Synthesis of humanized collagen type XVII and preparation method and application thereof

Abstract

The application discloses synthesis of type XVII humanized collagen and a preparation method and application thereof, and particularly relates to the technical field of genetic engineering. The amino acid sequence of the recombinant type XVII collagen is shown as SEQ ID NO. 1. The application retains key functional domains (5 high-hydrophilicity and high-stability peptide segments of 641-685) in the alpha 1 chain of human type XVII collagen, and eliminates non-functional regions. The application adopts 100% human sequence coverage, completely avoids the immunogenicity risk of animal-derived collagen, and has excellent biocompatibility. The functional peptide segments are repeated twice to form a stable structure of 210 amino acids, and the protein functional activity is enhanced. The theoretical isoelectric point (pI=6.07) is close to the pH (7.4) of human tissue fluid, the solubility is excellent, and the applicability is strong.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, specifically to a method for synthesizing humanized type XVII collagen, its preparation, and its applications. Background Technology

[0002] Collagen is widely used in the fields of biomedicine and tissue engineering due to its excellent biocompatibility, biodegradability and safety, such as drug gene delivery systems, cell culture, artificial blood vessels, tendons, bone and skin scaffolds, hemostatic materials, etc.

[0003] Type XVII collagen (COL17 / BP180 / BPAG2) is a rare type II transmembrane protein found in tissues such as skin, mucous membranes, and the eyes. It plays a crucial role in maintaining the connections between intracellular and extracellular structural elements involved in epidermal adhesion. COL17 plays a vital role in forming the cell infiltration barrier and is also a key factor in maintaining skin homeostasis, anti-aging, and wound repair regulation. Therefore, COL17 has significant development value in applications related to skin and wound care, tissue regeneration and repair, and anti-aging.

[0004] Natural animal-derived type XVII collagen is present in low amounts and poses significant risks due to its immunogenicity and virality, necessitating sophisticated production processes. Furthermore, as a trace amount of collagen, type XVII collagen's low expression levels and the difficulty of large-scale production present further challenges. Therefore, using genetic engineering techniques to obtain recombinant collagen has become the most ideal method for collagen production.

[0005] Chinese patent CN116640205A discloses a recombinant type XVII collagen and its expression strain. The recombinant type XVII collagen sequence is obtained by combining the integrin-binding functional domains of human type XVII collagen, located in both the collagen and non-collagen domains, comprising two non-collagen domains and four collagen domains. After codon optimization, it was transformed into Pichia pastoris, and a high-copy Pichia pastoris genetically engineered strain obtained through G418 resistance gradient screening was able to stably express the recombinant type XVII collagen. However, while the recombinant type XVII collagen obtained by this patent can promote the proliferation, migration, and adhesion of human hair follicle stem cells and human fibroblasts, its effects on wound repair and anti-aging are relatively poor.

[0006] Chinese patent CN117866077A, through the design and splicing of the sequence of human type XVII collagen, obtained two recombinant type XVII collagen proteins, solving the problem that the performance of recombinant type XVII collagen proteins in the prior art needs improvement. The recombinant type XVII collagen proteins provided by this invention have superior anti-aging and wrinkle-reducing effects, and can exert excellent efficacy even at low concentrations. However, this patent is not effective in wound repair, especially for diabetic wound repair.

[0007] Therefore, finding a synthetic type XVII collagen that can both mass-produce human type XVII collagen and possess anti-aging, wrinkle-reducing, and wound-repairing properties, especially for repairing diabetic wounds, is a pressing problem that needs to be solved. Summary of the Invention

[0008] Therefore, this invention provides a method for synthesizing type XVII humanized collagen, its preparation, and its application, in order to solve the problems in the prior art.

[0009] To achieve the above objectives, the present invention provides the following technical solution:

[0010] According to a first aspect of the present invention, a synthetic type XVII humanized collagen is provided, wherein the amino acid sequence of the recombinant type XVII collagen is shown in SEQ ID NO.1.

[0011] Furthermore, the peptide composition of the amino acids includes segments 641-685, 734-757, 773-787, 915-932, and 957-968 of the human type XVII collagen α1 chain.

[0012] Furthermore, the peptide segments of the amino acids are repeated twice to obtain the amino acid sequence; the total number of amino acids is 210, the theoretical isoelectric point (PI) is 6.07, it has good stability, high hydrophilicity, good solubility and high compatibility under the pH conditions of human tissue fluid.

[0013] Furthermore, the nucleotide sequence encoding the amino acid is shown in SEQ ID NO.2. This sequence was obtained by codon optimization of the gene sequence encoding the above-mentioned synthetic type XVII humanized collagen, specifically Pichia pastoris codon preference optimization.

[0014] According to a second aspect of the present invention, a recombinant vector for expressing and synthesizing type XVII humanized collagen is provided, wherein the recombinant vector contains the aforementioned nucleotide sequence. The synthesized gene sequence is subjected to PCR to obtain the target sequence, and after digestion with EcoRI / Not I, it is ligated into the plasmid pPIC9K to obtain the recombinant expression vector. The pPIC9K plasmid possesses an α-factor secretion signal sequence, enabling secretory expression using yeast. The vector fragment is cloned using PCR primers, and seamless DNA sequence splicing is achieved using homologous recombinase. In the spliced ​​vector, the multiple cloning site sequence of the pPIC9K plasmid is deleted by 12 nucleotides, and the expression product is missing 4 amino acids.

