A SNP marker affecting porcine UMP content and its application

Abstract

This invention relates to the fields of molecular markers and animal genetic breeding technology, and particularly to a SNP marker affecting UMP content in pigs and its application. Using whole-genome resequencing and GWAS analysis, this invention studied purebred Landrace, Large White, and Duroc pigs as research subjects, identifying seven SNP markers associated with UMP content in pigs. By optimizing the dominant alleles of these SNPs, the frequency of dominant alleles can be increased generation by generation, thereby increasing UMP content, accelerating the progress of pig genetic improvement, and effectively improving the economic benefits of pig breeding.

Description

Technical Field

[0001] This invention relates to the fields of molecular markers and animal genetic breeding technology, and in particular to an SNP marker that affects UMP content in pigs and its application. Background Technology

[0002] UMP (uridine monophosphate) is a fundamental substance in pyrimidine metabolism and a core node in various metabolic pathways, including the synthesis of RNA, cell membrane components (such as phosphatidylcholine), and glycosylation intermediates. It participates in muscle cell growth, repair, and energy metabolism, indirectly influencing muscle development and meat quality improvement. As a core substance in pyrimidine metabolism, UMP is closely related to multiple metabolic processes. Its synthesis involves the catalysis of several important enzymes and can be converted into other important nucleotides, such as UDP and UTP, which then participate in various biosynthetic processes. UDP, a metabolite of UMP, is an activated carrier of monosaccharides, participating in the biosynthesis of monosaccharides, disaccharides, and polysaccharides. This indicates that UMP plays a crucial role in maintaining cellular energy metabolism and structural integrity. Furthermore, UMP may have a synergistic flavor-enhancing effect with glutamate-like substances, and in some models, it has been found to weaken bitterness or enhance sweetness. Although UMP itself has a relatively weak umami flavor, its higher content may reflect more active muscle cell metabolism and good tissue physiological state, making it suitable as an auxiliary indicator in breeding strategies that focus on muscle development, healthy metabolism, and potential flavor structure optimization.

[0003] Therefore, identifying marker sites affecting UMP levels and improving breeding populations is of great significance to the production and economic benefits of pig farming. Genome-wide association analysis (GWAS) provides strong technical support for achieving this goal. GWAS can scan marker sites related to UMP levels across the entire genome, precisely locating key gene regions affecting UMP synthesis, metabolism, and regulation. This allows breeders to directly select at the gene level, avoiding errors caused by environmental interference and other factors in traditional breeding, thus improving the accuracy and efficiency of selection. Key marker sites screened through GWAS can be used to construct efficient marker-assisted selection (MAS) systems. In actual breeding processes, by detecting the genotype of the corresponding marker sites in target individuals, individuals carrying favorable alleles can be quickly screened.

[0004] Furthermore, GWAS can be used not only for selecting the specific trait of UMP content, but also to simultaneously analyze other traits related to production performance, meat quality, and health. This multi-trait integrated breeding method can better balance the relationship between different breeding objectives, optimize the process of pig genetic improvement, and achieve the sustainable development of the pig farming industry. Summary of the Invention

[0005] In order to overcome the shortcomings and disadvantages of the prior art, the primary objective of this invention is to provide an SNP marker that affects the UMP content in pigs.

[0006] Another object of the present invention is to provide the application of the above-mentioned SNP marker.

[0007] The objective of this invention is achieved through the following technical solution:

[0008] A SNP marker affecting porcine UMP content, comprising at least one of the following SNP markers:

[0009] (I) The SNP site corresponds to the T>C mutation at position 49824761 on chromosome 15 in International Pig Genome Version 11.1;

[0010] (II) The SNP site corresponds to the G>C mutation at position 64738361 on chromosome 5 in International Pig Genome Version 11.1;

[0011] (III) The SNP site corresponds to the A>G mutation at position 7847557 on chromosome 2 in International Pig Genome Version 11.1;

[0012] (IV) The SNP site corresponds to the T>C mutation at position 7800167 on chromosome 2 in International Pig Genome Version 11.1;

[0013] (V) The SNP site corresponds to the T>C mutation at position 7820968 on chromosome 2 in International Pig Genome Version 11.1;

[0014] (VI) The SNP site corresponds to the T>C mutation at position 80754161 on chromosome 7 in International Pig Genome Version 11.1;

[0015] (VII) The SNP site corresponds to the A>G mutation at position 80919433 on chromosome 7 in the International Pig Genome Version 11.1.

