Guide RNA (Ribonucleic Acid) and use method thereof
By adding nucleotide residues to the 5' end of the guide RNA, regulating RNA transcription, and designing expression vectors, the limitations of RNA-guided nuclease application technology have been addressed, enabling more efficient RNA expression and genome editing.
Patent Information
- Application Number
- CN202480017217.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2023-03-09
- Filing Date
- 2024-03-08
- Publication Date
- 2025-10-21
AI Technical Summary
There is a need for further development of the existing CRISPR/Cas system in RNA transcription regulation and genome editing technologies, especially in the application of RNA-guided nucleases.
By adding three or more nucleotide residues to the 5' end of guide RNA, RNA transcription can be regulated and RNA expression vectors can be designed. By combining RNA-guided nucleases and expression vectors, transcriptional regulation of target genes and genome editing can be achieved.
This study provides new methods for RNA transcription regulation and RNA expression vector design, improves the application efficiency of RNA-guided nucleases, and enhances the ability to regulate target genes and the precision of genome editing.
Smart Images

Figure BDA0005582957080000261 
Figure BDA0005582957080000262 
Figure BDA0005582957080000271
Abstract
Description
Technical Field
[0001] The present invention relates to a guide RNA and a method for using the same. Specifically, the present invention relates to a method for regulating RNA transcription, a method for designing an RNA expression vector, a method for regulating target gene transcription, a genome editing method, a base editing method, a target gene transcription regulation kit, a base editing kit, a genome editing kit, a guide RNA, and an expression vector. This application claims priority to U.S. Provisional Application Nos. 63 / 450,962 and 63 / 450,967, filed in the United States on March 9, 2023, the contents of which are incorporated herein by reference. Background Art
[0002] Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and Cas (CRISPR-associated) genes together constitute the adaptive immune system in bacteria and archaea, enabling resistance to invading foreign nucleic acids. CRISPR is typically derived from bacteriophage or plasmid DNA and consists of short, conserved repeats of 24-48 base pairs in length, interspersed with similarly sized, unique, and variable DNA sequences (called spacers). Gene clusters encoding the Cas protein family exist near the repeats and spacers.
[0003] In the CRISPR / Cas system, foreign DNA is cleaved into approximately 30-bp fragments by the Cas family of proteins and inserted into the CRISPR sequence. The Cas1 and Cas2 proteins, members of the Cas family, recognize a nucleotide sequence in the foreign DNA called the protospacer adjacent motif (PAM), cleave off the upstream portion, and insert it into the host's CRISPR sequence, which serves as the bacterial immune memory. The RNA (precursor crRNA, pre-crRNA) transcribed from the CRISPR sequence containing the immune memory pairs with a partially complementary RNA (trans-activating crRNA, tracrRNA) and is integrated into the Cas9 protein, also a member of the Cas family. The pre-crRNA and tracrRNA integrated into Cas9 are cleaved by RNase III, forming small RNA fragments (CRISPR-RNAs, crRNAs) containing the foreign sequence (guide sequence), thereby forming the Cas9-crRNA-tracrRNA complex. The Cas9-crRNA-tracrRNA complex binds to foreign invading DNA that is complementary to crRNA, and the Cas9 protein, which acts as a DNA-cutting enzyme (nuclease), cuts the foreign invading DNA, thereby inhibiting and eliminating the function of foreign DNA invading from the outside.
[0004] The Cas9 protein recognizes the PAM sequence in foreign invading DNA and cuts the double-stranded DNA upstream of it in a blunt-end manner. The length and nucleotide sequence of the PAM sequence vary depending on the bacterial species. In Streptococcus pyogenes (S. pyogenes), the three-base sequence "NGG" is recognized. Streptococcus thermophilus (S. thermophilus) has two types of Cas9, which recognize "NGGNG" or "NNAGAA" as 5-6 bases as the PAM sequence (where N represents any base). The number of bases upstream of the PAM sequence where the cutting site is located also varies depending on the bacterial species, but most Cas9 orthologs, including S. pyogenes, cut at the third base upstream of the PAM sequence.
[0005] In recent years, the application of the bacterial CRISPR / Cas system for genome editing has advanced rapidly. The crRNA and tracrRNA are fused to form a tracrRNA-crRNA chimera (sgRNA, single-stranded guide RNA) and expressed. The sgRNA then recruits an RNA-guided nuclease (RGN) to cleave genomic DNA at the target site.
[0006] Currently known types of CRISPR / Cas systems are classified into Types I-VI. Genome editing primarily utilizes the Type II CRISPR / Cas system, in which the Cas9 protein is a Type II receptor binding site (RGN) and Cas12a (Cpf1) is a Type V receptor binding site (RGN). The Cas9 protein, derived from Streptococcus pyogenes, recognizes the three bases "NGG" as the PAM sequence and can cleave any sequence containing two guanines upstream.
[0007] In recent years, various technologies utilizing the CRISPR / Cas system have been developed. For example, Patent Document 1 describes a method for increasing the genome editing rate of a single allele by adding nucleotide residues to the 5' end of a spacer sequence. Prior art literature Patent Literature
[0008] [Patent Document 1] International Publication No. 2020 / 122195 Summary of the Invention Problems to be solved by the present invention
[0009] People expect further development of technologies related to RNA transcription regulation and technologies using RNA-guided nucleases.
[0010] This specification aims to provide new methods for regulating RNA transcription and designing RNA expression vectors, as well as new methods suitable for the application of RNA-guided nuclease technology, as well as guide RNAs, expression vectors, kits, etc. that can be used in this method. Means of solving the problem
[0011] This specification includes the following aspects. [1] A method for regulating RNA transcription, comprising the step of transcribing the RNA from an RNA expression vector, wherein the RNA is an RNA having one or more nucleotide residues added to the 5' end. [2] The method for regulating RNA transcription according to [1], wherein the number of the added nucleotide residues is 3 or more. [3] The method for regulating RNA transcription according to [1] or [2], wherein the RNA is a guide RNA. [4] A method for designing an RNA expression vector, comprising regulating at least one of the number and / or type of nucleotide residues added to the 5' end of an RNA coding sequence to control the transcription efficiency of the RNA, thereby designing the RNA expression vector. [5] The method for designing an RNA expression vector according to [4], wherein the RNA is a guide RNA. [6] A method for regulating the transcription of a target gene, comprising the steps of introducing the following components into a cell: (A) a guide RNA selected from (a1) having one or more nucleotide residues added to its 5' end, and (a2) at least one expression vector of the guide RNA of (a1); and (B) at least one selected from a fusion protein comprising an RNA-guided nuclease with inactivated nuclease activity and a transcriptional regulation-related domain, an mRNA of the fusion protein, and an expression vector of the fusion protein; wherein the guide RNA targets the transcriptional regulatory region of the target gene. [7] The method for regulating transcription of a target gene according to [6], wherein the number of the added nucleotide residues is 3 or more. [8] A genome editing method comprising the steps of introducing the following components into a cell: (A) a guide RNA selected from (a1) having a repeat sequence at the 5' end of a spacer sequence and one or more nucleotide residues added to the 5' end, and (a2) at least one expression vector of the guide RNA of (a1); and (B) at least one selected from an RNA-guided nuclease, an mRNA of the RNA-guided nuclease, and an expression vector of the RNA-guided nuclease. [9] The genome editing method according to [8], wherein the number of added nucleotide residues is 3 or more.
[10] According to the genome editing method described in [8] or [9], the RNA-guided nuclease is a Cas protein of the V-type CRISPR / Cas system.
[11] A base editing method comprising the steps of introducing the following components into a cell: (A) a guide RNA selected from (a1) that regulates at least one of (1) the addition of 5'-terminal nucleotide residues, (2) the length of the spacer sequence, and (3) the introduction of mismatched nucleotide residues in the spacer sequence, and (a2) at least one expression vector of the guide RNA of (a1); and (B) at least one selected from a base editor, an mRNA of the base editor, and an expression vector of the base editor.
[12] According to the base editing method described in
[11] , the activity window of the base editor is controlled by regulating at least one of (1) the addition of 5'-end nucleotide residues, (2) the length of the spacer sequence, and (3) the introduction of mismatched nucleotide residues in the spacer sequence.
[13] According to the base editing method described in
[12] , the activity window of the base editor is controlled by regulating the addition of nucleotide residues at the 5' end, and the number of the added nucleotide residues is more than 3.
[14] According to the base editing method described in
[12] , the activity window of the base editor is controlled by regulating the length of the spacer sequence.
[15] According to the base editing method described in
[12] , the activity window of the base editor is controlled by regulating the introduction of mismatched nucleotide residues in the spacer sequence.
[16] A target gene transcriptional regulation kit comprising: (A) a guide RNA selected from (a1) having one or more nucleotide residues added to its 5' end, and (a2) at least one expression vector of the guide RNA of (a1); and (B) at least one selected from a fusion protein comprising an RNA-guided nuclease with inactivated nuclease activity and a transcriptional regulation-related domain, an mRNA of the fusion protein, and an expression vector of the fusion protein; wherein the guide RNA targets the transcriptional regulatory region of the target gene.
[17] A base editing kit comprising: (A) a guide RNA selected from (a1) that regulates at least one of (1) the addition of 5'-terminal nucleotide residues, (2) the length of the spacer sequence, and (3) the introduction of mismatched nucleotide residues in the spacer sequence, and (a2) at least one expression vector of the guide RNA of (a1); and (B) at least one selected from a base editor, an mRNA of the base editor, and an expression vector of the base editor.
[18] An expression vector capable of expressing: (A) a guide RNA having one or more nucleotide residues added to its 5' end; and (B) a fusion protein comprising an RNA-guided nuclease with inactivated nuclease activity and a protein involved in transcriptional regulation.
[19] An expression vector capable of expressing: (A) a guide RNA with one or more nucleotide residues added to its 5' end; and (B) a base editor.
[20] A guide RNA having a repeat sequence at the 5' end of a spacer sequence and one or more nucleotide residues added to the 5' end.
[21] An expression vector capable of expressing the guide RNA according to
[20] .
[22] The expression vector according to
[21] can also express RNA-guided nuclease.