[0015] According to a third aspect of the present invention, a recombinant strain expressing synthetic type XVII humanized collagen is provided, the recombinant strain comprising a host cell and the aforementioned recombinant expression vector introduced into the host cell. The recombinant expression plasmid is electrotransformed into Pichia pastoris GS115 competent cells, and transformed strains are screened using histidine-deficient medium. Multiple-copy transformed strains are then screened using G418 resistance to obtain an engineered Pichia pastoris strain capable of expressing synthetic type XVII humanized collagen.

[0016] Furthermore, the recombinant strain was classified and named Komagataella pastoris, strain number KP0003, and its accession number was GDMCC No: 66336.

[0017] According to a fourth aspect of the present invention, a method for preparing synthetic type XVII humanized collagen is provided, the method comprising:

[0018] Step 1: Gene Synthesis

[0019] A codon-optimized nucleotide sequence was synthesized, as shown in SEQ ID NO.2;

[0020] Step 2: Synthesis and Construction of Expression Plasmids

[0021] The synthesized gene was cloned into the corresponding sites of the Pichia pastoris expression vector pPIC9K via EcoRI and Not I restriction sites to obtain the initial recombinant plasmid pPIC9K-C17A1-9, which contains α-secretion factor;

[0022] Step 3, Recombinant plasmid modification

[0023] The coding sequence of the 4 amino acids (YVEF) at the C-terminus of the α-secretion factor in the initial recombinant plasmid pPIC9K-C17A1-9 was deleted to obtain pPIC9K-C17A1T01;

[0024] Step 4: Transformation and Cultivation

[0025] The recombinant plasmid pPIC9K-C17A1T01 was transformed into Pichia pastoris host cells, and engineered strains were screened. The engineered strains were then fermented and cultured to induce the expression of the target protein under appropriate conditions.

[0026] Step 5, Harvesting and Purification

[0027] The fermentation broth was collected, the expressed protein product was harvested, and high-purity target collagen was obtained by efficient purification using cation exchange.

[0028] Furthermore, in step four, the fermentation culture adopts a staged culture strategy, specifically a glycerol batch culture to accumulate biomass until the OD600 reaches the critical value (as an example, the value in this invention is 30-50); glycerol fed culture to further increase cell density (to carry out high-density fermentation); and a methanol induction stage, in which the methanol flow rate is gradually increased from 2 mL / L / h to 6 mL / L / h, and the induction is continued for 72-96 hours to maximize protein secretion.

[0029] According to a fifth aspect of the present invention, a synthetic type XVII humanized collagen is used in the preparation of cosmetics, health products, food additives, medical devices, or pharmaceuticals. As an example, its preferred application is in the repair of diabetic wounds, and it also has certain repair effects on diabetic foot and other conditions.

[0030] This invention preferentially utilizes highly hydrophilic and stable peptides within the collagen domain of the α1 chain of type XVII collagen, which were then spliced ​​together. The expression vector pPIC9K was constructed and modified using genetic engineering methods. Four amino acid sequences associated with multiple cloning sites on the plasmid and potentially remaining at the N-terminus of the target protein were deleted to reduce the amount of non-human peptide residues in the expression product. Microbial synthesis was performed using Pichia pastoris, resulting in collagen with 100% sequence coverage of human type XVII collagen. This protein promotes cell adhesion, migration, proliferation, and matrix remodeling, and exhibits good compatibility, protective, and repair properties with human skin.

[0031] The present invention has the following advantages:

[0032] This invention retains the key functional domains (5 highly hydrophilic and stable peptide segments, such as 641-685) of the α1 chain of human type XVII collagen, while eliminating non-functional regions. The 100% human sequence coverage completely avoids the immunogenicity risks associated with animal-derived collagen, resulting in excellent biocompatibility. The functional peptides are repeated twice, forming a stable 210-amino acid structure that enhances protein function and activity. The theoretical isoelectric point (pI=6.07) is close to the pH of human tissue fluid (7.4), exhibiting excellent solubility and broad applicability.

[0033] This invention uses a Pichia pastoris expression system with eukaryotic protein modification capabilities. It utilizes α-factor secretion signals to achieve extracellular protein secretion, simplifying downstream purification. The codon preference optimization of this invention is adapted to the Pichia pastoris tRNA library, significantly improving expression efficiency. The four non-human amino acid (YVEF) coding sequences remaining at the multiple cloning site of the pPIC9K vector are deleted to ensure the purity of the product sequence.

[0034] This invention employs a staged culture method, first establishing a foundation with glycerol batch culture, followed by glycerol supplementation. Pichia pastoris' metabolism of glycerol does not produce ethanol inhibition, and it also avoids the Crabtree effect, thus preventing potential metabolic burdens or byproduct accumulation problems caused by excessive carbon sources. OD 600 The critical value is controlled between 30-50, and feeding is switched to before the cell enters the decline phase to ensure high cell viability. A methanol gradient design is then used to avoid cell apoptosis caused by excessive methanol concentration and to prolong cell secretion time. The temperature is controlled at 20-25℃ to reduce the folding rate and reduce the formation of collagen aggregates.

