes. Since the homology of the NS1 amino acid sequences of the two strains is as high as 58.6%, they are different virus species, therefore, according to the design principles of fluorescent quantitative PCR primers and probes, 2 pairs of primers and probes are designed for each strain respectively (Table 1), which are synthesized by Jilin Kumai Biotechnology Co., Ltd. NS1 NS1 VP1 Since the homology of the NS1 amino acid sequences of the two strains is as high as 58.6%, they are different virus species, therefore, according to the design principles of fluorescent quantitative PCR primers and probes, 2 pairs of primers and probes are designed for each strain respectively (Table 1), which are synthesized by Jilin Kumai Biotechnology Co., Ltd.
[0041] Table 1 Sequence information of fluorescent quantitative PCR primers and probes The DNA of PPV8 and PPV9 positive wild boar tissue samples was extracted as a template, and the Ct values obtained by fluorescence quantitative PCR detection were compared when different primer probe combinations were used, and the smallest Ct value was considered as the best primer and probe. The results are shown in Table 2, which shows that the primer probe numbers 1 and 3 are the best primers and probes for detecting PPV8 and PPV9, respectively.
[0042] Table 2 Comparison of the effects of different primers and probes for detecting PPV8 and PPV9, respectively Example 2 Construction of positive plasmid A plasmid containing the target sequence targeted by the primer probe set in Table 1 was constructed as a positive plasmid standard, and the specific method was as follows: The PPV8 fragment (137 bp, SEQ ID NO. 1, amplified by primer probe combination No. 1) and PPV9 fragment (269 bp, SEQ ID NO. 3, amplified by primer probe combination No. 3) were obtained by PCR amplification with primer probe combination No. 1 and No. 3 in Table 1, respectively, and were connected to pMD-18T vector, labeled as p18T-PPV8 and p18T-PPV9, respectively. The plasmid was sequenced correctly, and its concentration was determined, and its copy number (copies / μL) = (6.02×10 23 )× (ng / μL×10 -9 ) / (DNA length× 660) was calculated, which were 2.1×10 10 copies / µL and 5.4×10 10 copies / µL, respectively. Then they were mixed and diluted to a copy number of 1.0×10 10 copies / µL, which was used as a positive plasmid standard. Then it was diluted by 10 times to 1.0×10 0 copies / µL, and was stored at -20℃ for standby.
[0043] Example 3 Establishment of real-time fluorescence quantitative PCR method According to the Premix Ex Taq™ (Probe qPCR) instructions of TAKARA, the optimal primer and probe (primer probe combination No. 1 and No. 3) designed above were determined, and then the primer and probe concentration, annealing temperature and other conditions were optimized. The optimized reaction system is shown in Table 3.
[0044] Table 3 Fluorescence quantitative PCR reaction system The reaction conditions were 95℃ 60s, (95℃ 10s, 60℃ 60s) for 40 cycles.
[0045] 3.1 Optimization of the volume of upstream and downstream primers The total volume of the reaction system was 25 μL, of which Premix Ex Taq™ (Probe qPCR) was 12.5 μL, the positive standard plasmid (containing p18T-PPV8 and p18T-PPV9) prepared in Example 2 was used as a template (2 μL), the probe (10 μM, 1 μL), and the volume of the upstream and downstream primers (10 μM) was optimized, with 0.2 μL, 0.4 μL, 0.6 μL, 0.8 μL, and 1.0 μL, respectively.
[0046] 3.2 Optimization of the volume of the probe The volume of the probe (10 μM) was optimized, with 0.2 μL, 0.4 μL, 0.6 μL, 0.8 μL, and 1 μL, respectively.
[0047] 3.3 Optimization of the pre-denaturation time The pre-denaturation time was optimized, with 1 min, 3 min, and 10 min, respectively.
[0048] 3.4 Optimization of the annealing temperature The annealing temperature was optimized, with 57℃, 58℃, 59℃, 60℃, and 61℃, respectively.
[0049] 3.5 Optimization of the denaturation time The denaturation time was optimized, with 5 s, 10 s, and 20 s, respectively.
[0050] 3.6 Optimization of the annealing time The annealing time was optimized, with 30 s, 45 s, and 60 s, respectively.
[0051] According to the optimized conditions, the Ct values were compared, and the smallest Ct value was considered as the best reaction condition. The results are shown in Tables 4-9.
[0052] Table 4 Optimization of the volume of primers When 0.4 μL of the upstream and downstream primers of PPV8 and PPV9 was added, the Ct value was the smallest.
[0053] Table 5 Optimization of the volume of the probe When 0.6 μL of the probe of PPV8 and PPV9 was added, the Ct value was small.
[0054] Table 6 Optimization of the denaturation time When the denaturation time was 10 s, the Ct value was the smallest.
[0055] Table 7 Annealing temperature optimization When the annealing temperature was 60℃, the Ct value was the smallest.
[0056] Table 8 Annealing time optimization When the annealing time was 60 s, the Ct value was the smallest.
[0057] Table 9 Pre-denaturation time optimization When the pre-denaturation time was 3 min, the Ct value was the smallest.