[23] A genome editing kit comprising: (A) a guide RNA selected from (a1) having a repeat sequence at the 5' end of a spacer sequence and one or more nucleotide residues added to the 5' end, and (a2) at least one expression vector of the guide RNA of (a1); and (B) at least one selected from an RNA-guided nuclease, an mRNA of the RNA-guided nuclease, and an expression vector of the RNA-guided nuclease. Effects of the Invention
[0012] The present invention provides novel methods for regulating RNA transcription and designing RNA expression vectors, as well as novel methods for applying RNA-guided nucleases. Furthermore, guide RNAs, expression vectors, and kits useful in these methods can be provided. BRIEF DESCRIPTION OF THE DRAWINGS
[0013] Figure 1 A schematic diagram showing the structure of a guide RNA (gRNA) with additional nucleotide residues in one embodiment is shown. Figure 2 A schematic diagram of the AIMS cells used in the Examples is shown, where "MP" stands for membrane protein and "TF" stands for transcription factor. Figure 3 The Northern blot analysis results in Example 1 are shown, and "Trim" indicates that the gRNA has been trimmed of excess nucleotide residues. Figure 4 Shown Figure 3 Quantification results of Northern blot analysis signals. Figure 5 The Northern blot analysis results in Example 2 are shown. "15hp" refers to a sample using an sgRNA with 15 nucleotide residues added to the 5' end to form a hairpin structure, and "15s" refers to a sample using an sgRNA with 15 nucleotide residues added to the 5' end to form a hairpin structure. Figure 6 The results of the transcription activation experiment using CRISPRa in Example 3 are shown. Figure 7 The results of the transcription activation experiment using CRISPRa in Example 3 are shown. Figure 8 The results of the transcription inhibition test using CRISPRi in Example 4 are shown. Figure 9 The results of the insertion / deletion induction test using Cas12a (AsCpf1) in Example 5 are shown, which are from the detection of the introduction position of the additional nucleotide residues in the gRNA. In the gRNA schematic diagram shown below the horizontal axis, [C] represents the introduction position of the additional nucleotide residues, "No" represents that insertion / deletion is not induced, "Mono" represents that insertion / deletion is induced in one allele, and "Bi" represents that insertion / deletion is induced in both alleles. Figure 10 The results of the indel induction test using Cas12a (AsCpf1) in Example 5 are shown, which are the results of examining the number of nucleotide residues added to the gRNA. Figure 11The results of clone sequence analysis using ABE8e in the base substitution experiment in Example 6 are shown. Figure 12 The results of clone sequence analysis using ABE8e in the base substitution experiment in Example 7 are shown. Figure 13 The results of amplicon sequence analysis of the base substitution experiment using ABE8e in Example 8 are shown. Figure 14 In Example 9, the results of investigating the indel induction rate by analyzing the amplicon sequences in the base substitution experiment using ABE8e performed in Example 8 are shown. Figure 15 The results of amplicon sequence analysis of the ABE8e base substitution experiment in Example 10 are shown. Figure 16 Shows the Figure 15 The "Editing frequency (%)" of "A5G6--A9→G5G6--G9" is divided by Figure 13 The value (Off / On ratio) obtained by the "Editing frequency (%)" of "A5A6--A9→G5G6--G9". Figure 17 The results of amplicon sequence analysis of the base substitution test using ABE8e in Example 11 are shown, as well as the analysis results of the target region. Figure 18 The results of amplicon sequence analysis of the base substitution experiment using ABE8e in Example 11 are shown. The figure shows the analysis results of the off-target 1 region (upper figure) and the off-target 2 region (lower figure), and the nucleotide residues marked in the boxes represent mismatch residues. Figure 19 The values obtained by dividing the editing frequency of the off-target 1 region (upper graph) or the off-target 2 region (lower graph) by the editing frequency of the on-target region in Example 11 (Off / On ratio) are shown. Figure 20 The target genomic site of the SNP repair test of the Acvr gene associated with fibrodysplasia ossificans progressiva (FOP) in Experimental Example 12 is shown, and byproducts (1) to (3) indicate the predicted mechanism of byproduct correction. Figure 21 The results of the FOP-associated SNP repair test in Example 12 are shown. Figure 22 The target genomic sites for the SNP repair test associated with hereditary tyrosinemia type 1 (HT-1) in Example 13 are shown. Figure 23 The graph shows the results of the HT-1-associated SNP repair test in Example 13. Figure 24 The structure of the ABE8e integrated plasmid used in Experimental Example 14 is shown. Figure 25 The graph shows the results of the HT-1-associated SNP repair test in Example 14. Figure 26 The results of amplicon sequence analysis of the ABE8e base substitution experiment in Example 15 are shown. Figure 27 The results of amplicon sequence analysis of the ABE8e base substitution experiment in Example 15 are shown. Figure 28 The results of amplicon sequence analysis of the base substitution experiment using AID-BE4max in Example 16 are shown. Figure 29 The results of amplicon sequence analysis of the base substitution experiment using AID-BE4max in Example 16 are shown. DETAILED DESCRIPTION
[0014]
definition
[0015] "Comprise" means that components other than the target component may be included. "Consist of" means that components other than the target component are not included. "Consist essentially of" means that components other than the target component are not included and components other than the target component are not included in a manner that exerts a specific function (for example, in a manner that completely loses the effects of the present invention). When "comprising" is used in this specification, both "consist of" and "consist essentially of" are included.
[0016] Proteins, nucleic acids (DNA, RNA), vectors and cells can be isolated. "Isolated" means in a natural state or separated from other components. "Isolated" can mean substantially free of other components. "Substantially free of other components" means that the content of other components contained in the isolated components is negligible. The content of other components contained in the isolated components can be, for example, 10% by mass or less, 5% by mass or less, 4% by mass or less, 3% by mass or less, 2% by mass or less, 1% by mass or less, 0.5% by mass or less or 0.1% by mass or less. The proteins, nucleic acids (DNA, RNA), vectors and cells described herein can be isolated proteins, isolated nucleic acids (isolated DNA, isolated RNA), isolated vectors and isolated cells, respectively.
[0017] The terms "polynucleotide" and "nucleic acid" are used interchangeably and refer to a polymer of nucleotides joined by phosphodiester bonds. "Polynucleotide" and "nucleic acid" can be DNA, RNA, or a combination of DNA and RNA. "Polynucleotide" and "nucleic acid" can be a polymer of natural nucleotides, a polymer of natural nucleotides and non-natural nucleotides, or a polymer of non-natural nucleotides. Non-natural nucleotides are analogs of natural nucleotides. Non-natural nucleotides refer to nucleotides in which at least one of the base portion, sugar portion, and phosphate portion of a natural nucleotide is modified (e.g., a nucleotide having a phosphorothioate backbone).
[0018] Unless otherwise indicated, nucleotide sequences of "polynucleotides" or "nucleic acids" are written using the commonly accepted single-letter code. Unless otherwise indicated, nucleotide sequences are written from the 5' end to the 3' end. The nucleotide residues that make up a "polynucleotide" or "nucleic acid" may be abbreviated as adenine, thymine, cytosine, guanine, uracil, etc., or written using their single-letter codes.
[0019] "Gene" refers to a polynucleotide containing at least one open reading frame that encodes a specific protein. A gene may contain both exons and introns.
[0020] "Polypeptide," "peptide," and "protein" are used interchangeably to refer to a polymer of amino acids linked by amide bonds. A "polypeptide," "peptide," or "protein" can be a polymer of natural amino acids, a polymer of natural and non-natural amino acids, or a polymer of non-natural amino acids. Non-natural amino acids are analogs of natural amino acids. For example, non-natural amino acids are amino acids that have side chains that differ from those of natural amino acids. Unless otherwise indicated, amino acid sequences are written from N-terminus to C-terminus.
[0021] "Alleles" refer to a pair of genes or a pair of nucleotide sequences that exist at the same location on a pair of chromosomes. These genes are not necessarily alleles, and these nucleotide sequences are not necessarily composed of different nucleotide sequences. "Bilateral alleles" refer to both sides of a pair of genes or a pair of nucleotide sequences. "Unilateral alleles" refer to either side of a pair of genes or a pair of nucleotide sequences.
[0022] "Genome editing" refers to the induction of mutations at a desired location (target region) in the genome. Genome editing may involve the use of engineered nucleases to cut the DNA of the target region. Typically, site-specific nucleases are used to induce double-strand breaks (DSBs) in the DNA of the target region. The genome is then repaired by endogenous cellular processes, such as homologous directed repair (HDR) or non-homologous end-joining repair (NHEJ). NHEJ is a repair method that connects the ends of double-strand breaks without the use of repair template DNA, and insertions and / or deletions (indels) are often induced during the repair process. HDR is a repair mechanism that uses repair template DNA and can also introduce desired mutations into the target region. In some embodiments, genome editing technology uses RNA-guided nucleases. In some embodiments, genome editing technology uses CRISPR / Cas systems.
[0023] "Repair template DNA" refers to DNA used to repair double-strand breaks in DNA, which can homologously recombine the DNA around the target region. "Repair template DNA" is also referred to as "donor DNA". In some embodiments, the donor DNA may comprise a nucleotide sequence having 95% or higher sequence identity with the target region and its surrounding areas. The donor DNA may comprise a homology arm that can homologously recombine with the region around the target region. The homology arm may consist of a 5' homology arm and a 3' homology arm. For example, based on the DNA chain comprising the target sequence, the homology arm comprising DNA homologous to the 5' region of the target sequence may be referred to as the 5' homology arm, and the homology arm comprising DNA homologous to the 3' region of the target sequence may be referred to as the 3' homology arm. The desired nucleotide sequence may be contained between the 5' homology arm and the 3' homology arm. The length of the 5' homology arm and the 3' homology arm may be any length that allows homologous recombination to occur. The lower limits of the lengths of the 5' homology arm and the 3' homology arm are, for example, more than 30bp, more than 40bp, more than 50bp, more than 100bp, more than 200bp, more than 300bp, more than 400bp, and more than 500bp, respectively. The upper limits of the lengths of the 5' homology arm and the 3' homology arm are not particularly limited, for example, less than 10kb. Examples of the lengths of the 5' homology arm and the 3' homology arm are, for example, 30bp to 10kb, 40bp to 10kb, 50bp to 10kb, 100bp to 10kb, 200bp to 10kb, 300bp to 10kb, 400bp to 10kb, and 500bp to 10kb, respectively. The lengths of the 5' homology arm and the 3' homology arm can be the same or different. "Homologous DNA" refers to a DNA having a sequence identity of, for example, 80% or more, preferably 85% or more, more preferably 90% or more, and even more preferably 95% or more to the region to be subjected to homologous recombination.
[0024] A "safe harbor region" is a region of the genome where foreign DNA has been shown to be able to be inserted without adversely affecting cells. Examples of known safe harbor regions include AAVS1 in humans and Rosa26 in mice.
[0025] "RNA-guided nuclease" refers to an enzyme that acts synergistically with a guide RNA and exhibits sequence-specific nuclease activity under the guidance of the guide RNA. RNA-guided nucleases form a complex with the guide RNA and exhibit activity that cuts nucleic acids near the target sequence bound to the guide RNA. Examples of RNA-guided nucleases include Cas proteins. RNA-guided nucleases also include RNA-guided nucleases in which nuclease activity has been inactivated. Examples of RNA-guided nucleases in which nuclease activity has been inactivated include RNA-guided nucleases that do not have nuclease activity but have nickase activity, and RNA-guided nucleases that have neither nuclease activity nor nickase activity.
[0026] "Cas protein" refers to a CRISPR-associated protein. In some embodiments, the Cas protein forms a complex with the guide RNA and has endonuclease activity or nickase activity. The Cas protein can be any Cas protein in type I, type II, type III, type IV, type V, and type VI CRISPR / Cas systems. Examples of Cas proteins include, but are not limited to, Cas3 protein, Cas9 protein, Cas12a (Cpf1) protein, C2c1 protein, C2c2 protein, and C2c3 protein. The Cas protein can be a wild-type Cas protein, a homolog thereof (paralog, ortholog, etc.), or a mutant thereof, as long as it can form a complex with the guide RNA. The Cas protein also includes a Cas protein that does not have nuclease activity. Cas proteins that do not have nuclease activity include Cas proteins that do not have nuclease activity but have nickase activity, and Cas proteins that have neither nuclease activity nor nickase activity. Cas proteins that do not have nuclease activity can be obtained by mutating one or more amino acid residues of a wild-type Cas protein with nuclease activity. Cas proteins with nickase activity can be obtained, for example, by mutating one or more amino acid residues of wild-type Cas proteins with nuclease activity. These can be obtained by known methods.