[0035] The XVII type collagen obtained by this invention not only has anti-aging and wrinkle-reducing effects, but also has a good repair effect on trauma, especially diabetic trauma. Attached Figure Description

[0036] To more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are merely exemplary, and those skilled in the art can derive other embodiments based on the provided drawings without creative effort.

[0037] The structures, proportions, sizes, etc. illustrated in this specification are only for the purpose of assisting those skilled in the art in understanding and reading the content disclosed herein, and are not intended to limit the conditions under which the present invention can be implemented. Therefore, they have no substantial technical significance. Any modifications to the structure, changes in the proportions, or adjustments to the size, without affecting the effects and objectives that the present invention can produce, should still fall within the scope of the technical content disclosed in the present invention.

[0038] Figure 1 This is a plasmid map of the expression of humanized collagen C17A1T01 of type XVII provided in Example 1 of the present invention.

[0039] Figure 2 This is a colony diagram of the Pichia pastoris transformant provided in Example 1 of the present invention grown on MD plates.

[0040] Figure 3This is the recombinant Pichia pastoris colony genome PCR provided in Example 1 of the present invention.

[0041] Figure 4 This is the SDS-PAGE electrophoresis pattern of the purified C17A1T01 protein provided in Example 1 of the present invention; wherein, M: protein marker, 1: loading solution, 2-4: elution solution.

[0042] Figure 5 This refers to the stability of the C17A1T01 protein provided in Experimental Example 2 of the present invention when stored at 57°C; wherein, M: protein marker, 1: day 0, 2: day 1, 3: day 3, 4: day 5, 5: day 7.

[0043] Figure 6 This is a circular dichroism (CD) chromatogram of the C17A1T01 protein provided in Experimental Example 3 of the present invention.

[0044] Figure 7 The results of experiments on cell proliferation, cell adhesion, and cell migration of C17A1T01 protein provided in Experiment Example 4 of this invention are as follows.

[0045] Figure 8 This is a graph showing the evaluation results of diabetic wound healing provided in Experimental Example 5 of this invention. Detailed Implementation

[0046] The following specific embodiments illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. Obviously, the described embodiments are only some, not all, of the embodiments of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0047] Yeast extract: Oxoid, LP0021B;

[0048] Peptone: Oxoid, LP0042B;

[0049] YNB: Shanghai Yuanye Biotechnology Co., Ltd., S24483;

[0050] Glycerin: Recombinant, GY20250113;

[0051] Biotin: aladdin, D2317484;

[0052] Potassium phosphate buffer: Beijing Solarbio Science & Technology Co., Ltd., P1030.

[0053] Example 1

[0054] Preparation of synthetic human type XVII collagen C17A1T01

[0055] 1. Synthesis of C17A1T01 expression plasmid

[0056] In this embodiment, the amino acid sequence of the human type XVII collagen C17A1T01 is as shown in SEQ ID NO.1, consisting of 210 amino acids. Codon optimization and chemical synthesis of the nucleotide sequence were commissioned to Nanjing GenScript, and the optimized nucleotide sequence is shown in SEQ ID NO.2. Nanjing GenScript also commissioned the construction of the recombinant plasmid: the synthesized gene fragment was inserted into the EcoRI / Not I site of the pPIC9K vector via EcoRI (Takara product number: 1611) and Not I (Takara product number: 1623) restriction enzyme sites, resulting in the recombinant plasmid pPIC9K-C17A1-9. The plasmid map is shown below. Figure 1 As shown.

[0057] 2. Modification with recombinant plasmid pPIC9K-C17A1T01

[0058] Using recombinant plasmid pPIC9K-C17A1-9 as a template, PCR amplification was performed using primer pair P1 / P2, and fragment 1 was recovered. PCR amplification was then performed using primer pair P3 / P4, and fragment 2 was recovered. The original plasmid pPIC9K was double-digested with Aan I (thermofisher, catalog number: FD2064) and Not I (Takara, catalog number: 1623) to obtain a linearized vector without α-secreting factor. The linearized plasmid, fragment 1, and fragment 2 were ligated using a multi-fragment homologous recombinase (Novizan, catalog number: C117) to obtain the modified recombinant plasmid pPIC9K-C17A1T01. Compared to the original plasmid, this plasmid successfully deleted the 4-amino acid YVEF coding sequence at the end of the α-secreting factor and can still express the target gene.