[0058] In summary, the optimal reaction conditions of the established duplex real-time fluorescent quantitative PCR method for detecting PPV8 and PPV9 were 95℃ 180 s, (95℃ 10 s, 60℃ 60 s) 40 cycles, and the optimal reaction system was shown in Table 10.
[0059] Table 10 Fluorescent quantitative PCR reaction system Example 4 Specificity experiment The positive nucleic acids of porcine parvovirus type 1 (PPV1), porcine parvovirus type 7 (PPV7), porcine circovirus type 2 (PCV2), porcine circovirus type 3 (PCV3), porcine bocavirus type 3 (PBoV3), African swine fever virus (ASFV), classical swine fever virus (CSFV), rabies virus (RABV), porcine rotavirus type A (PRV-A), bovine viral diarrhea virus (BVDV), and porcine reproductive and respiratory syndrome virus (PRRSV) were used as reaction templates, ddH2O was used as negative control, and the mixed plasmid of PPV8 and PPV9 (positive standard plasmid prepared in Example 2) was used as positive control. The fluorescent quantitative PCR method established in Example 3 was used for specificity experiment.
[0060] The results are shown in Table 11. Figure 3 As shown in Table 11, only the positive control appeared a specific amplification curve, indicating that PPV8 and PPV9 could be detected at the same time, while the specific amplification curves of the remaining viruses did not appear, i.e. other viruses could not be detected, indicating that the method had good specificity.
[0061] Example 5 Sensitivity experiment 1.0×10 0 -1.0×10 7The sensitivity experiment was performed by using the fluorescent quantitative PCR method established in Example 3, with p18T-PPV8 and p18T-PPV9 positive standard plasmids prepared in Example 2 as templates, and ddH2O as a negative control, to determine the minimum number of copies detected. Each detection was repeated three times.
[0062] The results are shown in Figure 4 and Figure 6 The minimum detection limit of PPV8 and PPV9 was 1x10.0 copies / µl. Since the detection signals of the two viruses were in different fluorescence channels (HEX and FAM), they did not interfere with each other. When PPV8 and PPV9 were detected with obvious amplification curves and Ct values less than 36.01 and 37.82, respectively, they were judged to be positive; when there was no amplification curve and no Ct value, they were judged to be negative; when PPV8 and PPV9 were detected with obvious amplification curves and Ct values between 36.01-40 and 37.82-40, respectively, they were judged to be suspicious and needed to be reconfirmed.
[0063] In addition, by detecting positive standard plasmids of different concentrations, the present application also established a standard curve, which can perform absolute quantitative analysis on samples. The standard curve for PPV8 detection ( Figure 5 ): HEX Standards, RSq: 0.996; HEX, Y=-2.995xLOG(X)+40.31, Eff.=115.7%. The standard curve for PPV9 detection ( Figure 7 ): FAM Standards, RSq: 0.993; FAM, Y=-3.330xLOG(X)+41.68, Eff.=99.7%.
[0064] The amplification efficiency of the standard curves of PPV8 and PPV9 was 115.7% and 99.7%, respectively, and the correlation coefficients were 0.996 and 0.993, respectively. The gradient of the amplification curve Ct value decreased uniformly, indicating that the detection method had high sensitivity.
[0065] Example 6 Reproducibility experiment The duplex real-time fluorescent quantitative PCR method established in Example 3 was used to perform inter-batch and intra-batch reproducibility experiments on PPV8 and PPV9 positive plasmids of different copy numbers (1x10 5 , 1x10 6 , and 1x10 7 copies / µl) prepared in Example 2. Each sample was set up with three parallel repeats, and a negative control (ddH2O) and a positive control (standard plasmid prepared in Example 2) were set up. The average Ct value, standard deviation, and coefficient of variation of the reaction results were calculated to evaluate the reproducibility of the established fluorescent quantitative PCR.
[0066] The result of negative control was no amplification curve. The positive control appeared obvious S-shaped amplification curve. The specific results were shown in Table 11. The intra-group and inter-group coefficient of variation (CV) of PPV8 and PPV9 were less than 2%, and the negative control had no specific amplification, which indicated that the double real-time fluorescent quantitative PCR method using the above primer and probe combination had good amplification repeatability, and showed good stability.
[0067] Table 11 Reproducibility analysis of fluorescent quantitative PCR for samples with different copy numbers Example 7 Detection of wild boar tissue samples 7.1 Extraction of DNA from samples to be detected The DNA in the wild boar samples to be detected was extracted according to the instructions of the blood / cell / tissue genomic DNA extraction kit (DP304) of TIANGEN Company, for subsequent detection.
[0068] 7.2 Detection of PPV8 and PPV9 in wild boar tissue samples The double real-time fluorescent quantitative PCR method for PPV8 and PPV9 established in Example 3 was used to simultaneously detect PPV8 and PPV9 in 71 wild boar tissue samples (from Heilongjiang, Jilin and Liaoning). At the same time, the nested PCR method was used to detect PPV8 and PPV9 in the above samples, respectively, and the coincidence rate of the two methods was compared.