[0027] In some embodiments, the Cas protein participates in a Class II CRISPR / Cas system. The Cas protein preferably participates in a Type II CRISPR / Cas system or a Type V CRISPR / Cas system. Cas proteins participating in the Type II CRISPR / Cas system include Cas9 proteins. Cas proteins participating in the Type V CRISPR / Cas system include Cas12a proteins. Cas12a proteins are also known as Cpf1 proteins.
[0028] "Cas9 protein" is a Cas protein that participates in the CRISPR / Cas system and is classified as type II. The Cas9 protein forms a complex with the guide RNA and exhibits the activity of collaboratively cutting the target region DNA with the guide RNA. The Cas9 protein can be a wild-type Cas9 protein, its homologs (paralogs, orthologs, etc.) or a mutant thereof, as long as it has the activity of forming a complex with the guide RNA. The wild-type Cas9 protein has a RuvC domain and an HNH domain as a nuclease domain. The Cas9 protein also includes a Cas9 protein that does not have nuclease activity.
[0029] The biological population from which the Cas9 protein originates is not particularly limited, for example, bacteria of the genus Streptococcus, Staphylococcus, Neisseria and Treponema. The Cas9 protein is preferably derived from Streptococcus pyogenes, Streptococcus thermophilus, Staphylococcus aureus, Neisseria meningitidis, Treponema denticola, etc., more preferably from Streptococcus pyogenes. In the Cas9 protein, the sequence adjacent to the 5' side of the PAM sequence is the target sequence.
[0030] "Cas12a protein" is a Cas protein that participates in the CRISPR / Cas system and is classified as type V. Cas12a protein forms a complex with guide RNA and exhibits the activity of collaboratively cutting target region DNA with guide RNA. Cas12a protein can be any of wild-type Cas12a protein, its homologues (paralogues, orthologues, etc.) and mutants thereof, as long as it has the activity of forming a complex with guide RNA. Wild-type Cas12a protein has a RuvC domain as a nuclease domain. Cas12a protein also includes Cas12a protein that does not have nuclease activity.
[0031] The biological species of Cas12a protein sources include Acidaminococcus, Prevotella, Francisella and Lachnospiraceae. Cas12a protein is preferably derived from Acidaminococcus sp. BV3L6. In Cas12a protein, the sequence adjacent to the 3' side of the PAM sequence is the target sequence.
[0032] The amino acid sequences and coding sequence information of various Cas proteins can be obtained from various databases such as GenBank and UniProt. For example, the amino acid sequence of the Streptococcus pyogenes Cas9 protein with accession number Q99ZW2 in UniProt can be used. Expression vectors for various Cas proteins are commercially available, so commercially available vectors can also be used.
[0033] The terms "guide RNA" and "gRNA" are used interchangeably and refer to RNA that can form a complex with an RNA-guided nuclease and guide the RNA-guided nuclease to the target region. Examples of guide RNA include RNA that can form a complex with a Cas protein and guide the Cas protein to the target region. For example, the guide RNA of the type II CRISPR / Cas system includes CRISPR RNA (crRNA) and trans-activating CRISPR RNA (tracrRNA). crRNA participates in binding to the genomic target region, while tracrRNA participates in binding to the Cas protein. In some embodiments, crRNA comprises a spacer sequence and a repeat sequence, and the spacer sequence binds to the complementary strand of the target sequence in the target region. For example, in the crRNA of the type II CRISPR / Cas system, the repeat sequence is located at the 3' side of the spacer sequence. In some embodiments, tracrRNA comprises an anti-repeat sequence and a 3' tail sequence, wherein the anti-repeat sequence has a sequence that is complementary to the repeat sequence of the crRNA and base-paired, and the 3' tail sequence typically forms three stem loops. The guide RNA of the type II CRISPR / Cas system can be a single-stranded guide RNA (sgRNA), in which the 5' end of the tracrRNA is connected to the 3' end of the crRNA; or the crRNA and tracrRNA can be independent RNA molecules, in which base pairs are formed at the repeat sequence and the anti-repeat sequence. In some embodiments, the guide RNA is an sgRNA.
[0034] For example, the guide RNA of the V-type CRISPR / Cas system (e.g., the CRISPR / Cas12a system) contains crRNA but does not contain tracrRNA. For example, in the crRNA of the V-type CRISPR / Cas system, the repeat sequence is located at the 5' side of the spacer sequence.
[0035] The repeat sequence of crRNA and the sequence of tracrRNA can be appropriately selected according to the type of Cas protein, and sequences derived from the same bacterial species as the Cas protein can be used. For example, when using the Cas9 protein derived from Streptococcus pyogenes, the length of the sgRNA can be about 50 to 220 nucleotides (nt), preferably about 60 to 180 nt, and more preferably about 80 to 120 nt. The length of the crRNA (including the spacer sequence) can be about 25 to 70 nt, preferably about 25 to 50 nt. The length of the tracrRNA can be about 10 to 130 nt, preferably about 30 to 80 nt. The repetitive sequence of crRNA may be the same as the repetitive sequence in the bacterial species from which the Cas protein is derived, or it may be a sequence with a partial deletion of the 3' end. The sequence of tracrRNA may be the same as the mature tracrRNA in the bacterial species from which the Cas protein is derived, or it may be a truncated form in which the 5' end and / or 3' end of the mature tracrRNA are truncated. For example, tracrRNA may be a truncated form in which about 1 to 40 nucleotide residues are removed from the 3' end of the mature tracrRNA. tracrRNA may also be a truncated form in which about 1 to 80 nucleotide residues are removed from the 5' end of the mature tracrRNA. tracrRNA may also be the following truncated form, for example, removing about 1 to 20 nucleotide residues from the 5' end and about 1 to 40 nucleotide residues from the 3' end. Various crRNA repeat sequences and tracrRNA sequences for designing sgRNA have been proposed, and those skilled in the art can design sgRNA based on known techniques (e.g., Jinek et al. (2012) Science, 337, 816-21; Mali et al. (2013) Science, 339: 6121, 823-6; Cong et al. (2013) Science, 339: 6121, 819-23; Hwang et al. (2013) Nat. Biotechnol. 31: 3, 227-9; Jinek et al. (2013) eLife, 2, e00471).
[0036] "Target sequence" refers to a nucleotide sequence in the genome that serves as a target for RNA-guided nuclease cleavage. In some embodiments, the target sequence refers to a nucleotide sequence in the genome that serves as a target for Cas protein cleavage. The target sequence is a sequence complementary to the nucleotide sequence bound to the spacer sequence carried by the guide RNA in the genome. When the Cas9 protein is used as the Cas protein, the target sequence is a sequence adjacent to the 5' side of the original spacer adjacent motif (PAM). The target sequence is typically selected to be a sequence of 15 to 50 nucleotide residues (e.g., 17 to 50 nucleotide residues, preferably 17 to 40 nucleotide residues, more preferably 17 to 30 nucleotide residues, even more preferably 20 nucleotide residues) adjacent to the PAM5' side. When Cas12a protein is used as the Cas protein, the target sequence is a sequence adjacent to the 3' side of PAM, which is generally a sequence of 17 to 30 bases (preferably 17 to 25 bases, more preferably 19 to 22 bases, and even more preferably 20 bases) adjacent to the 3' side of PAM. Target sequences can be designed using known design tools such as CRISPRDESIGN (crispr.mit.edu / ).
[0037] "Target region" refers to a genomic region comprising a target sequence and its complementary sequence.
[0038] The terms "protospacer adjacent motif" and "PAM" are used interchangeably to refer to the sequence recognized by Cas proteins during DNA cleavage. The sequence and position of the PAM vary depending on the type of Cas protein. For example, for the Cas9 protein, the PAM is immediately 3' to the target sequence. The PAM sequence corresponding to the Cas9 protein varies depending on the type of bacteria from which the Cas9 protein originates. For example, the PAM corresponding to the Cas9 protein of Streptococcus pyogenes is "NGG". The PAM corresponding to the Cas9 protein of Streptococcus thermophilus is "NNAGAA". The PAM corresponding to the Cas9 protein of Staphylococcus aureus is "NNGRRT" or "NNGRR(N)". The PAM corresponding to the Cas9 protein of Neisseria meningitidis is "NNNNGATT". The PAM corresponding to the Cas9 protein of Treponema denticola is "NAAAC" (where "R" is A or G; "N" is A, T, G, or C). For Cas12a proteins, the PAM is located immediately 5' to the target sequence. The PAM sequence corresponding to the Cas12a protein varies depending on the bacterial species from which the Cas12a protein originates. For example, the PAM corresponding to the Cas12a protein of Acidaminoncoccus sp. BV3L6 is "TTTV" (where "V" is A, C, or G).
[0039] The terms "spacer sequence" and "guide sequence" are used interchangeably and refer to a sequence contained in a guide RNA that can bind to a complementary sequence of a target sequence. Typically, the spacer sequence is the same as the target sequence (except that the T in the target sequence is changed to a U in the spacer sequence). In some embodiments, the spacer sequence may contain one or more mismatches of nucleotide residues relative to the target sequence. When multiple nucleotide residues are mismatched, the mismatched nucleotide residues may be adjacent to or far away from each other. The length of the spacer sequence can be, for example, 15 to 50 nucleotide residues, or 17 to 50 nucleotide residues, 17 to 40 nucleotide residues, or 17 to 30 nucleotide residues. In some embodiments, the spacer sequence is 20 nucleotide residues. In type II CRISPR / Cas system guide RNAs, the spacer sequence is located at the 5' end of the crRNA. In type V CRISPR / Cas system guide RNAs, the spacer sequence is located at the 3' end of the crRNA.
[0040] “Cas protein without nuclease activity” refers to a Cas protein in which nuclease activity is inactivated. Examples of Cas proteins without nuclease activity include: a Cas protein without nuclease activity but with nickase activity (hereinafter also referred to as “nCas”), and a Cas protein with neither nuclease activity nor nickase activity (hereinafter also referred to as “dCas”). dCas can be obtained by, for example, mutating one or more amino acid residues of a wild-type Cas protein with nuclease activity. Examples of dCas include, but are not limited to, dCas9, dCasl2a, etc. The number of amino acid substitutions can be, for example, about 1 to 10, about 1 to 5, about 1 to 3, or 2. For example, when the Cas protein is a Cas9 protein, the RuvC domain of the Cas9 protein without nuclease activity (dCas9) may contain D10A, E762A and / or D986A mutations, and the HNH domain may contain H840A, N854A and / or N863A mutations. Specific examples of dCas9 include dCas9 having two amino acid substitutions (D10A and H840A).
