Molecular marker associated with soybean oil content on chromosome 9 and application thereof

By developing a molecular marker for the SNP site Gm_Chr09_5332672 on soybean chromosome 9 and combining it with KASP technology, the problem of the difficulty in quickly selecting high-oil soybean lines using traditional breeding methods was solved, achieving efficient identification and breeding of soybean crude oil content.

CN120818633BActive Publication Date: 2025-12-16SHANDONG AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511339872.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-09-19
Publication Date
2025-12-16
Estimated Expiration
2045-09-19

AI Technical Summary

Technical Problem

Traditional breeding methods make it difficult to quickly and accurately select high-oil soybean lines. Existing molecular marker technologies lack stability and versatility in the application of soybean oil content, which affects breeding efficiency.

Method used

A molecular marker for the SNP site Gm_Chr09_5332672 on soybean chromosome 9 was developed. KASP labeling technology was used for quantitative real-time PCR detection. C/T base mutations were detected to determine the crude oil content of soybeans. Specific primer sets Gm_Chr09_5332672-F1, Gm_Chr09_5332672-F2, and Gm_Chr09_5332672-R were designed for high-throughput screening.

Benefits of technology

This method enables rapid and accurate identification of crude oil content in soybeans, improves breeding efficiency, simplifies marker-assisted selection, and reduces costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120818633B_ABST
    Figure CN120818633B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of biology, and discloses a molecular marker related to soybean crude oil content on chromosome 9 and application. The application measures the crude oil content of soybean grains, and through QTL positioning analysis, a stable and reliable molecular marker Gm_Chr09_5332672 closely linked to the crude oil content is obtained, the molecular marker is located at the 5332672th position on the 9th chromosome of the soybean reference genome Glycine max Wm82.a4.v1, a marker for KASP detection is developed based on the position, and a primer set for amplifying the KASP marker is designed. The application further provides a method for rapidly identifying the crude oil content of soybean by using the primer set of the molecular marker, the method is simple and fast, the identification result is accurate, and has a good popularization and application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a molecular marker located on chromosome 9 that is associated with the crude oil content of soybeans and its application. Background Technology

[0002] Soybean (Glycine max (L.) Merr.) is one of the world's most important oilseed crops. Its seeds are rich in protein and oil, making them an important source of nutrition for humans and animals. As a major source of vegetable oil, soybean oil dominates the edible oil market. The crude oil content of soybeans directly affects their economic value and breeding objectives; therefore, increasing oil content has always been an important direction for soybean genetic improvement. However, oil content is a typical quantitative trait, controlled by multiple genes and strongly influenced by environmental conditions such as temperature, light, and moisture. Traditional breeding methods are difficult to accurately and quickly select high-oil lines. Therefore, modern breeding techniques combined with molecular marker-assisted selection have become a crucial breakthrough in improving breeding efficiency.

[0003] In research on the genetic basis of soybean oil content, QTL (quantitative trait locus) mapping technology has played a crucial role. By constructing different types of populations (such as F2 populations, recombinant inbred line (RIL) populations, backcross populations, etc.) and using high-throughput molecular marker technology to map genetic information, important regions in the soybean genome that affect oil accumulation can be located. The discovery of these QTLs provides a theoretical basis for elucidating the genetic mechanisms related to oil synthesis and also provides direction for subsequent fine mapping and candidate gene discovery. Currently, studies have identified QTLs closely related to oil content on multiple chromosomes, and some regions have recurred under different genetic backgrounds and environments, showing strong stability and practical value.

[0004] To better apply QTL research findings to soybean breeding practices, developing stable, reliable, and versatile molecular markers is crucial. KASP (Kompetitive Allele-Specific PCR) marker technology is widely used in crop molecular breeding due to its advantages such as high throughput, low cost, and high specificity. KASP is a fluorescence detection technique based on allele-specific amplification, capable of rapidly and accurately genotyping target loci, suitable for rapid screening of large-scale samples. Combining KASP markers with QTL loci related to oil content enables efficient detection of target alleles, thereby assisting breeders in accurately selecting high-oil-content materials in early generations and significantly improving breeding efficiency.