[0059] The primer sequences are as follows:

[0060] P1: ataacgggttattgtttataaatactactattgccagcattgctg (as shown in SEQ ID NO.3);

[0061] P2: ccagcttcagcctctcttttctcg (as shown in SEQ ID NO.4);

[0062] P3: aaaagagaggctgaagctggcgagaaaggtgagagaggg (as shown in SEQ ID NO.5);

[0063] P4: aaggcgaattaattcgcggccgctcatgggtcacccttatcaccc (as shown in SEQ ID NO.6);

[0064] The new recombinant plasmid pPIC9K-C17A1T01 was transformed into competent *E. coli* cells (Beijing Tiangen Biotech). The cells were plated on LB agar plates containing kanamycin and cultured for 16 hours. Positive colonies containing the recombinant plasmid pPIC9K-C17A1T01 were screened and verified by colony PCR. The PCR primers are as follows:

[0065] P5: cgactggttccaattgacaagct (as shown in SEQ ID NO.7);

[0066] P6: gcaaatggcattctgacatcctct (as shown in SEQ ID NO. 8);

[0067] All primer synthesis was outsourced to Sangon Biotech in Shanghai, and all sequencing was outsourced to BGI Genomics. The target band size was 1121 bp. The sequencing results of the PCR products from positive colonies were completely consistent with the theoretical sequence.

[0068] 10 μg of recombinant plasmid pPIC9K-C17A1T01 was linearized by digestion with Sal I enzyme. The digestion reaction conditions were 37℃ for 15 min, followed by purification and concentration for later use.

[0069] 3. Pichia pastoris GS115 electroconversion

[0070] After sterilization with anhydrous ethanol, the electroporation cuvettes were placed on ice. 10 μg of the linearized plasmid obtained in the previous step was mixed with 80 μL of GS115 Pichia pastoris competent cells. The mixture was transferred to an electroporation cuvette with a diameter of 0.2 cm, incubated on ice for 5 min, and then electroporated: voltage 1.5 kV; capacitance 25 μF; resistance 200 Ω; electroporation time 4–6 msec. After electroporation, 900 μL of pre-cooled 1M sorbitol solution was mixed, gently blown to mix, and then transferred to a 2 mL EP tube. The tubes were incubated at 28°C for 2 h. The cells were collected by low-speed centrifugation at 700 g and plated onto MD plates. The plates were incubated at 30°C for 3–4 days, and the transformed colonies were collected and verified. Figure 2 As shown.

[0071] 3. Identification of recombinant Pichia pastoris strains

[0072] Single colonies from MD plates were inoculated into 25 mL of BMGY medium (1% yeast extract + 2% peptone + 1.34% YNB + 1% glycerol + 0.0004% biotin + 100 mM potassium phosphate buffer (pH 6.0)) and cultured overnight at 28°C and 220 rpm. The bacterial culture in the logarithmic growth phase (approximately 16 hours, OD600 = 4-6) was centrifuged at 4000 rpm at room temperature to collect the cells. After removing the supernatant, the cells were resuspended in BMMY medium (1% yeast extract + 2% peptone + 1.34% YNB + 0.0004% biotin + 100 mM potassium phosphate buffer (pH 6.0)) until OD=1 and induced to express (total medium volume 100 mL).

[0073] The strains with high expression levels were selected and inoculated into 24-well plates containing 0.5 mL of YPD liquid medium, and cultured overnight at 28°C and 220 rpm. Yeast genomic DNA was extracted and PCR was performed using primers P3 and P6 for verification; the expected band size was 747 bp. Electrophoresis results of the PCR products of positive clones are shown below. Figure 3 As shown, the sequencing results were completely consistent with the theoretical sequence, and the correctly identified positive strain was obtained and named KP0003.

[0074] Positive bacteria - Pichia pastoris Komagataella pastoris KP0003 is deposited at the Guangdong Provincial Center for Microbial Culture Collection (recombinant strain classification and naming). Komagataella pastoris The strain name is Komagataella pastoris KP0003, accession number GDMCC No: 66336, dated May 14, 2025, Guangdong Provincial Center for Microbial Culture Collection, address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Academy of Sciences Institute of Microbiology, postal code: 510070).

[0075] 4. Protein expression

[0076] Glycerol batch culture: Accumulating biomass to OD 600 Upon reaching the critical value of 30, glycerol-fed culture was initiated, with 50% glycerol (containing 12 mL / L PTM1) added at a rate of 4-6 mL / L / h, continuing the reaction until the OD value was reached. 600 =100±20; During the methanol induction phase, the methanol flow rate was gradually increased (each liter of methanol contained 12 mL of PTM1). The flow rate was low (2 mL / L / h) for 0-12 hours to avoid methanol toxicity. For 12-24 hours, the flow rate was increased to 4 mL / L / h, and DO fluctuations were monitored. For 24-96 hours, the flow rate was high (6 mL / L / h) to maintain DO at 10%-20%. Samples were taken every 12 hours to detect expression levels and purity. Induction was continued for 72-96 hours to maximize protein secretion.

[0077] 5. Collection and purification of expression products

[0078] The fermentation broth was centrifuged at 3000 g at room temperature, and the supernatant was collected. The supernatant was then diluted with purified water until the final solution conductivity was <5 mS / cm.

[0079] Cation exchange resin (Borglon, Diamond SP Mustang, catalog number AI0192) was used for separation and purification by chromatography.