[0041] The term "transcriptional regulation-related domain" refers to a domain that regulates transcription. The transcriptional regulation-related domain can be a transcriptional activation-related domain or a transcriptional repression-related domain. The transcription activation associated domain is a domain involved in transcriptional activation. The transcription activation associated domain can be a domain of a transcription activator that binds to the transcriptional regulatory region of a target gene, thereby activating the transcription of the target gene; or it can be a transcription activator recruitment domain for recruiting transcription activators. Examples of transcription activation associated domains include transcription activation associated domains for CRISPR activation (CRISPRa). Examples of transcription activation associated domains include, but are not limited to, at least one of VP64, p65, Rta, and Suntag (GCN4 epitope). The transcriptional repression-associated domain is a domain involved in transcriptional repression. The transcriptional repression-associated domain can be a transcriptional repressor domain that binds to the transcriptional regulatory region of the target gene to inhibit the transcription of the target gene; it can also be a transcriptional repressor recruitment domain that recruits transcriptional repressors. The transcriptional activation-associated domain includes a transcriptional repression-associated domain for CRISPR interference (CRISPRi). Examples of transcriptional repression-associated domains include, but are not limited to, at least one selected from KRAB (KRAB domain of Kox1) and SALL1-SDS3.
[0042] "CRISPR activation" (CRISPRa) refers to a system that uses a fusion protein of dCas and a transcriptional activation-associated domain to activate target gene transcription. For CRISPRa, known CRISPRa systems can be used, such as a system using VP64 as a transcriptional activation-associated domain, a system using VP64, p65, and Rta, and a system using SunTag. In the CRISPRa SAM system, VP64 is used as a transcriptional activation-associated domain, and a modified guide RNA containing an MS2 RNA aptamer and an MS2-p65-HS1 activation domain are used in combination. In the CRISPRa SunTag system, GCN4 is used as a transcriptional activation-associated domain, and a fusion protein of scFv that specifically binds to the GCN4 epitope and VP64 is used in combination.
[0043] "CRISPR interference" (CRISPRi) refers to a system that uses a fusion protein of dCas and a transcriptional repression-associated domain to inhibit target gene transcription. CRISPRi can use a known CRISPRi system, for example, a system using KRAB or SALL1-SDS3 as a transcriptional repression-associated domain.
[0044] CRISPRa and CRISPRi use guide RNA to target the transcriptional regulatory region of the target gene to be activated or inhibited. In some embodiments, the guide RNA of CRISPRa and CRISPRi targets a 17-30nt nucleotide sequence contained in the transcriptional regulatory region of the target gene. Examples of transcriptional regulatory regions include promoter regions and regions around the transcription start site (+1). Examples of regions around the transcription start site include regions 0 to 300bp upstream and downstream of the transcription start site (-300 to +300). If the transcriptional regulatory-related domain is capable of transcriptional control, the target sequence can be located in the -300 upstream region. Alternatively, if the transcriptional regulatory-related domain is capable of transcriptional control, the target sequence can be located in the +300 downstream region.
[0045] "Base editor" refers to a protein that has the activity of converting a base of a nucleotide residue in a nucleic acid into another base, or a protein complex having such activity. Examples of base editors include those that use RNA-guided nucleases whose nuclease activity has been inactivated to perform sequence-specific base replacements. Examples of base editors include proteins or protein complexes that can use CRISPR / Cas systems to perform sequence-specific base replacements. The base editor can form a complex with the guide RNA and reach the target sequence under the guidance of the guide RNA, thereby replacing a specific base in or near the target sequence with another base. Various base editors have been developed and are already on the market. These known base editors can be used as base editors without any special restrictions. Examples of base editors include adenine base editors (convert adenine to guanine or inosine; ABE, ABE8e, etc.), cytosine base editors (convert cytosine to thymine; Target-AID, BE4max, etc.), and adenine transversion editors (convert adenine to cytosine; alkyladenine DNA glycosylase / nCas9 / deaminase TadA-8e), etc.
[0046] Known base editors include base editors that connect deaminases (with or without linkers) to Cas proteins that do not have nuclease activity. Examples of Cas proteins that do not have nuclease activity include nCas and dCas. As deaminases, commonly used examples include adenosine deaminase and cytidine deaminase.
[0047] "Base editing" refers to the use of a base editor to convert the base of a nucleotide residue in a nucleic acid to another base.
[0048] The term "activity window" refers to the range within which a base editor can perform base editing in a nucleic acid to be base edited.
[0049] "Mismatch" means that the spacer sequence contains a different nucleotide residue than the target sequence, or contains different nucleotide residues. For example, "the spacer sequence contains a mismatch" means that the spacer sequence is different from the target sequence by only one nucleotide residue.
[0050] "Indel" refers to insertion and / or deletion. "Bilateral allelic indel" refers to a state in which indels are generated in the target region of both alleles by genome editing. "Unilateral allelic indel" refers to a state in which indels are generated in the target region of only one allele by genome editing. "Frameshift indel" refers to an indel that results in a frameshift. "Same-frame indel" refers to an indel that does not result in a frameshift.
[0051] "AIMS" (Allele-specific Indel Monitor System) stands for Allele-specific Indel Monitor System, a technology that can specifically detect allele insertions and deletions. "AIMS cells" refer to cells engineered to perform AIMS and are capable of specifically detecting allele insertions and deletions.
[0052] "Genome editing pattern" refers to the genome editing directing status of each allele within the target region in a genome-edited cell. Genome editing pattern refers to whether genome editing is directed in both alleles or only in one allele.
[0053] The term "operably linked" when applied to polynucleotides means that a first nucleotide sequence is located sufficiently close to a second nucleotide sequence such that the first nucleotide sequence can affect the second nucleotide sequence or the region controlled by it. For example, a polynucleotide is operably linked to a promoter if the polynucleotide is linked in such a way that its expression is under the control of the promoter.
[0054] The term "expressible state" refers to a state in which a polynucleotide is capable of being transcribed in a cell or in vitro expression system into which the polynucleotide is introduced.
[0055] An “expression vector” is a vector that contains a polynucleotide of interest and is equipped with a system that allows the polynucleotide of interest to be expressed in cells into which the vector has been introduced. For example, a “Cas protein expression vector” is a vector that can express a Cas protein in cells into which the vector has been introduced or in an in vitro expression system. For example, a “guide RNA expression vector” is a vector that can express a guide RNA in cells into which the vector has been introduced or in an in vitro expression system.
[0056] A "silent mutation" is a genetic mutation that does not change the amino acid sequence of the encoded protein.
[0057] The sequence identity between the nucleotide sequence or between the amino acid sequence can be determined in the following manner: two nucleotide sequences or amino acid sequences are compared, and a gap is inserted in the part of the insertion and deletion so that the corresponding nucleotide residues or amino acid residues of the maximum number are identical. Sequence identity is determined by the percentage of matching nucleotide residues or matching amino acid residues relative to the entire nucleotide sequence or the entire amino acid sequence (deleting the gap in the comparison result). The sequence identity between the nucleotide sequence or the amino acid sequence can be determined using various homology search software known in the art. For example, the sequence identity value of the nucleotide sequence can be calculated based on the comparison results obtained using known homology search software BLASTN. The sequence identity value of the amino acid sequence can be calculated based on the comparison results obtained using known homology search software BLASTP.
[0058] RNA transcription regulation methods The first aspect of the present specification is a method for regulating RNA transcription, comprising the step of transcribing RNA from an RNA expression vector, wherein the RNA has one or more nucleotide residues added to the 5' end.
[0059] <rna> Examples of RNA include RNA that is operably linked to an RNA polymerase III (pol III) promoter and can be transcribed by pol III. Examples of such RNA include functional RNA, such as guide RNA and RNA with RNA interference effect (e.g., siRNA and shRNA). Examples of pol III promoters include mouse U6-snRNA promoter, human U6-snRNA promoter, human H1-RNase P RNA promoter, and human valine-tRNA promoter, etc. RNA is preferably a guide RNA. In the embodiments described below, RNA is preferably a guide RNA. When RNA is a guide RNA for a CRISPR / Cas system, a nucleotide residue is added to the 5' end of the crRNA. The 5' end of RNA refers to the 5' end of the RNA molecule that the functional RNA is able to express its function.
[0060] By adjusting the number and type of nucleotide residues added to the 5' end of the RNA, the transcription efficiency of the RNA can be regulated in an in vitro transcription system or in a cell into which an expression vector is introduced. The cell into which the expression vector is introduced can be a living cell. The introduction of the expression vector can be carried out in vitro, in vitro, or in vivo.
[0061] In another aspect, this specification provides a method for designing an RNA expression vector. This DNA design method includes controlling the transcription efficiency of the RNA by regulating at least one of the number and / or type of nucleotide residues added to the 5' end of the RNA coding sequence, thereby designing an RNA expression vector. Examples of RNA include RNAs similar to those described above, preferably guide RNAs. For example, an RNA coding sequence without additional nucleotide residues or an RNA coding sequence with a modified number and / or type of additional nucleotide residues added to the 5' end can be prepared, and RNA expression tests can be performed using these sequences to design an expression vector that achieves a desired expression level.
[0062] The RNA used is an RNA to which one or more nucleotide residues are added at the 5' end. Exemplarily, the number of added nucleotide residues (hereinafter also referred to as "additional nucleotide residues") can be in the range of 1 to 50. For example, the number of additional nucleotide residues can be 3 or more, 5 or more, 10 or more, 15 or more, 20 or more or 25 or more. The upper limit of the number of additional nucleotide residues, for example, can be 50 or less, preferably 40 or less, more preferably 35 or less, even more preferably 30 or less. The upper limit and lower limit can be combined as needed. The preferred range of the number of nucleotide residues added, for example, includes 3 to 50, 5 to 40, 5 to 35 and 5 to 30, etc.
[0063] In the RNA transcription regulation method of the present embodiment, RNA transcription can be regulated by adjusting the number of added nucleotide residues. For example, the greater the number of added nucleotide residues, the greater the degree of inhibition of RNA transcription. For example, by increasing or decreasing the number of added nucleotide residues within the range of 0 to 50, 0 to 30, or 0 to 25, the efficiency of RNA transcription can be precisely regulated. When it is necessary to obtain a better RNA transcription inhibition effect, the number of added nucleotide residues can be, for example, 5 or more, 10 or more, 15 or more, 20 or more, or 25 or more.
[0064] The type of nucleotide residues added can be any one of adenine nucleotide residues (A), uracil nucleotide residues (U), guanine nucleotide residues (G) and cytosine nucleotide residues (C), or a combination of two or more of these residues. When two or more nucleotide residues are added, the nucleotide residues added can include a continuous region (hereinafter also referred to as a "continuous region") in which nucleotide residues of the same type are continuous. The type of continuous nucleotide residues can be any one of adenine nucleotide residues (A), uracil nucleotide residues (U), guanine nucleotide residues (G) and cytosine nucleotide residues (C). The number of continuous nucleotide residues is limited to the total number of nucleotide residues added, for example, 2 or more, 3 or more, 4 or more, 5 or more, 10 or more, 15 or more, 20 or more, and 25 or more. The ratio of the continuous region to all added nucleotide residues includes, for example, 10-100%, 20-100%, 30-100%, 40-100%, 50-100%, 60-100%, 70-100%, 80-100%, 90-100%, etc. Hereinafter, a continuous region of nucleotide residues of the same type may be represented as [nN]. n represents the number of continuous nucleotide residues, and N represents the type of continuous nucleotide residues. For example, [10C] represents 10 continuous cytosine nucleotide residues. [nC] represents n continuous cytosine nucleotide residues. n is an integer of 2 or greater. [nN] may include 1 to 2 nucleotide residues of other types.