[0016] For (I), the SNP-labeled nucleic acid sequence is preferably as shown in SEQ ID NO:1, where M in the sequence is C or T, and the SNP site is a single base mutation of C232-T232 at position 232 of the sequence labeled in SEQ ID NO:1.

[0017] For (III), the sequence of the SNP-labeled nucleic acid is preferably as shown in SEQ ID NO:2, wherein M in the sequence is A or G, and its SNP site is a single base mutation of nucleic acid A85-G85 at position 85 of the sequence marked in SEQ ID NO:2.

[0018] In the specific implementation plan:

[0019] For (I), the pigs are of American Duroc breed or their synthetic line.

[0020] For (II), the pigs are of American Landrace breed or their synthetic line.

[0021] For (Ⅲ)-(Ⅴ), the pigs are of American Large White breed or their synthetic line.

[0022] For (VI)-(VII), the source of the pig is American Landrace, American Large White, or American Duroc or their synthetic lines.

[0023] A primer combination for detecting the above-mentioned SNP markers, comprising at least one of primer pairs primer-F1 and primer-R1, and primer pairs primer-F2 and primer-R2, the nucleotide sequences of which are shown in SEQ ID NO:3-6;

[0024] A kit for detecting the above-mentioned SNP markers, comprising the above-mentioned primer combination.

[0025] The application of the SNP markers, primer combinations, or kits in identifying UMP content or meat quality-related traits in pigs or pork, screening pig breeds with high UMP content or excellent meat quality, or in breeding pigs for UMP content or meat quality-related traits.

[0026] A method for genetic improvement of pigs, comprising the following steps:

[0027] Identify the aforementioned SNP markers of breeding pigs in the core breeding pig herd, and make corresponding selections based on the SNP markers:

[0028] For (I), select breeding pig individuals with the T / T or T / C genotype at position 49824761 on chromosome 15 of the International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the C / C genotype, so as to increase the frequency of the T allele at this locus generation by generation.

[0029] For (II), select breeding pig individuals with the C / C or C / G genotype at position 64738361 on chromosome 5 of the International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the G / G genotype, so as to increase the frequency of allele C at this locus generation by generation.

[0030] For (III), select breeding pig individuals with the G / G or G / A genotype at position 7847557 on chromosome 2 of the International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the A / A genotype, so as to increase the frequency of the G allele at this locus generation by generation.

[0031] For (Ⅳ), select breeding pig individuals with the C / C or C / T genotype at position 7800167 on chromosome 2 of the International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the T / T genotype, so as to increase the frequency of allele C at this locus generation by generation.

[0032] For (V), select breeding pig individuals with the C / C or C / T genotype at position 7820968 on chromosome 2 of International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the T / T genotype, so as to increase the frequency of allele C at this locus generation by generation.

[0033] For (VI), select breeding pig individuals with the T / T or C / T genotype at position 80754161 on chromosome 7 of the International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the C / C genotype to increase the frequency of the T allele at this locus generation by generation.

[0034] For (VII), select breeding pig individuals with the A / A or G / A genotype at position 80919433 on chromosome 7 of the International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the G / G genotype, so as to increase the frequency of allele A at this locus generation by generation.

[0035] A method for identifying UMP content or meat quality-related traits in pigs, comprising the following steps:

[0036] The above-mentioned SNP markers in pigs were identified, and the UMP content or meat quality-related traits in pigs were determined based on the SNP sites of the SNP markers, wherein:

[0037] For (I), the UMP content of the pigs from high to low or the meat quality traits from excellent to poor are ordered by the genotype at position 49824761 on chromosome 15 of the International Pig Genome Version 11.1, in the following order: T / T genotype, T / C genotype and C / C genotype.

[0038] For (II), the UMP content of the pigs from high to low or the meat quality traits from excellent to poor are sorted by the genotype at position 64738361 on chromosome 5 of the International Pig Genome Version 11.1, in the following order: C / C genotype, C / G genotype and G / G genotype.