[0080] (1) Equilibration: 10mM PBS, pH 7.0 ± 0.1; wash with 3 column volumes and drain waste liquid;

[0081] (2) Sample loading: After centrifugation, collect the supernatant of the fermentation broth and add it to the chromatography column, where it flows through the column resin by gravity;

[0082] (3) Washing: 10 mM PBS, pH 7.0 ± 0.1; wash with 5 column volumes;

[0083] (4) Elution: 10mM PBS, 0.5M NaCl, pH 7.0 ± 0.1; use 3 column volumes for elution;

[0084] (5) CIP cleaning: 500mM NaOH; flush with 5 column volumes.

[0085] 6. Protein identification and analysis

[0086] The eluent containing synthetic human type XVII collagen C17A1T01 was collected and subjected to SDS-PAGE. The results are as follows: Figure 4 As shown: The purified synthetic human type XVII collagen was a monomer with an apparent molecular weight of 28 kDa. The purification recovery rate reached 95%, and the purity reached 98%.

[0087] Example 2

[0088] This embodiment prepares a synthetic type XVII humanized collagen lyophilized powder:

[0089] The recombinant collagen C17A1T01 prepared according to this invention was used to prepare a synthetic type XVII humanized collagen lyophilized powder. The synthetic type XVII humanized collagen has a content of 10-15 mg / bottle; the remaining components, by mass percentage, include: mannitol 1%-2%; trehalose 0.5%-1%; polysorbate 80 0.01%-1%; and oligopeptide-1 0.001%-1%.

[0090] raw material:

[0091] 2-1. Synthetic XVII type humanized collagen, content 10mg / bottle; other ingredients by mass percentage include: mannitol 1%; trehalose 1%; polysorbate 80 0.01%; oligopeptide-1 1%.

[0092] 2-2. Synthetic XVII type humanized collagen, content 15mg / bottle; other ingredients by mass percentage include: mannitol 2%; trehalose 0.5%; polysorbate 80 1%; oligopeptide-1 0.001%.

[0093] 2-3. Synthetic XVII type humanized collagen, content 12mg / bottle; other ingredients by mass percentage include: mannitol 1.5%; trehalose 0.8%; polysorbate 80 0.5%; oligopeptide-1 0.5%.

[0094] The preparation method is as follows:

[0095] (1) Accurately weigh the synthetic XVII humanized collagen solution containing collagen.

[0096] (2) Accurately weigh mannitol, trehalose, and polysorbate 80, and add them to the collagen solution in sequence, stirring to dissolve.

[0097] (3) Before freeze-drying, accurately weigh oligopeptide-1, slowly add it to the collagen solution, and mix gently.

[0098] (4) Filter through a 0.22µm PES membrane into sterile vials. Freeze dry using a freeze dryer.

[0099] Instructions for use: Add sterile water to the lyophilized powder bottle, shake gently until completely dissolved, and pat onto the face with a sterile medical brush or fingertips.

[0100] Example 3

[0101] This embodiment provides a solution for synthesizing type XVII humanized collagen:

[0102] The recombinant collagen C17A1T01 prepared according to this invention was used to prepare a synthetic type XVII humanized collagen solution. The solution contained 5-20 mg / mL of synthetic type XVII humanized collagen, and the remaining components, by mass percentage, included: sodium hyaluronate 1%-5%; glycerol 1%-3%; and phosphate buffer 0.01%-0.1%.

[0103] raw material:

[0104] 3-1. Synthesize type XVII humanized collagen 5 mg / mL, the remaining components by mass percentage include: sodium hyaluronate 5%; glycerol 1%; phosphate buffer 0.01%.

[0105] 3-2. Synthesize type XVII humanized collagen 20 mg / mL, the remaining components by mass percentage include: sodium hyaluronate 1%; glycerol 3%; phosphate buffer 0.1%.

[0106] 3-3. Synthesize type XVII humanized collagen 10 mg / mL, the remaining components by mass percentage include: sodium hyaluronate 3%; glycerol 2%; phosphate buffer 0.05%.

[0107] The preparation method is as follows:

[0108] (1) Accurately weigh the synthetic XVII type humanized collagen.

[0109] (2) Accurately weigh sodium hyaluronate and slowly add it to water for injection, stirring to dissolve.

[0110] (3) Mix collagen solution and sodium hyaluronate in proportion, and add glycerol and phosphate buffer in sequence.

[0111] (4) Fill into a 3mL sterile glass syringe and sterilize by irradiation.

[0112] How to use: After cleansing, inject evenly into designated areas.

[0113] Example 4

[0114] This embodiment prepares a synthetic XVII type humanized collagen absorbable suture:

[0115] The recombinant collagen C17A1T01 prepared according to this invention was used to prepare synthetic type XVII humanized collagen absorbable sutures. The sutures contain 10-20 mg / cm of synthetic type XVII humanized collagen and 10%-20% polycaprolactone.

[0116] The preparation method is as follows:

[0117] (1) Accurately weigh the synthetic XVII type humanized collagen and polycaprolactone, and stir to mix well.

[0118] (2) Extruded through a 0.1mm-0.5mm spinneret and dried and shaped.

[0119] (3) Add to a crosslinking solution of 0.1M EDC + 0.05M NHS and soak for 4-6 hours. Rinse with purified water.