[0069] The inner and outer sleeve reaction systems of nested PCR were both 25 μl, and the specific contents were as follows: 2 × Taq Master Mix 12.5 μl, ddH2O 8.5 μl, upstream primer (10 μM) 1 μl, downstream primer (10 μM) 1 μl, DNA 2 μl. After mixing, PCR amplification was performed. The inner and outer sleeve PCR programs were as follows: 95℃ 3min; 95℃ 30s, 57℃ 30s, 72℃ 30s, 35 cycles; 72℃ 7min, 12℃ 5min.
[0070] The results are shown in Table 13. The duplex fluorescent qPCR method established in Example 3 detected 3 PPV8 positive samples and 5 PPV9 positive samples, with positive rates of 4.2% and 7.0%, respectively. In addition, according to the conserved regions of PPV8 and PPV9, nested primers were designed (Table 12), and the DNA of tissue samples from 71 wild boars was detected for PPV8 and PPV9, respectively. The results showed that the nested PCR method detected 2 PPV8 positive samples and 4 PPV9 positive samples, with positive rates of 2.8% and 5.6%, respectively (Table 13), which were lower than those of the duplex fluorescent qPCR method. The coincidence rate of the positive rates of PPV8 and PPV9 was 100%, and the total coincidence rate of the detection results of PPV8 and PPV9 was 98.6% (Tables 14 and 15). It was shown that the sensitivity of the duplex fluorescent qPCR method was slightly higher than that of the nested PCR method.
[0071] Table 12. Nested PCR primer sequence information In Table 12, R represents A or G, Y represents C or T, W represents A or T, M represents A or C, D represents A or G or T, and K represents G or T.
[0072] Table 13. Statistical situation of detection of PPV8 and PPV9 infection in wild boars by two methods Table 14. Coincidence rate of detection of PPV8 infection in wild boars by two methods Table 15. Coincidence rate of detection of PPV9 infection in wild boars by two methods Although the present application has been described in detail with general description and specific embodiments above, some modifications or improvements can be made on the basis of the present application, which is obvious to those skilled in the art. Therefore, these modifications or improvements made on the basis of not deviating from the spirit of the present application, are within the scope of the present application claimed.
Claims
1. A primer probe set for detecting porcine parvovirus, characterized in that: comprising a first primer probe set and / or a second primer probe set; The first primer-probe set includes primers as shown in SEQ ID NO.5-6 and a probe as shown in SEQ ID NO.7; The second primer-probe set includes primers shown as SEQ ID NO.11-12 and a probe shown as SEQ ID NO.
13.
2. The primer probe set according to claim 1, characterized in that The probe is labeled with a fluorescent gene; When the primer probe set includes both the first primer probe set and the second primer probe set, the probe shown in SEQ ID NO. 7 and the probe shown in SEQ ID NO. 13 are respectively labeled with fluorescent groups that produce different fluorescent colors.
3. The primer probe set according to claim 2, characterized in that The fluorescent group is selected from any one of FAM, TAMRA, HEX, Texas Red, CY5, TET, JOE, CY3, ROX, LC RED640, and LC RED705.
4. A target sequence for detecting porcine parvovirus, characterized in that: The target sequence is shown as SEQ ID NO. 1 or 3.
5. Use of the primer-probe set according to any one of claims 1 to 3 or the target sequence according to claim 4 in preparing a detection kit for porcine parvovirus.
6. A detection kit for porcine parvovirus, characterized in that: The kit comprises the primer-probe set according to any one of claims 1 to 3.
7. The kit according to claim 6, characterized in that The kit further comprises a positive plasmid standard; the positive plasmid standard is a plasmid carrying the sequence shown in SEQ ID NO.1 and / or a plasmid carrying the sequence shown in SEQ ID NO.
3.
8. A method for detecting porcine parvovirus for purposes other than disease diagnosis and treatment, characterized in that: The method comprises using the DNA of the sample to be tested as a template, performing real-time fluorescence quantitative PCR using the primer probe set according to any one of claims 1 to 3 or the kit according to claim 6 or 7, and judging whether the sample to be tested contains porcine parvovirus and / or its level based on the amplification curve and Ct value.
9. The method according to claim 8, characterized in that Each 25 μL of the real-time fluorescence quantitative PCR reaction system includes: 2 μL of template, 12.5 μL of 2X Premix Ex Taq, 0.4 μL of each primer shown in SEQ ID NO. 5-6 at a concentration of 10 μM and / or 0.4 μL of each primer shown in SEQ ID NO. 11-12 at a concentration of 10 μM, 0.6 μL of the probe shown in SEQ ID NO. 7 at a concentration of 10 μM and / or 0.6 μL of the probe shown in SEQ ID NO. 13 at a concentration of 10 μM, and the balance is ddH2O.
10. The method according to claim 8 or 9, characterized in that The reaction program of the real-time fluorescence quantitative PCR was 95° C., 180 s; 95° C., 10 s, 60° C., 60 s, 40 cycles.