[0065] The transcriptional repression effect of RNA is often shown to be stronger with [nC] and [nU] (or [nT]), followed by [nG], and weaker with [nA]. Therefore, by appropriately selecting or combining [nC], [nU] (or [nT]), [nG], and [nA], desired RNA expression levels can be modulated.
[0066] The additional nucleotide residues may not constitute a continuous region. For example, the additional nucleotide residues may form a hairpin structure of RNA.
[0067] When using an expression vector encoding RNA, the added polynucleotide residues preferably do not contain a sequence complementary to the terminator sequence used to terminate transcription of the promoter employed. For example, when using the U6 promoter, since transcription stops upon the occurrence of 5 consecutive thymines, the added nucleotide residues preferably do not contain 5 or more consecutive uracil nucleotide residues ([nU]: n≥5).
[0068] <RNA expression vector> An RNA expression vector (e.g., an expression vector for guide RNA) is an expression vector that, when introduced into a cell, is capable of expressing an RNA (e.g., guide RNA) having additional nucleotide residues at its 5'-end. The RNA expression vector (e.g., an expression vector for guide RNA) preferably comprises a sequence encoding the RNA (e.g., guide RNA) (RNA coding sequence (e.g., guide RNA coding sequence)) and a promoter that regulates the expression of the RNA coding sequence. In the RNA expression vector (e.g., an expression vector for guide RNA), the RNA coding sequence (e.g., guide RNA coding sequence) is operably linked to the promoter.
[0069] The promoter is not particularly limited as long as it has the function of expressing RNA (e.g., guide RNA). Examples of the promoter include RNA polymerase II (pol II) promoters and RNA polymerase III (pol III) promoters. Using a pol III promoter allows for more accurate transcription of relatively short RNAs. Examples of pol III promoters include the mouse U6-snRNA promoter, the human U6-snRNA promoter, the human H1-RNaseP RNA promoter, and the human valine-tRNA promoter. When using the U6 promoter, the 5'-end of the RNA (e.g., guide RNA) is preferably a guanine nucleotide residue (G) in order to initiate transcription. Thus, the 5'-end of the additional nucleotide residues carried by the RNA (e.g., guide RNA) is preferably a guanine nucleotide residue.
[0070] An RNA expression vector (e.g., an expression vector for a guide RNA) may contain other components in addition to an RNA coding sequence (e.g., a guide RNA coding sequence) and a promoter. Examples of other components include a terminator, an enhancer, a marker gene, a replication origin, and a gene encoding a protein that binds to the replication origin and controls replication. The terminator is linked to the 3'-end of the RNA coding sequence (e.g., a guide RNA coding sequence). Terminators commonly used as terminators for RNA (e.g., guide RNA) can be used. A "marker gene" refers to a gene that enables cell sorting or selection by introducing it into a cell. Specific examples of marker genes include drug resistance genes, fluorescent protein genes, luciferase genes, and chromogenic enzyme genes. These genes can be used alone or in combination. Specific examples of drug resistance genes include puromycin resistance gene, geneticin resistance gene, neomycin resistance gene, tetracycline resistance gene, kanamycin resistance gene, hygromycin resistance gene, and chloramphenicol resistance gene. Specific examples of fluorescent protein genes include green fluorescent protein (GFP) gene, yellow fluorescent protein (YFP) gene, and red fluorescent protein (RFP) gene. Specific examples of luciferase genes include luciferase genes. Specific examples of chromogenic enzyme genes include β-galactosidase gene, β-glucuronidase gene, and alkaline phosphatase gene.
[0071] There is no particular limitation on the type of expression vector, and any known expression vector can be used, e.g., plasmid vectors and viral vectors, etc.
[0072] The plasmid vector only needs to be able to be expressed in the cell to be subjected to genome editing, and there is no particular limitation. For example, in animal cells, plasmid vectors commonly used for expression in animal cells can be used. Plasmid vectors for expression in animal cells include, but are not limited to: pX459, pA1-11, pXT1, pRc / CMV, pRc / RSV, and pcDNAI / Neo.
[0073] Examples of viral vectors include retrovirus (including lentivirus) vectors, adenovirus vectors, adeno-associated virus vectors, Sendai virus vectors, herpesvirus vectors, vaccinia virus vectors, poxvirus vectors, poliovirus vectors, Silvis virus vectors, rhabdovirus vectors, paramyxovirus vectors, and orthomyxovirus vectors, etc.
[0074] Among them, plasmid vectors are preferably used as expression vectors.
[0075] <RNA transcription step> Expression of an RNA (e.g., a guide RNA) from an RNA expression vector (e.g., a guide RNA) can be carried out by known methods. Expression of an RNA (e.g., a guide RNA) can be carried out in an in vitro transcription system or in a cell. When expressing an RNA (e.g., a guide RNA) in an in vitro transcription system, an RNA polymerase (e.g., pol III) can be allowed to act on the RNA expression vector (e.g., a guide RNA). When expressing an RNA (e.g., a guide RNA) in a cell, the RNA expression vector (e.g., a guide RNA) can be introduced into a desired cell. The cell can be an in vitro cell or an in vivo cell. This step can be carried out in vitro, ex vivo or in vivo. When RNA transcription is carried out in a cell, the method for regulated transcription of the RNA includes the step of introducing the RNA expression vector into the cell.
[0076] When the RNA is a guide RNA, the method for regulated transcription of the guide RNA may include the following steps: introducing (A) an expression vector of the guide RNA into a cell, the 5' end of the vector being added with one or more nucleotide residues; and (B) at least one selected from an RNA-guided nuclease, the mRNA of the RNA-guided nuclease, and the expression vector of the RNA-guided nuclease. The cell can be a living cell. This step can be carried out in vitro, ex vivo or in vivo.
[0077] <RNA-guided nuclease> Examples of RNA-guided nucleases include Cas proteins. The Cas protein is not particularly limited as long as it is used in the CRISPR / Cas system. The Cas protein can be a Cas protein used in a type I-VI CRISPR / Cas system. The Cas protein is not limited to a Cas protein having endonuclease activity and can also be nCas or dCas. In some embodiments, the Cas protein is a Cas protein used in a type II or V CRISPR / Cas system. In some embodiments, the Cas protein is a Cas9 protein or a Cas12a protein.
[0078] The Cas protein can also be a mutant of a wild-type Cas protein as long as it can form a complex with the guide RNA. Examples of Cas protein mutants include the following proteins (b1) and (b2): (b1) a protein having an amino acid sequence having, for example, 85% or more, preferably 90% or more, more preferably 95% or more, and even more preferably 98% or more sequence identity with the amino acid sequence of the wild-type Cas protein and having the ability to form a complex with the guide RNA. (b2) A protein formed by an amino acid sequence in which one or more (e.g., 2 to 100, preferably 2 to 50, more preferably 2 to 20, even more preferably 2 to 10, still more preferably 2 to 5, particularly preferably 2) amino acids are substituted, deleted, added or inserted relative to the amino acid sequence of the wild-type Cas protein, and having the ability to form a complex with a guide RNA.
[0079] <RNA-guided nuclease expression vector> An RNA-guided nuclease expression vector is an expression vector capable of expressing an RNA-guided nuclease after being introduced into a cell. The RNA-guided nuclease expression vector preferably contains a coding sequence of an RNA-guided nuclease (RNA-guided nuclease coding sequence) and a promoter that regulates the expression of the RNA-guided nuclease coding sequence. In the RNA-guided nuclease expression vector, the RNA-guided nuclease coding sequence is operably linked to the promoter. The RNA-guided nuclease is preferably a Cas protein.
[0080] The promoter is not particularly limited as long as it has the function of expressing an RNA-guided nuclease (e.g., Cas protein). For example, a Pol II promoter. For example, the Pol II promoter can be a CMV promoter, an EF1 promoter, an SV40 promoter, an MSCV promoter, a hTERT promoter, a β-actin promoter, a CAG promoter or a CBh promoter, etc.
[0081] In addition to the RNA-guided nuclease coding sequence and the promoter, the RNA-guided nuclease expression vector may further contain other components. These other components include a terminator, an enhancer, a polyA addition signal, a marker gene, a replication origin, and a gene encoding a protein that binds to the replication origin to regulate replication. The terminator is linked to the 3'-side of the RNA-guided nuclease coding sequence. Terminators commonly used for RNA-guided nuclease (e.g., Cas protein) terminators can be used. Examples of the marker gene include those described above.
[0082] The type of the expression vector is not particularly limited, and known expression vectors can be used. For example, plasmid vectors, viral vectors, etc. As these vectors, the same vectors as those described above can be cited. Among them, a plasmid vector is preferably used as the expression vector.
[0083] The RNA-guided nuclease coding sequence (e.g., Cas protein coding sequence) contained in the expression vector can be codon-optimized according to the target cell species. Codon optimization refers to replacing at least one codon in the original base sequence with a more commonly used codon in the target species while keeping the original amino acid sequence unchanged. Codon usage tables are easy to obtain, for example, from the "Codon Usage Database" (Codon Usage Database: www.kazusa.or.jp / codon / ) provided by the Kazusa DNA Research Institute. Codons can be optimized using these known codon usage tables. Computer algorithms for codon optimization of specific sequences for expression in specific animal species can be obtained from, for example, GeneForge (Aptagen; Jacobus, PA).
[0084] <Expression Vectors for Guide RNA and RNA-Guided Nucleases> When using an expression vector of an RNA-guided nuclease (e.g., a Cas protein), the expression vector of the guide RNA and the expression vector of the RNA-guided nuclease can be the same expression vector. In some embodiments, the expression vector is an expression vector capable of expressing a guide RNA and an RNA-guided nuclease (hereinafter also referred to as a "guide RNA / RNA-guided nuclease expression vector"). The expression vector of the guide RNA / RNA-guided nuclease comprises a guide RNA coding sequence and an RNA-guided nuclease coding sequence, wherein each sequence is expressible. The expression vector of the guide RNA / RNA-guided nuclease comprises a guide RNA coding sequence operably connected to a guide RNA promoter, and an RNA-guided nuclease coding sequence operably connected to an RNA-guided nuclease promoter. The guide RNA terminator can be connected to the 3' side of the guide RNA coding sequence. The terminator of the RNA-guided nuclease coding sequence can be connected to the 3' side of the RNA-guided nuclease coding sequence.
[0085] The expression vector for the guide RNA / RNA-guided nuclease may also include other components, such as those described above.
[0086] <Introduction steps> The method of this embodiment may include the following steps: introducing into a cell (A) an expression vector for a guide RNA, and (B) at least one selected from an RNA-guided nuclease (e.g., a Cas protein), an mRNA for an RNA-guided nuclease, and an expression vector for an RNA-guided nuclease.