[0039] For (III), the UMP content of the pigs from high to low or the meat quality traits from excellent to poor are sorted by the genotype at position 7847557 on chromosome 2 of the International Pig Genome Version 11.1, in the following order: G / G genotype, G / A genotype and A / A genotype.

[0040] For (Ⅳ), the UMP content of the pigs from high to low or the meat quality traits from excellent to poor are ordered by the genotype at position 7800167 on chromosome 2 of the International Pig Genome Version 11.1, in the following order: C / C genotype, C / T genotype and T / T genotype.

[0041] For (V), the UMP content of the pigs from high to low or the meat quality traits from excellent to poor are ordered by the genotype at position 7820968 on chromosome 2 of the International Pig Genome Version 11.1, in the following order: C / C genotype, C / T genotype and T / T genotype.

[0042] For (VI), the UMP content of the pigs from high to low or the meat quality traits from excellent to poor are ordered by the genotype at position 80754161 on chromosome 7 of the International Pig Genome Version 11.1, in the following order: T / T genotype, C / T genotype and C / C genotype.

[0043] For (VII), the UMP content of the pigs, from high to low or the meat quality traits, from excellent to poor, are ordered by the genotype at position 80919433 on chromosome 7 of the International Pig Genome Version 11.1, in the following order: A / A genotype, G / A genotype, and G / G genotype.

[0044] The application of the aforementioned SNP markers, primer combinations, or kits in the fields of gene editing or transgenics;

[0045] A method for establishing new pig breeds and / or new pig varieties that increase UMP content or improve pork quality-related traits includes the following steps:

[0046] The above-mentioned SNP markers in pigs were identified, and the following mutations were performed based on the SNP markers:

[0047] For (I), pigs with the SNP marker having the genotype C / C or T / C, the C / C or T / C genotype is mutated to the T / T genotype through site-directed mutagenesis;

[0048] For (II), pigs with the SNP marker having the genotype G / G or C / G, the G / G or C / G mutant genotype is changed to the C / C genotype by site-directed mutation.

[0049] For (III), pigs with the SNP marker having the genotype A / A or G / A, the A / A or G / A mutant genotype is changed to the G / G genotype by site-directed mutation.

[0050] For (Ⅳ), pigs with the SNP marker having the genotype T / T or C / T, the T / T or C / T mutant genotype is changed to the C / C genotype through site-directed mutagenesis;

[0051] For (V), pigs with the SNP marker having the genotype T / T or C / T can have their T / T or C / T genotype mutated to C / C genotype through site-directed mutagenesis.

[0052] For (VI), pigs with the SNP marker having the genotype C / C or C / T are mutated to the T / T genotype through site-directed mutagenesis.

[0053] For (VII), pigs with the SNP marker having the genotype G / G or G / A are mutated to the A / A genotype through site-directed mutagenesis.

[0054] The mutation is performed using transgenic methods or gene editing methods.

[0055] The preferred method for mutation is to use the CRISPR / Cas9 gene editing method.

[0056] The present invention has the following advantages and effects compared with the prior art:

[0057] (1) This invention uses whole genome resequencing and GWAS analysis. It takes purebred American Landrace pigs, purebred American Large White pigs and purebred American Duroc pigs as research objects, and studies and identifies 7 SNP markers related to UMP content in pigs. At least one of the SNP markers in this invention can be used to detect relevant indicators in pigs, or at least one of these SNP markers can be used for genetic improvement.

[0058] (2) Based on the SNP markers that affect the UMP content of pigs, this invention establishes a set of efficient and accurate molecular marker-assisted breeding technology, including primers and kits for detecting the SNP markers, methods for identifying UMP content or meat quality-related traits in pigs, methods for genetic improvement of pigs, etc. When applied to the genetic improvement of UMP content or meat quality-related traits in pigs, the breeding process can be accelerated quickly and accurately selected for UMP content or meat quality-related traits in pigs.

[0059] (3) This invention uses molecular breeding to solve the problem of low UMP content. By selecting the superior alleles of the above-mentioned SNPs, the frequency of superior alleles can be increased generation by generation, UMP content can be increased, the progress of pig genetic improvement can be accelerated, and the economic benefits of breeding pigs can be effectively improved. Attached Figure Description

[0060] Figure 1 This is a Manhattan plot showing the GWAS analysis of UMP content traits on different chromosomes in different experimental populations. The X-axis represents the location of the molecular marker loci on the chromosome, and the Y-axis represents the -log[missing value]. 10 (P-value).