[0120] (4) The needle and thread are assembled by laser welding. The needle and thread are then placed in aluminum foil bags and sterilized by irradiation.

[0121] Application: For delicate suturing in plastic surgery, ophthalmology, and other procedures.

[0122] Example 5

[0123] This embodiment prepares a synthetic type XVII humanized collagen compound gel dressing:

[0124] It is divided into two parts, A and B. Part A is sterile freeze-dried and contains 2-8 mg of the synthetic type XVII humanized collagen. Part B consists of the following components by mass percentage: sodium hyaluronate 0.05%-0.5%, carbomer 0.1%-2%, propylene glycol 0.5%-5%, glycerin 0.5%-5%, methylparaben 0.03%-0.1%, propylparaben 0.02%-0.05%, and the remainder is purified water. When using, mix parts A and B thoroughly.

[0125] The raw materials are as follows:

[0126] 5-1. Synthesize type XVII humanized collagen with the following composition: 2 mg sodium hyaluronate, 0.5% carbomer, 0.1% propylene glycol, 0.5% glycerin, 0.03% methylparaben, 0.02% propylparaben, and the remainder being purified water.

[0127] 5-2. Synthesize type XVII humanized collagen with the following composition: 8 mg, sodium hyaluronate 0.05%, carbomer 2%, propylene glycol 5%, glycerin 5%, methylparaben 0.1%, propylparaben 0.05%, and the remainder being purified water.

[0128] 5-3. Synthesize type XVII humanized collagen with the following composition: 4 mg, sodium hyaluronate 0.2%, carbomer 1%, propylene glycol 2%, glycerin 2%, methylparaben 0.08%, propylparaben 0.05%, and the remainder being purified water.

[0129] The preparation method is as follows:

[0130] (1) Accurately weigh carbomer, sodium hyaluronate, glycerin, propylene glycol, methylparaben and propylparaben, stir for 1 hour, add purified water and dissolve completely.

[0131] (2) Accurately weigh the freeze-dried synthetic type XVII humanized collagen microfibers.

[0132] (3) Filling under aseptic conditions, sealing and packaging, and irradiation sterilization result in the XVII type humanized collagen compound gel dressing product.

[0133] Instructions for use: Bottles A and B can be aseptically and quickly mixed before use.

[0134] Comparative Example 1

[0135] Except for methanol induction culture, where methanol was added at a constant rate of 5 mL / L / h, this comparative example was completely consistent with Example 1.

[0136] Comparative Example 2

[0137] The XVII type humanized collagen liquid was prepared by the method in Example 1 of Chinese Patent CN117866077A. The obtained XVII type humanized collagen replaced the collagen in Examples 5-3, and the other components and preparation methods were the same as in Examples 5-3, resulting in an XVII type humanized collagen compound gel dressing product.

[0138] Experimental Example 1

[0139] This experiment analyzes the stability of the humanized collagen C17A1T01 of type XVII synthesized in Example 1:

[0140] In this embodiment, the recombinant humanized type XVII collagen prepared in Example 1 was freeze-dried in a C17A1T01 vial, then dissolved in ultrapure water to prepare a protein solution of 5 mg / mL. The solution was stored in an incubator at 57°C. Sample conditions were observed on days 0, 1, 3, 5, and 7, and a portion of the sample was removed for SDS-PAGE electrophoresis to detect the stability of the recombinant protein in C17A1T01. The results are as follows: Figure 5 This indicates that the protein has good stability at 57°C.

[0141] Experiment Example 2

[0142] UV protein quantification formula: C (g / L) = 0.144 * (A215 - A225), A215 < 1.5. This formula is used to calculate protein expression levels during methanol induction.

[0143] Table 1

[0144]

[0145] Experimental Example 3

[0146] This experimental example demonstrates the circular dichroism (CD) of the synthesized type XVII humanized collagen C17A1T01 from Example 1:

[0147] The structural characterization of collagen in this invention employs circular dichroism (CD) chromatography, a method commonly used in the field. The CD characteristic of the triple helix structure of collagen generally exhibits a positive absorption peak near 223 nm and a negative absorption peak near 195 nm; the positions of these absorption peaks shift with changes in amino acid sequence and length. The synthetic type XVII humanized collagen solution prepared in Example 1 was subjected to CD detection. The results are as follows... Figure 6 As shown, the maximum characteristic positive peak is at approximately 223 nm, and a negative peak appears at less than 200 nm (198 nm), verifying that the recombinant collagen of the present invention has a triple helix structure.

[0148] Experiment Example 4

[0149] This experimental example analyzes the bioactivity of the synthesized XVII type humanized collagen C17A1T01 from Example 1:

[0150] The bioactivity analysis method of collagen in this embodiment is referenced in (Chen Huijuan, Liu Lingrong, Wang Jingjie, et al. Effect of collagen mimic peptides on L929 cell adhesion [J]. Functional Materials, 2012, 43(10): 1352-1356.).