[0087] The cells into which (A) and (B) are introduced are not particularly limited. The organisms from which the cells can be derived are also not particularly limited, and examples include mammals such as humans, monkeys, mice, rats, dogs, cats, rabbits, cattle, horses, pigs, goats, and sheep; birds such as chickens; reptiles such as snakes and lizards; amphibians such as African clawed frogs; fish such as zebrafish, medaka, and tiger pufferfish; chordates such as sea squirts; arthropods such as fruit flies and silkworms; plants such as Arabidopsis thaliana, rice, wheat, and tobacco; fungi such as yeast and Neurospora crassa; and bacteria such as Escherichia coli, Bacillus subtilis, and cyanobacteria. The type of cells is not particularly limited. For example, the cells may be blood cells, hematopoietic stem cells / progenitor cells, gametes (sperm, eggs), fertilized eggs, fibroblasts, epithelial cells, vascular endothelial cells, nerve cells, hepatocytes, keratinocytes, muscle cells, epidermal cells, endocrine cells, tissue stem cells, iPS cells, ES cells, cancer cells, etc., and may be cells suffering from various genetic diseases such as sickle cell disease, Huntington's disease, Duchenne muscular dystrophy, and fibrodysplasia ossificans progressiva (FOP).
[0088] The above-mentioned introduction methods (A) and (B) can be appropriately selected according to the types of target cells and substances (such as nucleic acids or proteins). Methods for introducing expression vectors into cells include, for example, lipofection, microinjection, DEAE-dextran, gene gun, electroporation, calcium phosphate method, etc. When the expression vector is a viral vector, methods for infecting cells with viral vectors (e.g., polybrene method) can be used.
[0089] The method for introducing RNA into cells is not particularly limited, and a known method can be appropriately selected and used. For example, RNA can be introduced using commercially available RNA transfection reagents such as Lipofectamine (registered trademark) and MessengerMAX (manufactured by Life Technologies).
[0090] The method for introducing proteins into cells is not particularly limited, and any known method can be appropriately selected and used, for example, a method using a protein introduction reagent, a method using a protein introduction domain (PTD) fusion protein, or a microinjection method.
[0091] The above (A) and (B) can be introduced into the cells simultaneously, sequentially or separately at certain time intervals. In some embodiments, the above (A) and (B) are introduced into the cells simultaneously.
[0092] <Other steps> In addition to the above-mentioned introduction step, the method of this embodiment may also include other steps, such as the step of introducing the donor vector into cells, the step of culturing cells, the step of measuring the expression level of the guide RNA, etc.
[0093] <<Donor vector introduction step>> When the RNA is a guide RNA, the transcriptional regulation method of the guide RNA may include the step of introducing a donor vector into a cell. The donor vector contains a nucleotide sequence adjacent to the target region as a homologous arm. The donor vector may contain a desired nucleotide sequence (hereinafter also referred to as "knock-in sequence") between the 5' homologous arm and the 3' homologous arm. The knock-in sequence is not particularly limited and can be any sequence. For example, the knock-in sequence can be a sequence for gene knockout, a sequence for introducing one or more mutations, or any gene sequence. When the knock-in sequence is any gene sequence, it is preferably set in a safe harbor region.
[0094] The donor vector can be a circular DNA vector (such as a plasmid vector) or a linear DNA vector. In addition to the homologous arms and the knock-in sequence, the donor vector may also contain other components. Examples of other components include components similar to the expression vectors described above.
[0095] The method of introducing the donor vector into the cell is not particularly limited and can be appropriately selected according to the target cell. For example, it can be a lipid transfection method, a microinjection method, a DEAE-dextran method, a gene gun method, an electroporation method, a calcium phosphate method, etc.
[0096] The donor vector can be introduced into the cell simultaneously with (A) and (B), or can be introduced sequentially, or can be introduced after a period of time after the introduction of (A) and (B). In some embodiments, the donor vector is introduced into the cell simultaneously with (A) and (B).
[0097] <<Cultivation process>> When RNA transcription occurs intracellularly, the transcriptional regulation method of RNA may include the step of introducing an RNA expression vector into a cell and then culturing the cell. When the transcriptional regulation method of RNA includes the step of introducing the above (A) and (B) into the cell, the transcriptional regulation method of RNA may include the step of introducing the above (A) and (B) and an optional donor vector into the cell and then culturing the cell. Cell culture can be carried out under appropriate culture conditions according to the cell type. When the RNA expression vector or one or more of the above (A), (B), and the donor vector contain a drug resistance marker, the culture can be carried out in the presence of a drug. Culturing in the presence of a drug can effectively screen out the cells into which the vector has been introduced. For example, cells can also be cloned by diluting the cell culture medium or inoculation.
[0098] <RNA expression level measurement step> The transcriptional regulation method of RNA may include the step of measuring RNA expression level. When the transcriptional regulation method of RNA includes the step of importing above-mentioned (A) and (B) into cells, the transcriptional regulation method of RNA may include the step of importing above-mentioned (A) and (B) and optional donor vector into cells, and then measuring the expression level of the guide RNA in the cells. The expression level of RNA can be measured by known methods, such as Northern blot analysis and quantitative reverse transcription PCR (RT-qPCR). The expression level of RNA is considered to reflect the transcription level of RNA. Therefore, the quantity and type of the nucleotide residues added can be adjusted according to the measured RNA expression level to achieve the required RNA transcription level.
[0099] According to the RNA transcription regulation method of this embodiment, the amount of RNA transcribed from the RNA expression vector can be regulated by a simple method of adjusting the number and type of added nucleotide residues.
[0100]
Methods for regulating target gene transcription
[0101] <Guide RNA> The guide RNA can be the same as described in the above-mentioned [RNA transcriptional regulation method]. In the target gene transcriptional regulation method, the guide RNA targets the transcriptional regulatory region of the target gene. The target sequence in the transcriptional regulatory region targeted by the guide RNA can be appropriately set according to the type of target gene. In some embodiments, the target sequence can be set within the range of -1000 to +300, for example, based on the target gene transcription start point (+1). If the transcriptional regulation-related domain can perform transcriptional regulation, the target sequence can be set outside the range of this region. The number and type of additional nucleotides contained in the guide RNA can be the same as described in the above-mentioned [RNA transcriptional regulation method].
[0102] In some embodiments, the target gene's transcriptional regulation method uses CRISPRa or CRISPRi. The effects of CRISPRa and CRISPRi can be controlled by adjusting the number and type of additional nucleotide residues contained in the guide RNA. Based on this, the transcription level of the target gene can be regulated.
[0103] For example, when using CRISPRa, the greater the number of additional nucleotide residues in the guide RNA, the greater the inhibition of CRISPRa's transcriptional activation. Therefore, by adjusting the number and type of additional nucleotide residues, CRISPRa's transcriptional activation can be precisely controlled. This allows for transcriptional regulation of target genes.
[0104] For example, when using CRISPRi, the more additional nucleotide residues in the guide RNA, the weaker the transcriptional inhibition effect of CRISPRi. Therefore, by adjusting the number and type of additional nucleotide residues, the transcriptional inhibition of CRISPRi can be precisely controlled, thereby achieving transcriptional regulation of the target gene.
[0105] For example, by increasing or decreasing the number of additional nucleotide residues in the guide RNA within the range of 0-50, 0-30, 0-25, 0-20, 0-15, or 0-10, transcriptional activation by CRISPRa or transcriptional repression by CRISPRi can be precisely regulated.
[0106] <Guide RNA Expression Vector> The expression vector for the guide RNA may be the RNA expression vector described in the above-mentioned [Method for regulating RNA transcription], but using the guide RNA as the RNA.
[0107] <RNA-guided nuclease with inactivated nuclease activity> As the RNA-guided nuclease with inactivated nuclease activity, it is preferred to use an RNA-guided nuclease with inactivated nuclease activity and without nickase activity. As the RNA-guided nuclease with inactivated nuclease activity, a Cas protein without nuclease activity can be used. As the Cas protein without nuclease activity, dCas is preferably used. As dCas, a wild-type Cas protein modified to have no nuclease activity and nickase activity can be used.
[0108] The dCas commonly used in CRISPRa or CRISPRi can be used without particular limitation. dCas can be derived from the Cas protein in type I to type VI CRISPR / Cas systems. In some embodiments, the Cas protein from which dCas is derived is a Cas protein in a type II or type V CRISPR / Cas system. In some embodiments, dCas can be a Cas9 protein (dCas9) lacking nuclease and nickase activity, or a Cas12 protein (dCas12a or dCpf1) lacking nuclease and nickase activity.
[0109] <Transcriptional regulation related domain> The transcriptional regulation-related domain can be any domain commonly used in CRISPRa or CRISPRi, and is not particularly limited thereto. In CRISPRa, a transcriptional activation-related domain is used as a transcriptional regulation-related domain. In CRISPRi, a transcriptional repression-related domain is used as a transcriptional regulation-related domain.
[0110] <Fusion protein containing a Cas protein without nuclease activity and a transcriptional regulation domain> In the fusion protein, the transcriptional regulation domain can be located at the N-terminus or C-terminus of the Cas protein that does not have nuclease activity. In addition to the Cas protein that does not have nuclease activity and the transcriptional regulation domain, the fusion protein can also contain other domains. Examples of other domains include nuclear localization signal domains.
[0111] <Fusion protein expression vector> A fusion protein expression vector is an expression vector that is capable of expressing a fusion protein after introduction into a cell. A fusion protein expression vector preferably comprises a coding sequence for the fusion protein (fusion protein coding sequence) and a promoter that controls the expression of the fusion protein coding sequence. In the fusion protein expression vector, the fusion protein coding sequence is operably linked to the promoter.
[0112] The expression vector for the fusion protein can be configured in the same manner as the RNA-guided nuclease expression vector described in the [RNA transcriptional regulation method] section above, except that it contains a fusion protein coding sequence instead of an RNA-guided nuclease coding sequence.
[0113] <Expression Vectors for Guide RNA and Fusion Proteins> When a fusion protein expression vector is used, the guide RNA expression vector and the fusion protein expression vector can be the same expression vector. In some embodiments, the expression vector is an expression vector capable of expressing a guide RNA and a fusion protein (hereinafter also referred to as a "guide RNA / fusion protein expression vector"). The guide RNA / fusion protein expression vector comprises a guide RNA coding sequence and a fusion protein coding sequence, each of which can be expressed. The guide RNA / fusion protein expression vector comprises a guide RNA coding sequence operably connected to a guide RNA promoter, and a fusion protein coding sequence operably connected to a fusion protein promoter. The guide RNA terminator can be connected to the 3' side of the guide RNA coding sequence. The fusion protein coding sequence terminator can be connected to the 3' side of the RNA-guided nuclease coding sequence.
[0114] Expression vectors for guide RNAs and fusion proteins can also include other components, such as those described above.
[0115] <Introduction steps> The method of this embodiment includes the step of introducing the following components into a cell: (A) a guide RNA selected from (a1) having one or more nucleotide residues added to the 5' end, and (a2) at least one expression vector of the guide RNA of (a1), and (B) at least one selected from a fusion protein comprising an RNA-guided nuclease with inactivated nuclease activity and a transcriptional regulation-related domain, mRNA of the fusion protein, and an expression vector of the fusion protein.