[0061] Figure 2 This is a violin plot showing the corresponding UMP content of genotypes at all loci in the corresponding populations. The X-axis represents the genotype of the SNP molecular marker locus, and the Y-axis represents the UMP content of the individual. Detailed Implementation

[0062] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0063] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise stated, the reagents, methods, and equipment used in this invention are conventional reagents, methods, and equipment in this technical field.

[0064] In the examples, the uridine monophosphate (UMP) (3387-36-8) standard for HPLC detection was purchased from Shanghai Anpu Experimental Technology Co., Ltd.

[0065] Example 1

[0066] 1. Laboratory animals

[0067] The pig population used in this invention consists of: 173 purebred American Landrace pigs, 166 purebred American Large White pigs, and 158 purebred American Duroc pigs.

[0068] All pigs were sourced from Jiangxi Yudu Jiada Livestock Co., Ltd. All pigs were slaughtered and tested at Jiangxi Nanchang Guohong Food Co., Ltd. after reaching 200 days of age, in the slaughterhouse's cutting workshop. After slaughter and bleeding, the hair, internal organs, head, tail, and limbs (below the wrists and joints) were removed, and the skin was removed to obtain a carcass. Sampling was completed within 30 minutes of slaughter to minimize the impact of post-mortem metabolism on the content of nucleotides and their metabolites. The longissimus dorsi muscle was precisely separated from the left side of the pig carcass between the first and second lumbar vertebrae, and visible connective tissue and fascia were removed. Approximately 2.0g of muscle tissue was taken, rapidly transferred to a 2mL cryovial, cut into small pieces, and flash-frozen in liquid nitrogen (-196℃), then stored in an ultra-low temperature freezer at -80℃ until the experiment.

[0069] 2. HPLC Quantitative Determination of UMP Content in Pork

[0070] (1) Extraction of UMP: Accurately weigh 0.4g (accurate to 0.001g) of muscle sample from the shredded longissimus dorsi muscle sample and place it in a 15mL polypropylene acid-resistant centrifuge tube.

[0071] (2) Acid hydrolysis extraction: Add 6 mL of 6% (w / w) perchloric acid solution pre-cooled to 4℃, and then homogenize it for 45 s with a handheld high-speed homogenizer (run for 10 s / pause for 5 s, cycle 3 times), and use an ice bath intermittently to prevent overheating.

[0072] (3) Centrifugation purification: Transfer the homogenate to a constant temperature water bath shaker (4℃) and shake at 200 rpm for 15 min to promote nucleotide release. Centrifuge at 4℃ and 5000 rpm for 10 min, collect the supernatant to a new tube, repeat the centrifugation twice, and combine the supernatants from the two centrifugations.

[0073] (4) Precise pH control for acid-base neutralization: The supernatant combined in step (3) is placed in an ice bath. 3 mol / L NaOH solution is added dropwise using a micropipette to adjust the pH to 6.5 ± 0.1 (real-time monitoring with a pH meter is used). This can minimize interference with ATPase activity. Ultrapure water is added to bring the volume to 10 mL. After vortexing and mixing, the mixture is allowed to stand for 10 min to promote ion balance.

[0074] (5) The content of UMP in the extract of the longissimus dorsi muscle of each individual pig was determined by high performance liquid chromatography (HPLC) (unit: mg / 100g). The HPLC analysis was performed on an ACQUITYUPLCH-ClassPLUS System (Waters). The chromatographic column was Waters BEH C18 (1.7 μm, 2.1× 100 mm), the mobile phase was 0.05 mol / L KH2PO4 buffer (pH 6.0)-methanol (95:5, v / v), the flow rate was 0.2 mL / min (isocratic elution), the column temperature was 30℃, the detection wavelength was 254 nm, the injection volume was 2 μL, and the external standard method was used for quantification.

[0075] Concentration data obtained from the HPLC system are converted from the original unit µg / mL to mg / 100g using the following formula:

[0076]

[0077] Where C represents the content of UMP in 100 grams of pork (mg / 100g), and C0 represents the concentration of UMP measured by HPLC (µg / mL).