[0005] Therefore, QTL mapping to identify key gene regions related to oil accumulation and developing KASP markers based on these regions not only helps to reveal the genetic mechanisms of soybean oil content but also provides reliable technical support for molecular breeding of high-oil varieties. This technical approach is expected to accelerate the improvement of soybean oil content and promote the breeding and promotion of new high-oil, high-yield, and high-quality soybean varieties. Summary of the Invention

[0006] One of the objectives of this invention is to provide a molecular marker related to the crude oil content of soybeans.

[0007] The second objective of this invention is to provide the application of the aforementioned molecular markers related to the crude oil content of soybeans.

[0008] To achieve the above objectives, the present invention adopts the following technical solution:

[0009] This invention discloses a molecular marker related to crude oil content in soybeans. The inventors measured the crude oil content of soybean seeds and, through QTL mapping analysis, located a linkage region in soybeans containing a SNP locus named Gm_Chr09_5332672. This locus is located at position 5332672 on chromosome 9 of the soybean reference genome Glycine max Wm82.a4.v1. This locus contains a C / T base mutation. The nucleotide sequence of this SNP locus is shown in SEQ ID NO.1. When the base at this locus is C (CC genotype, hereinafter referred to as 0 / 0 genotype), the crude oil content of the soybean material is low; when the base at this locus is T (TT genotype, hereinafter referred to as 1 / 1 genotype), the crude oil content of the soybean material is high. Population validation results show that the crude oil content of soybean material with genotype 1 / 1 is significantly higher than that of soybean material with genotype 0 / 0, with a highly significant difference.

[0010] Specifically, the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein a C / T base mutation exists at position 25 of the sequence shown in SEQ ID NO.1, and the sequence is as follows:

[0011] GGCTATTCCACACCTTTTGAAGTG C / TACAATGGATTTTATTATGTCACCATGGAAGGCATAAGTGTAGGGGAAAAAAGGCTTGACATAGCTCCAGAAACTTTTGAAATGAAAAAGAATAGAACAGGTGGAGTCATCATTGACACAGGAAGCACTATCACCTTCCTAGTTGATAGTG. (As shown in SEQ ID NO.1, the bold and underlined part represents the SNP site Chr09_5332672 (C / T)).

[0012] Based on this SNP site, a primer set for the KASP marker was designed to amplify a primer set for molecular markers associated with soybean crude oil content. The primer set sequences for the molecular markers are as follows:

[0013] Gm_Chr09_5332672-F1: GAAGGTGACCAAGTTCATGCTGGCTATTCCACACCTTTTGAAGTGC (shown in SEQ ID NO.2);

[0014] Gm_Chr09_5332672-F2: GAAGGTCGGAGTCAACGGATTGGCTATTCCACACCTTTTGAAGTGT (shown in SEQ ID NO.3);

[0015] Gm_Chr09_5332672-R: TATGCCTTCCATGGTGACATAATAAAATC (shown in SEQ ID NO.4).

[0016] Two forward primers are used to connect to different fluorescent adapter sequences; the 5' end of forward primer Gm_Chr09_5332672-F1 is connected to the FAM fluorescent adapter sequence, and the 5' end of forward primer Gm_Chr09_5332672-F2 is connected to the VIC fluorescent adapter sequence; the FAM and VIC fluorescent adapter sequences are as follows:

[0017] FAM: GAAGGTGACCAAGTTCATGCT (shown in SEQ ID NO.5);

[0018] VIC: GAAGGTCGGAGTCAACGGATT (shown in SEQ ID NO.6).

[0019] This invention also discloses the application of the aforementioned molecular marker primer set in marker-assisted breeding of soybean crude oil content. In other words, the molecular marker primer set of this invention can be used in future marker-assisted breeding to identify the crude oil content of soybean materials by extracting DNA from seedling leaves and detecting the presence of the molecular markers of this invention. The detection can be performed using quantitative real-time PCR, specifically using the aforementioned molecular marker primer set.