[0116] The introduction step can be performed in the same manner as the <Introduction Step> described in the above-mentioned [Method for RNA Transcriptional Regulation]. This step can be performed in vitro (invivo), ex vivo (exvivo), or in vivo (invivo).
[0117] <Other steps> In addition to the above-mentioned introduction step, the method of this embodiment may further include other steps, such as a step of culturing cells and a step of measuring the expression level of the target gene.
[0118] The step of culturing cells can be performed in the same manner as the <<Cultivation Process>> described in the above-mentioned [Method for RNA Transcriptional Regulation].
[0119] The step of measuring the target gene expression level can be carried out by introducing the above-mentioned (A) and (B) into the cell, and then measuring the expression level of the target gene in the cell. The expression level of the target gene in the cell can be measured by known methods, for example, Northern blot analysis and quantitative reverse transcription PCR (RT-qPCR) etc. The expression level of the target gene is considered to reflect the transcription level of the target gene. Therefore, the number and type of the added nucleotide residues can be adjusted according to the measured target gene expression level so that the target gene is transcribed at a desired level.
[0120] According to the target gene transcriptional regulation method of this embodiment, in a target gene transcriptional regulation system using an RNA-guided nuclease and a guide RNA, the transcription level of the target gene can be more precisely regulated by a simple method of regulating the number and type of added nucleotide residues. The target gene transcriptional regulation method of this embodiment can more precisely control the transcriptional regulation of the target gene, particularly in a system using CRISPRa or CRISPRi.
[0121] Genome editing methods The third aspect of this specification is a genome editing method, which includes the step of introducing the following components into cells: (A) at least one selected from (a1) a guide RNA having a repeat sequence at the 5'-end of the spacer sequence and having one or more nucleotide residues added at the 5'-end, and (a2) an expression vector of the guide RNA of the aforementioned (a1); and (B) at least one selected from an RNA-guided nuclease, the mRNA of the aforementioned RNA-guided nuclease, and the expression vector of the aforementioned RNA-guided nuclease.
[0122] <guide RNA> The guide RNA in the genome editing method of this example is a guide RNA having a repeat sequence on the 5'-side of the spacer sequence. Examples of such guide RNAs include the guide RNAs of type V CRISPR / Cas systems. In some embodiments, the guide RNA does not contain tracrRNA. In some embodiments, the spacer sequence contains a nucleotide sequence capable of binding to the complementary sequence of the target sequence adjacent to the 3'-side of the PAM. In some embodiments, the guide RNA is the guide RNA of Cas12a.
[0123] The guide RNA has an additional nucleotide residue at the 5'-end. The additional nucleotide residue is the same as that described in the above-mentioned
Method for Transcription Regulation of RNA
Method for Transcription Regulation of RNA
[0124] In the genome editing method of this example, the genome editing mode can be regulated by regulating the number and type of the added nucleotide residues. For example, the more the number of the added nucleotide residues, the greater the proportion of cells in which only one allele is genome-edited. For example, the genome editing mode can be precisely regulated by increasing or decreasing the number of the added nucleotide residues within the range of 3-50, 5-50, 5-40 or 5-30.
[0125] <guide RNA expression vector> Except for setting the coding sequence of the guide RNA as the coding sequence of the above-mentioned guide RNA, the guide RNA expression vector can adopt the same vector as the case where the guide RNA is used as the RNA in the RNA expression vector described in the above-mentioned
Method for Transcription Regulation of RNA
[0126] <RNA-guided nuclease> Examples of RNA-guided nucleases include Cas proteins. The Cas protein is not particularly limited as long as it can be used in the CRISPR / Cas system. The Cas protein can be a Cas protein used in type I-VI CRISPR / Cas systems. The Cas protein is not limited to a Cas protein having endonuclease activity, and can also have nickase activity or dCas. In some embodiments, the Cas protein is a Cas protein of a type V CRISPR / Cas system. In some embodiments, the Cas protein is a Cas12a protein.
[0127] The Cas protein can be the protein of (b1) or (b2) in the above-mentioned [Method for transcriptional regulation of RNA]. Examples of the wild-type Cas protein in (b1) or (b2) include Cas12a protein.
[0128] <Expression vector of RNA-guided nuclease>[ The expression vector of the RNA-guided nuclease can be the same as that described in the above-mentioned [Method for transcriptional regulation of RNA]. The expression vector of the RNA-guided nuclease is preferably an expression vector of a Cas protein.
[0129] <Expression vector of guide RNA and RNA-guided nuclease>[ When using an expression vector of an RNA-guided nuclease, the expression vector of the guide RNA and the expression vector of the RNA-guided nuclease can be the same expression vector. The expression vector of the guide RNA / RNA-guided nuclease can be the same as that described in the above "Method for transcriptional regulation of RNA", except that the RNA coding sequence is the coding sequence of the guide RNA.
[0130] <Import step>[ The genome editing method of this embodiment includes the step of introducing the following components into cells: (A) at least one selected from (a1) a guide RNA having a repeat sequence at the 5' end of the spacer sequence and having one or more nucleotide residues added at the 5' end, and (a2) an expression vector of the guide RNA of the foregoing (a1); and (B) at least one selected from an RNA-guided nuclease, the mRNA of the foregoing RNA-guided nuclease, and the expression vector of the foregoing RNA-guided nuclease.
[0131] The import step can be carried out in the same manner as the <Import step> described in the above-mentioned [Method for transcriptional regulation of RNA]. This step can be carried out in vitro, ex vivo or in vivo.
[0132] <Other steps>[ In addition to the above import step, the genome editing method of this embodiment can also include other steps, such as the step of introducing a donor vector into cells, the step of culturing cells, the step of analyzing the genome editing pattern, etc.
[0133] The donor vector used may be the same as that used in the <<Donor vector introduction step>> described in the above-mentioned [RNA transcription regulation method]. The step of introducing the donor vector into cells can be performed in the same manner as the <<Donor vector introduction step>> described in the above-mentioned [RNA transcription regulation method].
[0134] The step of culturing cells can be performed in the same manner as in the <<Cultivation Step>> described in the above-mentioned [Method for RNA Transcription Regulation].
[0135] The genome editing pattern analysis step can be performed after the introduction step using a known genome editing pattern analysis method, for example, a method of inoculating a cell culture solution after an appropriate culture step, extracting DNA from the resulting colonies, and analyzing the sequence of the target region.
[0136] According to the genome editing method of this embodiment, in the genome editing method using a guide RNA having a repeat sequence on the 5' side of the spacer sequence, the genome editing pattern can be precisely controlled by a simple method of regulating the number and type of added nucleotide residues. In addition, the genome editing method of this embodiment can also be expected to have an off-target inhibitory effect.
[0137] Base editing method The fourth aspect of the present specification is a base editing method, which includes the steps of introducing the following components into a cell: (A) a guide RNA selected from (a1) that regulates at least one of (1) the addition of 5'-terminal nucleotide residues, (2) the length of the spacer sequence, and (3) the introduction of mismatched nucleotide residues in the spacer sequence, and (a2) at least one expression vector of the guide RNA of the aforementioned (a1); and (B) at least one selected from a base editor, the mRNA of the aforementioned base editor, and the expression vector of the aforementioned base editor.
[0138] <Guide RNA> The guide RNA used is an RNA that adjusts one or more of the following: (1) the addition of additional nucleotide residues to the 5' end, (2) the length of the spacer sequence, and (3) the introduction of mismatched nucleotide residues in the spacer sequence.
[0139] In some embodiments, the base editing method uses a base editor that utilizes the CRISPR / Cas system. The activity window of the base editor can be controlled by adjusting any one or more of (1) to (3) in the guide RNA. In some embodiments, the target sequence of the guide RNA is set to a region containing the nucleotide residues to be base edited by the base editor (hereinafter also referred to as "target nucleotide residues"), or a region adjacent to the target nucleotide residue (e.g., close to the 3' side). The target sequence is preferably designed so that the target nucleotide residue falls within the activity window of the base editor.
[0140] <<(1) Adding nucleotide residues to the 5' end>> The activity window of base editors can be controlled by adding nucleotide residues to the 5' end of the guide RNA. The number and types of nucleotide residues added to the guide RNA can be the same as those listed above in "RNA Transcriptional Control Methods." When the base editor contains nCas, the nucleotide residues added to the guide RNA are added to the 5' end of the crRNA.
[0141] For example, the more nucleotide residues are added, the narrower the activity window of the base editor tends to be. For example, when trying to narrow the activity window of the base editor, the number of nucleotide residues added can be set to 3 or more, 4 or more, 5 or more, 10 or more, 15 or more, or 20 or more. For example, the upper limit of the number of nucleotide residues added can be 50 or less, preferably 40 or less, more preferably 35 or less, and even more preferably 30 or less. The upper and lower limits can be arbitrarily combined. When trying to narrow the activity window of the base editor, the range of the number of nucleotide residues added can be, for example, 3 to 50, 5 to 40, 5 to 35, 5 to 30, 10 to 30, 15 to 30, etc.
[0142] The type of nucleotide residue added can be any one of an adenine nucleotide residue (A), a uracil nucleotide residue (U), a guanine nucleotide residue (G) and a cytosine nucleotide residue (C), or a combination of two or more thereof. The added nucleotide residues may include a continuous nucleotide residue region of the same type (continuous region; [nN]). When trying to narrow the activity window of the base editor, the added nucleotide residues preferably include [nN]. [nN] can be any one of [nC], [nU] (or [nT]), [nG] and [nA], with [nC] being preferred. The value of n in [nN] is upper limited to the total number of nucleotide residues added, for example, 2 or more, 3 or more, 4 or more, 5 or more, 10 or more, 15 or more, 20 or more and 25 or more. The ratio of the continuous region to all added nucleotide residues includes, for example, 10-100%, 20-100%, 30-100%, 40-100%, 50-100%, 60-100%, 70-100%, 80-100%, 90-100%, etc.
[0143] The added nucleotide residues also have the effect of shifting the base editor's active window to the 3' or 5' side relative to the nucleic acid chain containing the target sequence. When the base editor's active window is shifted to the 3' side relative to the nucleic acid chain containing the target sequence, the number of added nucleotide residues can be, for example, 3 or more, 4 or more, 5 or more, 10 or more, 15 or more, 20 or more, or 25 or more, or, for example, 50 or less, 40 or less, or 30 or less. The above upper and lower limits can be arbitrarily combined. When the base editor's active window is moved to the 3' side of the target sequence, the number of added nucleotide residues can range from, for example, 3 to 50, 5 to 40, 5 to 35, 5 to 30, 10 to 30, 15 to 30, 20 to 30, or 25 to 30, preferably 15 to 30, and more preferably 20 to 30. By adjusting the number and type of added nucleotide residues, the base editor's active window can also be shifted to the 5' side relative to the nucleic acid chain containing the target sequence.