[0078] This invention presents descriptive statistics on HPLC detection data of UMP in the longissimus dorsi muscle of three commercial pig breeds (Large White, Landrace, and Duroc). The sample size (N), mean, standard deviation (SD), minimum-maximum (Min-Max), and coefficient of variation (CV) were systematically calculated. The descriptive statistical results are shown in Table 1. The table shows that uridine monophosphate (UMP) decreases in a gradient among breeds: Large White > Landrace > Duroc. The coefficient of variation in Duroc is 68.9%, indicating a low detection level and suggesting higher volatility in its purine metabolism pathway regulation.

[0079] Table 1. Descriptive statistics of UMP content in three varieties (unit: mg / 100g)

[0080]

[0081] Example 2

[0082] 1. Acquisition, quality control, and genotyping of whole-genome resequencing data in pigs.

[0083] (1) DNA extraction: Ear tissue samples were collected from each individual in the three experimental pig groups in Example 1, and genomic DNA was extracted from each individual using the standard phenol-chloroform method. The extracted genomic DNA was dissolved in TE buffer. The quality of the extracted genomic DNA was detected using a Nanodrop-ND1000 spectrophotometer. The quality standard was met when the A260 / 280 ratio was around 1.8-2.0 and the A260 / 230 ratio was around 1.7-1.9.

[0084] (2) DNA sequencing: The concentration of DNA samples that meet the standards is diluted to 50 ng / μL. The whole genome resequencing (paired-end 150 bp sequencing mode) is completed by the BGI T7 sequencing platform. The average sequencing depth of the sample reaches 30×, and the raw sequencing data in fastq format is obtained. Clean reads are obtained through fastp (v0.23.0) quality control for subsequent analysis.

[0085] (3) Sequence alignment: The raw sequencing data obtained in step (2) were aligned with the Sscrofa 11.1 (NCBI Suscrofa version 11.1) reference genome using BWA (v0.7.17) to obtain a sam format file.

[0086] (4) Variation detection: Use samtools (v1.10) to sort and convert the sam format file in step (3) into a bam format file, and then use Sambamba (v0.8.2) to remove PCR repeat sequences in the bam format file. Finally, use Graphtyper (v2.7.7) to perform genetic variation detection on all individual bam files to obtain population-level genotype data (vcf file).

[0087] (5) Variation Quality Control: The population-level genotype data obtained in step (4) was quality controlled using samtools. High-quality genotype sites were retained if they met the condition "FILTER="PASS"" and the variation detection quality value (GQ) > 20. Plink (v1.9) was further used to perform quality control on the population-level genotype data, excluding variant sites with a minor allele frequency (MAF) below 5% and samples with an individual genotype call rate below 80%. Finally, beagle (r1399) was used to autofill the genotypes to obtain high-quality genotype data.

[0088] After processing using the methods described above, 1,928,103, 1,964,653, and 1,513,322 mutation sites (including SNPs and Indels) were obtained in Dabai, Changbai, and Duroc, respectively.

[0089] 2. Genome-wide association study (GWAS) analysis and meta-analysis

[0090] (1) Genome-wide association analysis was performed on the phenotypic data after confounding correction using the Genome-wide Efficient Mixed Model Association algorithm (GEMMA v0.98.1). Specifically:

[0091] ① We used the lm() function in R language to process the phenotypes. We put gender and batch into the function to perform a simple linear regression, and the corrected residuals were used as the phenotypes for the final association analysis.

[0092] ② The analysis uses a univariate linear mixed model (ULMM) for statistical inference, and its mathematical expression is constructed as follows:

[0093]

[0094] Where y represents the n-dimensional vector of the phenotype (quantitative trait or binary vector) to be analyzed, which in this study is the content of UMP; W represents a matrix consisting of a column of "1"s (n×c dimensions); α is the vector of the effect and intercept of the corresponding covariate (c dimensions); x represents the vector of the genotype of the detection locus (n dimensions); β represents the vector of the magnitude of the effect of the detection locus; u indicates that the genotype follows a mean of 0 and a covariance-variance matrix of λτ. -1 The random effects vector (n-dimensional) of a K-multivariate normal distribution; ε indicates that it follows a mean of 0 and a covariance-variance matrix of τ. -1 The residual vector of In (n-dimensional). In two n-variable normal distributions, n represents the number of phenotypes, τ -1 Let represent the variance of the residuals, and λ represent the ratio of the variance of the random effects to the variance of the residuals; K represents the n×n kinship matrix, and In represents the n×n identity matrix; MVNn represents the n-dimensional multivariate normal distribution. To correct for multiple hypothesis testing, a genome-wide significance threshold of 0.05 / N (Bonferroni correction) is set, where N is the number of valid SNPs / Indels.