[0151] 1. The specific implementation method of the cell proliferation experiment is as follows:

[0152] Synthetic type XVII humanized collagen solution and BSA solution of the same concentration were prepared as experimental group. PBS solution was added to the control group. Then, 100 μL of solution was added to each well of a 96-well plate. Each sample was coated to prepare 3 wells. The plates were incubated in a 5% CO2 incubator at 37°C for 2 h. The excess coating solution was removed and the 96-well plates were refrigerated at 2-8°C overnight.

[0153] L929 cells were digested and counted. The suspension was diluted with growth medium and seeded into 96-well plates at a density of 2000 cells / well (100 μL per well). The seeding time was recorded as 0 h. The cells were incubated at 37°C for 11 h in a 5% CO2 incubator. After incubation, 10 µL of CCK-8 solution was added to each well, and the cells were incubated again at 37°C for 1 h. The absorbance was then measured at 450 nm.

[0154] 2. The specific implementation method of the cell adhesion experiment is as follows:

[0155] Coating: Prepare synthetic human type XVII collagen solution and BSA solution of the same concentration as the experimental group. Add PBS solution to the control group. Add 100 μL of solution to each well of a 96-well plate. Coat 3 wells for each sample. Incubate at 37°C for 2 h in a 5% CO2 incubator.

[0156] Washing: Remove excess coating solution from the wells and wash twice with PBS solution.

[0157] Cell counting: Cells were resuspended in culture medium and counted. The cell count was diluted to a final concentration of 2 × 10⁻⁶. 5 per mL.

[0158] Assay: The cell suspension was aspirated and added to each well of a 96-well plate, 100 μL per well. After incubation at 37°C for 4 h in a 5% CO2 incubator, the culture medium was discarded. The cells were gently washed three times with PBS to remove any unadhered cells. Fresh culture medium was then added and cultured for 2 h. After incubation, 10 µL of CCK-8 solution was added to each well, and the plate was incubated for another 1 h. The absorbance was then measured at 450 nm.

[0159] Observation of cell adhesion quantity and morphology: (1) Under a 100x light microscope, the quantity and morphology of L929 cells when they were first seeded into the well plates of the three samples were observed and compared. (2) After incubation for 4 h, under the same magnification conditions, the changes in cell morphology and the number of adherent cells at different times were observed and compared.

[0160] 3. The specific implementation method of the cell migration experiment is as follows:

[0161] Coating: Prepare synthetic human type XVII collagen solution and BSA solution of the same concentration as the experimental group. Add PBS solution to the control group. Add 1.5 mL of solution to each well of a marked 6-well plate. Coat two wells for each sample. Incubate at 37°C for 2 h in a 5% CO2 incubator.

[0162] Washing: Remove excess coating solution from the wells and wash twice with PBS solution.

[0163] Cell counting: Cells were resuspended in culture medium and counted. The cell count was diluted to a final concentration of 3 × 10⁻⁶. 5 per mL.

[0164] Detection: Aspirate the above cell suspension and add 1 mL to each well of a 6-well plate. Incubate at 37°C for 20-24 hours in a 5% CO2 incubator until 95%-100% confluence is achieved. Using a 1 mL pipette tip, mark the horizontal lines vertically and gently push downwards to create a scratch (approximately 1.0-1.5 mm wide). Gently wash twice with PBS to remove the scratched cells, then add 2 mL of fresh culture medium and incubate at 37°C in a 5% CO2 incubator. Observe the healing of the cell scratches under a microscope at 0 h and 16 h, using the intersection of the horizontal and vertical scratches as the core, and photograph the cells under a 40x microscope for analysis.

[0165] Experimental results are as follows Figure 7 The results showed that C17A1T01 collagen promoted cell proliferation, cell adhesion, and cell migration. Compared with BSA, it increased cell proliferation by 3.81 times, cell adhesion by 3.88 times, and cell migration by 3.03 times.

[0166] Experimental Example 5

[0167] An evaluation experiment was conducted on the healing of diabetic wounds using the products from Examples 5-3:

[0168] One hundred healthy SPF-grade SD rats, weighing between 230-250g, were used. They were acclimatized for one week before the experiment, housed at a temperature of 20±3℃ and a relative humidity of 55±10%, with free access to food and water. Before modeling, each rat was fasted for 12 hours and injected with 1% STZ solution (prepared with citrate buffer) at a dose of 50mg / kg. Food and water intake was no longer restricted 30 minutes after injection. Blood glucose was measured from the tail vein 72 hours after injection. A blood glucose level ≥16.7mM indicated successful modeling; rats that did not successfully model were excluded from the experiment. A total of 60 rats were successfully modeled and randomly divided into three groups of 20 each: Example 5-3 groups, Comparative Example 2 groups, and a control group.

[0169] A 2cm diameter circle was cut on the back of a rat to obtain a skin lesion. The collagen compound gel dressings obtained in Examples 5-3 and Comparative Example 2 were applied to the skin lesion twice daily for four weeks. The control group was treated with a phosphate buffer solution at pH 7.0. The diameter of the skin lesion was measured to confirm the wound healing effect.