[0020] This invention also discloses the application of the aforementioned molecular marker primer set in identifying the crude oil content of soybeans. Specifically, the specific steps for identifying the crude oil content of soybeans are as follows:

[0021] (1) Using the DNA of the tested soybean germplasm as a template for real-time PCR amplification, real-time PCR amplification was performed using the primer set corresponding to the molecular marker Gm_Chr09_5332672. The reaction system for real-time PCR amplification is shown in Table 1:

[0022] Table 1. Reaction system for PCR amplification

[0023]

[0024] Pre-read fluorescence at 30℃ for 1 min, initial denaturation at 94℃ for 15 min; denaturation at 94℃ for 20 s, annealing and extension at 61℃ for 1 min, 10 cycles; denaturation at 94℃ for 20 s, annealing and extension at 55℃ for 1 min, 26 cycles; final fluorescence reading at 30℃ for 1 min.

[0025] Quantitative real-time PCR (qPCR) amplification was performed using primer sets Gm_Chr09_5332672-F1, Gm_Chr09_5332672-F2, and Gm_Chr09_5332672-R. If the PCR product only showed FAM fluorescence signal corresponding to primer Gm_Chr09_5332672-F1 with a fluorescent adapter sequence, the detection site indicated a genotype 0 / 0, classifying it as homozygous with a low crude oil content phenotype. If the PCR product only showed VIC fluorescence signal corresponding to primer Gm_Chr09_5332672-F2 with a fluorescent adapter sequence, the detection site indicated a genotype 1 / 1, classifying it as homozygous with a high crude oil content phenotype. If primers Gm_Chr09_5332672-F1 and Gm_Chr09_5332672-F2 with fluorescent adapter sequences were detected simultaneously, the genotype was classified as homozygous. The corresponding FAM and VIC fluorescence signals indicate that the detection site is a 0 / 1 genotype (corresponding to the CT genotype), which is determined to be a heterozygous type of the medium crude oil content phenotype.

[0026] In addition, this invention also protects a kit for identifying the crude oil content of soybeans, the kit containing primer sets Gm_Chr09_5332672-F1, Gm_Chr09_5332672-F2, and Gm_Chr09_5332672-R. Other components of the kit are conventional reagents. Specifically, it also includes 2×PCR Mix and ROX supplementation solution. This invention imposes specific restrictions on the concentration of the primer sets; a concentration of 10 μM can be used. This invention does not impose specific restrictions on the source of the 2×PCR Mix and ROX supplementation solution; reagents for real-time quantitative PCR amplification well-known in the art can be used.

[0027] The kit of this invention can be used to quickly identify the crude oil content of soybeans, and can also be used to quickly identify the crude oil content genotype of soybeans. The specific method refers to the steps for identifying the crude oil content of soybeans. Analysis of the results of quantitative real-time PCR amplification reveals the following: If the PCR product only detects the FAM fluorescence signal corresponding to primer Gm_Chr09_5332672-F1 with the fluorescent adapter sequence, the detection site is classified as genotype 0 / 0, indicating a homozygous type with a low crude oil content phenotype. If the PCR product only detects the VIC fluorescence signal corresponding to primer Gm_Chr09_5332672-F2 with the fluorescent adapter sequence, the detection site is classified as genotype 1 / 1, indicating a homozygous type with a high crude oil content phenotype. If both FAM and VIC fluorescence signals corresponding to primers Gm_Chr09_5332672-F1 and Gm_Chr09_5332672-F2 with the fluorescent adapter sequences are detected simultaneously, the detection site is classified as genotype 0 / 1, indicating a heterozygous type with a medium crude oil content phenotype.

[0028] The present invention has the following advantages:

[0029] (1) The inventors of this invention screened out a molecular marker Gm_Chr09_5332672 that is related to the crude oil content of soybeans. This molecular marker is located on chromosome 9. Using the molecular marker Gm_Chr09_5332672 of this invention, the crude oil content of soybeans can be quickly identified.