[0095] (2) Using the results of the above GWAS analysis, a meta-analysis of the UMP content in the three groups was performed in METAL software. The meta-analysis was based on the standard error weighting method (SCHEME STDERR).

[0096] Based on GWAS analysis ( Figure 1 The basic genetic parameters of the seven representative SNP loci obtained in this invention (including those obtained from meta-analysis) are shown in Table 2. The names of the representative SNP loci were obtained from the sus_scrofa.vcf.gz file downloaded from the NCBI database using bcftools software. If the website did not have the SNP name information for that locus, the SNP name was represented in the form of "chromosome_location". Other important genetic parameters for each representative locus were provided by GWAS analysis using GEMMA software, including the chromosome and location information of the locus, alleles, effect size, and p-value (Wald test).

[0097] Table 2. Basic genetic parameters of 7 representative SNP loci

[0098]

[0099] Note: The meta-analysis integrates genome-wide association study data from three pig breeds: Duroc, Landrace, and Large White.

[0100] 3. Analysis of differences in UMP content phenotypes among different genotypes

[0101] Genotypes at displayed molecular marker sites in each of the 497 pigs from three populations were extracted from sequencing files using Plink (v1.9). After counting the number of individuals with each genotype, the genotypes of these individuals were correlated with their corresponding UMP contents. Then, the `summarise` function from the `dplyr` package in R was used to statistically analyze the differences in phenotypic distribution among different genotypes. The results are shown in Table 3. Figure 2 As shown in the figure. The p-value is obtained from the variance test.

[0102] Table 3. Effects of each molecular marker site on UMP content (unit: mg / 100g)

[0103]

[0104] 4. Heritability analysis

[0105] Heritability is one of the most important fundamental genetic parameters in quantitative genetics, and it can be divided into broad-sense heritability, narrow-sense heritability, and realized heritability. In the breeding process, heritability generally refers to narrow-sense heritability (h0). 2 ), which refers to the proportion of the variance in quantitative trait breeding values ​​to the variance in phenotypic values, is the additive effect portion after eliminating dominant and epistatic effects, and is stably inherited during generational transmission. This invention estimates single-marker heritability based on the effect value (β) and its standard error (SE) of each locus in the GWAS results file from step 3 above, and takes their mean as the approximate narrow-sense heritability at the whole-genome level. The specific calculation formula is as follows:

[0106]

[0107] Where β is the regression coefficient of a single SNP site, and SE is its corresponding standard error.

[0108] Table 4 shows the results of the heritability estimation analysis of UMP content in the three populations, where the heritability distribution of UMP content in the three populations ranges from 0.354 to 0.361.

[0109] Table 4. Heritability estimation of UMP content in the three populations (h 2 )

[0110]

[0111] Example 3

[0112] This embodiment provides a method and process for detecting SNP markers in Embodiment 2, specifically taking SNP markers rs326811755 and rs327623943 as examples, whose corresponding breeds are Duroc and Large White pigs, respectively. The specific method is as follows:

[0113] 1. Primer design

[0114] (1) The target fragment containing SNP sites that are significantly associated with UMP content in Duroc pigs is a 512 bp nucleotide sequence from chromosome 15 (SEQ ID NO:1). The upstream and downstream primers for sequence amplification are primer-F1 and primer-R1, and their nucleic acid sequences are as follows:

[0115] Upstream primer-F1: 5'-GCAAGGGGGTCAGGTTATCC-3' (SEQ ID NO:3);

[0116] Downstream primer-R1: 5'-CACCCGCATGTTCATTGCAG-3' (SEQ ID NO:4).