[0170] The results are as follows Figure 8 As shown, by Figure 8 It can be seen that the collagen compound gel dressing prepared in Examples 5-3 of this invention has a good effect on promoting the healing of diabetic wounds, with a wound healing rate of 98% after 28 days. Compared with the control group, the gel in Comparative Example 2 was slightly more effective than the blank control, but less effective than that in Examples 5-3. Therefore, although other human-derived type XVII collagen may have some effect on promoting tissue damage repair, its effect on diabetic wound repair is not good.

[0171] Experimental Example 6

[0172] An evaluation experiment was conducted on the efficacy of the product from Examples 5-3 on diabetic foot:

[0173] 1. Model Establishment

[0174] Based on the literature, an animal model of diabetic foot ulcer was established. The method is briefly described as follows: Wistar rats were selected and induced to develop diabetes by streptozotocin. Starting in the second week of modeling, the rats swam for 15 minutes daily and were placed on ice for 30 minutes. After one week, the rats' hind limbs became cold and purplish-dark. At the end of the second week, both hind limbs were frozen three times with liquid nitrogen swabs, 20 seconds each time, and the skin was allowed to rewarm before the next freezing. Following liquid nitrogen swab freezing, local congestion and edema appeared on the hind limbs. On the second day after freezing, the area of ​​congestion and edema expanded; on the third day, the edema became more localized, and the skin color turned dark red; by the fifth day, blood scabs had basically formed. By the end of the third week, the blood scabs on the affected limbs had fallen off, forming ulcer models of varying sizes and depths.

[0175] 2. Evaluation of therapeutic effects in experimental animals

[0176] According to the design in Table 2, diabetic foot ulcer model animals were randomly divided into groups of 10 animals each. The collagen compound gel dressings of Examples 5-3 and Comparative Example 2 and a phosphate buffer solution with pH=7.0 were applied to the diabetic foot ulcer surface. The medication was administered once a day. On day 28, the repair of diabetic foot ulcers was observed. The animals were then sacrificed, and samples were taken for pathological analysis. A double-blind method was used, and the same professional physician evaluated the degree of microvascular occlusion, inflammatory exudation, induration formation, wound healing speed, and scarring after healing. A comprehensive effect score was given, expressed on a percentage scale. The higher the score, the better the therapeutic effect of the collagen compound gel dressing on diabetic foot ulcers.

[0177] Table 2

[0178]

[0179] Table 2 shows that the collagen compound gel dressings of Examples 5-3 have a good therapeutic effect on diabetic foot, achieving a healing rate of 98%. Microvascular occlusion, inflammatory exudation, and induration are eliminated, wounds heal quickly, and there are almost no scars after healing, demonstrating excellent therapeutic efficacy. In contrast, the human-derived type XVII collagen obtained using other amino acid sequences showed a poorer therapeutic effect on diabetic foot, only slightly better than the control group, and the therapeutic effect did not meet expectations.

[0180] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. A synthetic humanized collagen of type XVII, characterized in that, The amino acid sequence of the synthetic humanized collagen type XVII is shown as SEQ ID NO.

1.

2. A gene encoding a synthetic humanized collagen of type XVII, characterized in that, The gene is used for encoding the humanized collagen type XVII according to claim 1, and the nucleotide sequence of the gene is shown as SEQ ID NO.

2.

3. A recombinant vector expressing a synthetic humanized collagen type XVII, characterized in that, The recombinant vector comprises the gene according to claim 2.

4. A recombinant strain expressing a synthetic humanized collagen type XVII, characterized in that, The recombinant strain comprises a host cell and the recombinant vector according to claim 3 introduced into the host cell.

5. The recombinant strain expressing synthetic humanized collagen type XVII according to claim 4, characterized in that, The recombinant strain is classified as Komagataella pastoris, and the strain number is KP0003, and the preservation number is GDMCC No: 66336.

6. A method for producing a synthetic humanized collagen of type XVII, characterized in that The method comprises: Step one, synthesis of a gene A codon-optimized nucleotide sequence is synthesized, and the nucleotide sequence is shown as SEQ ID NO. 2; Step two, synthesis and construction of an expression plasmid The synthetic gene is cloned into the corresponding site of the Pichia pastoris expression vector pPIC9K through EcoR I and Not I enzyme cutting sites to obtain an initial recombinant plasmid pPIC9K-C17A1-9, and the plasmid comprises an alpha secretion factor; Step three, modification of the recombinant plasmid The coding sequence of the C-terminal 4 amino acids YVEF of the alpha secretion factor of the initial recombinant plasmid pPIC9K-C17A1-9 is deleted to obtain pPIC9K-C17A1T01; Step four, transformation and culture The recombinant plasmid pPIC9K-C17A1T01 is transformed into Pichia pastoris host cells, and an engineering strain is screened, and the engineering bacteria are fermented and cultured, and the expression of the target protein is induced under appropriate conditions; Step five, harvesting and purification The fermentation broth is collected, the expressed protein product is harvested, cation exchange is used for high-efficiency purification, and high-purity target collagen protein is obtained.

7. The method for preparing synthetic type XVII humanized collagen according to claim 6, characterized in that, In step four, the fermentation culture comprises a pre-culture and a culture in the induction expression stage.

Images