[0030] (2) Using markers linked to the crude oil content of soybeans for screening is beneficial for molecular marker-assisted selection breeding. The method is simple and feasible, which can improve efficiency and save costs.

[0031] (3) The molecular markers of the present invention have the characteristics of convenient detection, stable amplification products and high specificity. They can be easily, quickly and with high throughput applied to molecular marker-assisted breeding practices and material identification related to crude oil content in soybeans. Attached Figure Description

[0032] Figure 1 The results of QTL localization analysis for crude oil content in soybeans.

[0033] Figure 2 This is a box plot showing the crude oil content distribution corresponding to the genotype at the Gm_Chr09_5332672 locus in the soybean population of Example 1 of this invention. 0 / 0 indicates a homozygous low crude oil content genotype at the Gm_Chr09_5332672 locus, and 1 / 1 indicates a homozygous high crude oil content genotype at the Gm_Chr09_5332672 locus. The dots represent the data distribution, and **** represents... P <0.0001.

[0034] Figure 3 This is an analysis diagram of the amplification results of the molecular marker at the Gm_Chr09_5332672 site in the soybean population of Example 1 of the present invention.

[0035] Figure 4 This is a box plot showing the distribution of crude oil content corresponding to the genotype at the Gm_Chr09_5332672 locus in soybean germplasm resources in Example 2 of this invention. 0 / 0 indicates a homozygous low crude oil content genotype at the Gm_Chr09_5332672 locus; 0 / 1 indicates a heterozygous medium crude oil content genotype; and 1 / 1 indicates a homozygous high crude oil content genotype. The dots represent the data distribution, and *** represents... P <0.001, ** represents P <0.01. Detailed Implementation

[0036] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer with the description. However, unless otherwise specified, the specific experimental methods involved in the following embodiments are conventional methods or implemented according to the conditions recommended in the manufacturer's instructions.

[0037] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, the experimental methods in the following embodiments are all conventional methods. Unless otherwise specified, the reagents and materials used can be purchased commercially.

[0038] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0039] Example 1: Development of molecular markers associated with soybean crude oil content

[0040] This invention analyzed 135 soybean population materials, using the crude oil content (%) in soybean grains as the measure of crude oil content. A higher value indicates a higher crude oil content, while a lower value indicates a lower crude oil content. The crude oil content in soybean grains was measured, and QTL mapping analysis located a linked region containing a SNP locus named Gm_Chr09_5332672. This locus is located at position 5332672 on chromosome 9 of the soybean reference genome Glycine max Wm82.a4.v1 (downloadable from https: / / phytozome-next.jgi.doe.gov / ). This locus contains a C / T base mutation, and the nucleotide sequence of this SNP locus is shown in SEQ ID NO.1, located at position 25 (counting from the first base at the 5' end as position 1). When the base at this locus is C (CC genotype, 0 / 0 genotype), the crude oil content of soybean materials is low; when the base at this locus is T (TT genotype, 1 / 1 genotype), the crude oil content of soybean materials is high. The box plot of crude oil content distribution corresponding to the genotypes at the Gm_Chr09_5332672 locus in the population is shown below. Figure 2 Among them, soybean materials with genotype 0 / 0 had low crude oil content, while soybean materials with genotype 1 / 1 had high crude oil content. Furthermore, the crude oil content of soybean materials with genotype 1 / 1 was significantly higher than that of soybean materials with genotype 0 / 0, meaning that the difference in crude oil content between the two was extremely significant.

[0041] Based on this SNP site and its upstream and downstream sequences, markers for KASP detection were developed, and the following primer set was designed using SnapGene:

[0042] Gm_Chr09_5332672-F1: GAAGGTGACCAAGTTCATGCTGGCTATTCCACACCTTTTGAAGTGC (shown in SEQ ID NO.2);

[0043] Gm_Chr09_5332672-F2: GAAGGTCGGAGTCAACGGATTGGCTATTCCACACCTTTTGAAGTGT (shown in SEQ ID NO.3);

[0044] Gm_Chr09_5332672-R: TATGCCTTCCATGGTGACATAATAAAATC (shown in SEQ ID NO.4).