[0117] (2) The target fragment containing SNP sites that are significantly associated with UMP content in American Large White pigs is a 238bp nucleotide sequence from chromosome 2 (SEQ ID NO:2). The upstream and downstream primers for sequence amplification are primer-F2 and primer-R2, and their nucleic acid sequences are as follows:

[0118] Upstream primer-F2: 5'-GCCGAGGAGAGAACAGGGAA-3' (SEQ ID NO:5);

[0119] Downstream primer primer-R2: 5'-TTCTATTTTTGCCCCCTGCCC-3' (SEQ ID NO:6).

[0120] 2. PCR amplification

[0121] Add 1 μL of the DNA template to be tested, 3.4 μL of double-distilled water, 5 μL of 2×Taq PCR StarMixwith Loading Dye, and 0.3 μL each of forward and reverse primers to a 10 μL reaction system. The PCR reaction conditions are as follows: 94℃ pre-denaturation for 5 min, followed by 94℃ denaturation for 30 s, 55-65℃ annealing for 30 s, and 72℃ extension for 45 s, for 35 cycles, and a final extension at 72℃ for 5 min.

[0122] 3. DNA sequencing

[0123] DNA sequence sequencing and identification: Performed at BGI Genomics Co., Ltd. in Shenzhen, the gene fragments were sequenced using both forward and reverse reactions. The obtained sequences were compared with the NCBI genome sequence to identify mutations at corresponding SNP sites.

[0124] SEQ ID NO:1(chr15:49824529-49825041):

[0125] GCAAGGGGGTCAGGTTATCCTTACATGTATACATTACAATTACAGTTTTTCCCCCACCCTTTCTTCTGTTGCAACATGAGTATCTAGACATAGTTCTCAATGCTATTCAGCAGGATCTCCTTGTCAATCTATTCTAAGTTGTGTCTGATAAGCCCAAGCTCCCGATCCCTCCCACTCCCTCCCCCTCCCATCAGGCAGGGACAAGTCTCTTCTCCAAGTCCATGATTTTCT M(C / T) TTCTGAGGAGATGTTCATTTGTGCTGGATATTAGATTCCAGTTATAAGTGATATCATATGGTATTTGTCTTTCTCTTTCTGGCTCATTTCACTCAGGATGAGAGTCTCTAGTTCCATCCATGTTGCTGCAAATGGCCTTATGTCATTCTTTTTTATGGCTGAGTAGTATTCCATTGTGTATATATACCACCTCTTCCGAATCCAATCCTCTGTCAATGGACATTTGGGTTGTTTCCATGTCCTGGCTATTGTGAATAGTGCTGCAATGAACATGCGGGTG

[0126] SEQ ID NO:2(chr2:7847472-7847710):

[0127] GCCGAGGAGAGAACAGGGAACGACTCCTCTCCGCCCACCCCGCCCCAGGCGCCCCTCACCTGGGCTGCTGAGGGAGGTGCTGGT M(G / A)

[0128] GGGGAGGTGGTGGGGCCCGGGGGCCGGCGGGGGAGGCGTCCAGGGGGCTGGGTGTGGGGTTTGGGGTCAGCTGGGATCCTGGCTGCTGAGACTGGGTCTCCTGGCTTGTCTCCGGGCCAGCCTGAGCCTGAAGGGCAGGGGGCAAAAATAGAA

[0129] Note: M marked in the sequence is the mutation site, indicated by an underline (the mutated base in parentheses represents the allele mutation). The primer binding position is indicated by bolding at the beginning and end of the sequence.

[0130] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. The use of a SNP locus affecting the UMP content of a pig in the identification of the UMP content of a pig or pork, or the genetic breeding of the UMP content of a pig, characterized in that, The SNP site comprises at least one of (I)-(V) as follows: (I) the SNP site corresponds to a T>C mutation at position 49824761 on chromosome 15 in the International Pig Genome 11.1 version; (II) the SNP site corresponds to a G>C mutation at position 64738361 on chromosome 5 in the International Pig Genome 11.1 version; (III) the SNP site corresponds to a A>G mutation at position 7847557 on chromosome 2 in the International Pig Genome 11.1 version; (IV) the SNP site corresponds to a T>C mutation at position 7800167 on chromosome 2 in the International Pig Genome 11.1 version; (V) the SNP site corresponds to a T>C mutation at position 7820968 on chromosome 2 in the International Pig Genome 11.1 version; For (I), the pig is a Duroc pig of American line; For (II), the pig is a Landrace pig of American line; For (III)-(V), the pig is a Large White pig of American line.

2. The use according to claim 1, characterized in that: For (I), the SNP site is M in the nucleotide sequence as shown in SEQ ID NO: 1, and the base is C or T; For (III), the SNP site is M in the nucleotide sequence as shown in SEQ ID NO: 2, and the base is A or G.

3. The use of a primer combination for detecting a SNP site affecting the UMP content of a pig in identifying the UMP content of a pig or pork, or the genetic breeding of the UMP content of a pig, characterized in that, The primer combination comprises at least one of primer pair primer-F1 and primer-R1, and primer pair primer-F2 and primer-R2, and the nucleotide sequences thereof are shown in SEQ ID NO: 3-6; The SNP site is the SNP site (I) or the SNP site (III) as described in claim 1 or 2.

4. Use of a kit for detecting SNP sites affecting UMP content in pigs in identifying UMP content in pigs or pork, or genetic breeding of UMP content in pigs, characterized in that, The kit comprises the primer combination as described in claim 3.

5. A method of genetic improvement of swine, characterized in that, Comprising the following steps: determining the genotype of the SNP site as described in claim 1 or 2 of the breeding pig in the breeding pig core group, and making a corresponding selection according to the genotype of the SNP site: For (I), selecting a breeding pig individual with T / T or T / C genotype at position 49824761 on chromosome 15 in the International Pig Genome 11.1 version from the breeding pig core group, and eliminating a breeding pig individual with C / C genotype, so as to increase the frequency of allele T at this site generation by generation; For (II), selecting a breeding pig individual with C / C or C / G genotype at position 64738361 on chromosome 5 in the International Pig Genome 11.1 version from the breeding pig core group, and eliminating a breeding pig individual with G / G genotype, so as to increase the frequency of allele C at this site generation by generation; For (III), selecting a breeding pig individual with G / G or G / A genotype at position 7847557 on chromosome 2 in the International Pig Genome 11.1 version from the breeding pig core group, and eliminating a breeding pig individual with A / A genotype, so as to increase the frequency of allele G at this site generation by generation; For (IV), selecting a breeding pig individual with C / C or C / T genotype at position 7800167 on chromosome 2 in the International Pig Genome 11.1 version from the breeding pig core group, and eliminating a breeding pig individual with T / T genotype, so as to increase the frequency of allele C at this site generation by generation; For (V), selecting the boar individual with C / C or C / T genotype at position 7820968 on chromosome 2 of the international pig genome version 11.1 from the boar core group, and eliminating the boar individual with T / T genotype to increase the frequency of allele C at the locus generation by generation; For (I), the boar individual is a Duroc pig of the American line; For (II), the boar individual is a Landrace pig of the American line; For (III)-(V), the boar individual is a Large White pig of the American line.

6. A method of identifying the UMP content of a pig, characterized in that, comprising the following steps: determining the genotype of the pig at the SNP locus as claimed in claim 1 or 2, and judging the UMP content of the pig according to the genotype of the SNP locus: For (I), the UMP content of the pig is ranked from high to low according to the genotype at position 49824761 on chromosome 15 of the international pig genome version 11.1, in the order of T / T genotype, T / C genotype and C / C genotype; For (II), the UMP content of the pig is ranked from high to low according to the genotype at position 64738361 on chromosome 5 of the international pig genome version 11.1, in the order of C / C genotype, C / G genotype and G / G genotype; For (III), the UMP content of the pig is ranked from high to low according to the genotype at position 7847557 on chromosome 2 of the international pig genome version 11.1, in the order of G / G genotype, G / A genotype and A / A genotype; For (IV), the UMP content of the pig is ranked from high to low according to the genotype at position 7800167 on chromosome 2 of the international pig genome version 11.1, in the order of C / C genotype, C / T genotype and T / T genotype; For (V), the UMP content of the pig is ranked from high to low according to the genotype at position 7820968 on chromosome 2 of the international pig genome version 11.1, in the order of C / C genotype, C / T genotype and T / T genotype; For (I), the pig is a Duroc pig of the American line; For (II), the pig is a Landrace pig of the American line; For (III)-(V), the pig is a Large White pig of the American line.

Images