[0045] Using this primer set, quantitative real-time PCR amplification was performed on the test samples. The results showed that if the PCR product only detected FAM fluorescence signal corresponding to primer Gm_Chr09_5332672-F1 with a fluorescent adapter sequence, the detection site was a 0 / 0 genotype, indicating a homozygous type with a low crude oil content phenotype; if the PCR product only detected VIC fluorescence signal corresponding to primer Gm_Chr09_5332672-F2 with a fluorescent adapter sequence, the detection site was a 1 / 1 genotype, indicating a homozygous type with a high crude oil content phenotype; if both FAM and VIC fluorescence signals corresponding to primers Gm_Chr09_5332672-F1 and Gm_Chr09_5332672-F2 with fluorescent adapter sequences were detected simultaneously, the detection site was a 0 / 1 genotype, indicating a heterozygous type with a medium crude oil content phenotype. Figure 3 ).

[0046] This study developed markers in 135 soybean accessions. 80 accessions showed a genotype of 0 / 0 at the Chr09_5332672 locus, while 55 accessions showed a genotype of 1 / 1 at the Chr09_5332672 locus. A t-test showed that the difference between the 0 / 0 and 1 / 1 genotypes was extremely significant. P <0.0001). The detection results are consistent with the genotype at the Chr09_5332672 locus and the actual crude oil content determination results. Figure 2 ).

[0047] The 135 soybean materials used for marker development were those published in the article "Lei Lei, et al. Classification of Soybean Heterotic Groups Based on SSR Molecular Markers for Yield-Related Traits[J]. Crops, 2022(4): 54–61".

[0048] Example 2: Accuracy verification of the molecular markers described in this invention

[0049] The above molecular markers were used to identify 51 soybean germplasm resources in the germplasm resource bank. The crude oil content and genotype corresponding to the Chr09_5332672 locus of the soybean germplasm materials used are shown in Table 2.

[0050] Table 2. Crude oil content of soybean seeds and genotypes corresponding to the Chr09_5332672 locus in 51 germplasm materials.

[0051]

[0052] Using the genomic DNA of the soybean to be identified as a template, the primer pair was used to perform real-time PCR amplification to obtain the real-time PCR product;

[0053] The reaction system for real-time PCR amplification is as follows: 1 μL genomic DNA, 5 μL 2×PCR Mix, 0.16 μL ROX supplement, 0.1 μL upstream primer F1, 0.1 μL upstream primer F2, 0.3 μL downstream primer R, and sterile distilled water to bring the total to 10 μL.

[0054] The preferred reaction program for quantitative real-time PCR amplification is as follows: 30℃ pre-read fluorescence for 1 min, 94℃ initial denaturation for 15 min; 94℃ denaturation for 20 s, 61℃ annealing and extension for 1 min, 10 cycles; 94℃ denaturation for 20 s, 55℃ annealing and extension for 1 min, 26 cycles; 30℃ final fluorescence reading for 1 min.

[0055] Determining the crude oil content of soybeans based on quantitative real-time PCR products:

[0056] Table 2 shows that among the 51 soybean germplasm resources identified in this study, 31 resources had a genotype of 0 / 0 at the Chr09_5332672 locus; 3 resources had a genotype of 0 / 1 at the Chr09_5332672 locus; and 17 resources had a genotype of 1 / 1 at the Chr09_5332672 locus. The t-test indicated that the difference between the 0 / 0 and 1 / 1 genotypes was extremely significant. P <0.001), the difference between 0 / 0 and 0 / 1 types is highly significant ( P <0.01). The detection results are consistent with the genotype at the Chr09_5332672 locus and the actual crude oil content determination results. Figure 4 Therefore, the KASP marker of the present invention can effectively identify the crude oil content of soybeans and can be used for the prediction and screening of soybean materials with high crude oil content.

[0057] The embodiments described above are merely preferred embodiments of the present invention and are only used to explain the present invention. They are not intended to limit the scope of the present invention. For those skilled in the art, other implementation methods can be easily made by substitution or modification based on the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.

Claims

1. The application of a molecular marker located on chromosome 9 and associated with soybean crude oil content in the identification or auxiliary identification of soybean crude oil content, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein there is a C / T base mutation at position 25 of the sequence shown in SEQ ID NO.

1. When the base at this position is C, the crude oil content of the soybean material is low, and when the base at this position is T, the crude oil content of the soybean material is high.

2. The application according to claim 1, characterized in that, The molecular marker is the KASP marker.

3. The application of the primer set for detecting the molecular marker described in claim 1 in identifying or assisting in the identification of crude oil content in soybeans, characterized in that, The primer set includes: Gm_Chr09_5332672-F1: GAAGGTGACCAAGTTCATGCTGGCTATTCCACACCTTTTGAAGTGC; Gm_Chr09_5332672-F2:GAAGGTCGGAGTCAACGGATTGGCTATTCCACACCTTTTGAAGTGT; Gm_Chr09_5332672-R: TATGCCTTCCATGGTGACATAATAAAATC; The molecular marker has a C / T base mutation at position 25. When the base at this position is C, the crude oil content of the soybean material is low, and when the base at this position is T, the crude oil content of the soybean material is high.

4. The application according to claim 3, characterized in that, The 5' end of the forward primer Gm_Chr09_5332672-F1 is connected to FAM, and the 5' end of the forward primer Gm_Chr09_5332672-F2 is connected to VIC.

5. The application according to claim 4, characterized in that, The method for determining the crude oil content of soybeans includes the following steps: (1) Extract soybean genomic DNA for testing; (2) Using the genomic DNA extracted in step (1) as a template, perform real-time PCR amplification using the primer set, and analyze the results of real-time PCR amplification. (3) Make a judgment based on the result of step (2), and the specific criteria are as follows: Quantitative real-time PCR was performed using primer sets Gm_Chr09_5332672-F1, Gm_Chr09_5332672-F2, and Gm_Chr09_5332672-R. If only FAM fluorescence signal was detected in the PCR product of the sample, the locus was identified as genotype 0 / 0, indicating a homozygous type with a low crude oil content phenotype. If only VIC fluorescence signal was detected in the PCR product of the sample, the locus was identified as genotype 1 / 1, indicating a homozygous type with a high crude oil content phenotype. If both FAM and VIC fluorescence signals were detected, the locus was identified as genotype 0 / 1, indicating a heterozygous type with a medium crude oil content phenotype.

6. The application of a reagent kit in identifying the crude oil content of soybeans, characterized in that, The kit contains the primer set of the molecular marker described in claim 3, with the 5' end of the forward primer Gm_Chr09_5332672-F1 linked to FAM and the 5' end of the forward primer Gm_Chr09_5332672-F2 linked to VIC; a C / T base mutation exists at position 25 of the molecular marker, wherein when the base at this position is C, the crude oil content of the soybean material is low, and when the base at this position is T, the crude oil content of the soybean material is high.

7. The application according to claim 6, characterized in that, The method for identifying the crude oil content of soybeans using the aforementioned kit is as follows: (1) Extract soybean genomic DNA for testing; (2) Using the genomic DNA extracted in step (1) as a template, perform real-time PCR amplification using the primer set, and analyze the results of real-time PCR amplification. (3) Analyze the results of quantitative real-time PCR amplification. If only FAM fluorescence signal is detected in the PCR product of the sample, the locus is 0 / 0 genotype and is determined to be a homozygous type with low crude oil content phenotype. If only VIC fluorescence signal is detected in the PCR product of the sample, the locus is 1 / 1 genotype and is determined to be a homozygous type with high crude oil content phenotype. If both FAM and VIC fluorescence signals are detected, the locus is 0 / 1 genotype and is determined to be a heterozygous type with medium crude oil content phenotype.