[0144] When the active window of the base editor moves to the 3' side, [nN] can be added to the 5' end, and additional nucleotide residues can be added to the 5' end of [nN]. The type of nucleotide residue added to the 5' end of [nN] can be any one of an adenine nucleotide residue (A), a uracil nucleotide residue (U), a guanine nucleotide residue (G), and a cytosine nucleotide residue (C), or a combination of two or more thereof. The number of nucleotide residues added to the 5' end of [nN] can be, for example, more than 1, more than 2, or more than 3, or less than 20, less than 15, less than 10, or less than 5. The above upper and lower limits can be arbitrarily combined. The number of nucleotide residues added to the 5' end of [nN] can be, for example, 1 to 20, 1 to 15, 1 to 10, 1 to 9, 1 to 8, 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, or 1 to 2. Hereinafter, the nucleotide residues added to the 5' end of [nN] may be represented by [nX]. n is the number of nucleotide residues. X is any nucleotide residue. When n is 2 or greater, two or more Xs may be the same or different. In some embodiments, the added nucleotide residues comprise a nucleotide sequence represented by [nX][nN].
[0145] Specific examples of [nX] include one selected from the group consisting of CUU (or CTT), AGC, and CGG. Specific examples of [nX][nN] include CUU[nN], AGC[nN], and CGG[nN]. [nN] can be any one of [nC], [nU] (or [nT]), [nG], and [nA], preferably [nC]. Examples of the value of n for [nN] in [nX][nN] include 5 to 50, 5 to 30, 5 to 20, 10 to 50, 10 to 30, 10 to 20, 15 to 50, 15 to 30, 15 to 20, 20 to 50, and 20 to 30.
[0146] <<(2) Length of the spacer sequence>> The activity window of a base editor can be controlled by adjusting the length of the guide RNA's spacer sequence. For example, increasing the length of the spacer sequence can expand the base editor's activity window toward the 5' side relative to the nucleic acid chain containing the target sequence. For example, reducing the length of the spacer sequence can shift the base editor's activity window toward the 3' side relative to the nucleic acid chain containing the target sequence. Alternatively, reducing the length of the spacer sequence can narrow the base editor's activity window.
[0147] The length of the spacer sequence can be adjusted, for example, within the range of 15 to 50 nucleotide residues, or can be adjusted to within the range of 17 to 50 nucleotide residues, 17 to 40 nucleotide residues, or 17 to 30 nucleotide residues.
[0148] <<(3) Introduction of mismatched nucleotide residues in the spacer sequence>> By introducing mismatched nucleotide residues in the spacer sequence of the guide RNA, the activity window of the base editor can be controlled. For example, if there are nucleotide residues in the target region that should be avoided from base editing (hereinafter also referred to as "non-target nucleotide residues"), the nucleotide residues corresponding to the non-target nucleotide residues (hereinafter also referred to as "non-target corresponding nucleotide residues") can be set as mismatched nucleotide residues in the spacer sequence. This can inhibit base editing of non-target nucleotide residues by the base editor.
[0149] For example, when the nucleotide residues of the spacer sequence are numbered from the 3' end to the 5' end of the spacer sequence, the mismatched nucleotide residue is preferably introduced into a position closer to the 5' end of the 15th nucleotide residue from the 3' end. This can inhibit base editing of non-target nucleotide residues while avoiding a decrease in the base editing activity of the base editor on the target nucleotide residue. For example, the mismatched nucleotide residue is preferably introduced into a position closer to the 5' end of the 16th, 17th, 18th, 19th or 20th nucleotide residue from the 3' end of the spacer sequence.
[0150] In some embodiments, the nucleotide residues of mispairing are introduced into the nucleotide residues beyond the non-target corresponding nucleotide residues.For example, the nucleotide residues around the non-target corresponding nucleotide residues can be the nucleotide residues of mispairing.For example, the nucleotide residues of mispairing can be introduced into one or more nucleotide residues within three nucleotide residues of the non-target corresponding nucleotide residues.In some embodiments, the nucleotide residues of mispairing are introduced into one or two nucleotide residues adjacent to the non-target corresponding nucleotide residues.In some embodiments, the nucleotide residues of mispairing are introduced into one or more nucleotide residues within three nucleotide residues of the non-target corresponding nucleotide residues.In some embodiments, the nucleotide residues of mispairing are introduced into non-target corresponding nucleotide residues and one or two nucleotide residues adjacent to the non-target corresponding nucleotide residues.
[0151] The number of mismatched nucleotide residues can be 0 to 3. By setting the number of mismatched nucleotide residues to 3 or less, preferably 2 or less, base editing in off-target regions can be suppressed. The number of mismatched nucleotide residues is preferably 0 to 2, and can also be 0 to 1.
[0152] By adjusting one or more of the above (1) to (3), the width and / or position of the base editor activity window can be controlled. Any one of the above (1) to (3) can be adjusted individually, or any two or more of the above (1) to (3) can be adjusted.
[0153] <Guide RNA Expression Vector> The guide RNA expression vector can be the same as described in the above-mentioned [Methods for Transcriptional Regulation of Guide RNA].
[0154] <Base Editing> Any known base editor can be used without any particular limitation. Examples of base editors include adenine base editors (converting adenine to guanine or inosine; ABE, ABE8e, etc.), cytosine base editors (converting cytosine to thymine; Target-AID, BE4max, etc.), and adenine transversion editors (converting adenine to cytosine; alkyladenine DNA glycosylase / nCas9 / deaminase TadA-8e), etc.
[0155] <Base Editor Expression Vector> The expression vector of the base editor is an expression vector that can express the base editor after being introduced into the cell. The expression vector of the base editor preferably comprises a coding sequence of the base editor (base editor coding sequence) and a promoter that controls the expression of the base editor coding sequence. In the expression vector of the base editor, the base editor coding sequence is operably connected to the promoter.
[0156] The expression vector for the base editor can be configured in the same manner as the RNA-guided nuclease expression vector described in the [RNA transcriptional regulation method] section above, except that it contains a base editor coding sequence instead of an RNA-guided nuclease coding sequence.
[0157] <Expression vectors for guide RNA and base editors> When using an expression vector of a base editor, the expression vector of the guide RNA and the expression vector of the base editor can be the same expression vector. In some embodiments, the expression vector is an expression vector capable of expressing a guide RNA and a base editor (hereinafter also referred to as "an expression vector of a guide RNA / base editor"). The expression vector of the guide RNA / base editor comprises a guide RNA coding sequence and a base editor coding sequence, each of which can be expressed. The expression vector of the guide RNA / base editor comprises a guide RNA coding sequence operably connected to a guide RNA promoter, and a base editor coding sequence operably connected to a base editor promoter. The guide RNA terminator can be connected to the 3' side of the guide RNA coding sequence. The base editor coding sequence terminator can be connected to the 3' side of the base editor coding sequence.
[0158] Expression vectors for guide RNAs and base editors can also include other components, including those described above.
[0159] <Introduction steps> The method of this embodiment includes the steps of introducing the following components into a cell: (A) one or more regulated guide RNAs selected from (a1) above to (3), and (a2) at least one of the guide RNA expression vectors of (a1) above; and (B) at least one selected from a base editor, the mRNA of the aforementioned base editor, and the expression vector of the aforementioned base editor.
[0160] The introduction step can be performed in the same manner as the <Introduction Step> described in the [Method for RNA Transcriptional Regulation] above. This step can be performed in vitro, ex vivo, or in vivo.
[0161] <Other steps> In addition to the above-mentioned introduction step, the method of this embodiment may further include other steps, for example, a step of culturing cells and a step of performing sequence analysis on a region containing the target sequence.
[0162] The step of culturing cells can be performed in the same manner as in the <<Cultivation Step>> described in the above-mentioned [Method for RNA Transcription Regulation].
[0163] The step of analyzing the sequence of the region where the target sequence is located can be performed by introducing the above (A) and (B) into cells and then analyzing the sequence of the region where the target sequence is located in the cells. Sequence analysis can be performed by known methods such as Sanger sequencing and next-generation sequencing. The activity window of the base editor can be estimated based on the sequence analysis results. Therefore, the guide RNA can be redesigned by adjusting the above (1) to (3) so that the activity window of the base editor has the desired width and position.
[0164] According to the base editing method of this embodiment, the activity window of the base editor can be controlled by a simple method of adjusting one or more of (1) to (3) in the guide RNA, thereby achieving more precise base editing.
[0165]
Guide RNA, vector, kit
[0166] The sixth aspect of the present specification is a base editing kit. The base editing kit comprises: (A) a guide RNA selected from (a1) that regulates at least one of (1) the addition of a 5'-terminal nucleotide residue, (2) the length of a spacer sequence, and (3) the introduction of a mismatched nucleotide residue in a spacer sequence, and (a2) at least one expression vector of the guide RNA of (a1); and (B) at least one selected from a base editor, an mRNA of the base editor, and an expression vector of the base editor. In the base editing kit according to the sixth aspect, the guide RNA, the expression vector for the guide RNA, the base editor, and the expression vector for the base editor are the same as those described above in the [Base Editing Method]. The base editor preferably uses nCas. When the guide RNA is a guide RNA for the CRISPR / Cas system, additional nucleotide residues are added to the 5' end of the crRNA.
[0167] The seventh aspect of the present specification is an expression vector capable of expressing (A) a guide RNA with one or more nucleotide residues added to the 5' end, and (B) a fusion protein comprising an RNA-guided nuclease with inactivated nuclease activity and a protein involved in transcriptional regulation. The expression vector of the seventh aspect is the same as the expression vector for the guide RNA / fusion protein described above in the [Method for Transcriptional Regulation of a Target Gene]. Examples of RNA-guided nucleases with inactivated nuclease activity include Cas proteins that do not have nuclease activity, preferably dCas. When the guide RNA is a guide RNA for a CRISPR / Cas system, additional nucleotide residues are added to the 5' end of the crRNA.
[0168] The eighth aspect of the present specification is an expression vector capable of expressing (A) a guide RNA having one or more nucleotide residues added to its 5' end, and (B) a base editor. The expression vector according to the eighth aspect is the same as the expression vector for the guide RNA / base editor described above in the [Base Editing Method]. The base editor preferably uses nCas. When the guide RNA is a guide RNA for the CRISPR / Cas system, additional nucleotide residues are added to the 5' end of the crRNA.
[0169] The ninth aspect of the present specification is a guide RNA having a repeat sequence at the 5' end of the spacer sequence, and one or more nucleotide residues are added to the 5' end. The guide RNA according to the ninth aspect is the same as the guide RNA described above in the [Genome Editing Method]. When the guide RNA is a guide RNA for a CRISPR / Cas system, additional nucleotide residues are added to the 5' end of the crRNA.
[0170] The tenth aspect of this specification is an expression vector capable of expressing the guide RNA according to the ninth aspect. The expression vector described in the tenth aspect is the same as the guide RNA expression vector described in the above-mentioned [Genome Editing Method]. The expression vector described in the tenth aspect can be the guide RNA / RNA-guided nuclease expression vector described in the above-mentioned [Genome Editing Method], or can be the guide RNA / Cas protein expression vector.
[0171] The eleventh aspect of the present specification is a genome editing kit comprising: (A) a guide RNA selected from (a1) having a repetitive sequence at the 5' end of the spacer sequence and one or more nucleotide residues added to the 5' end, and (a2) at least one expression vector of the guide RNA of the aforementioned (a1); and (B) at least one selected from an RNA-guided nuclease, an mRNA of the aforementioned RNA-guided nuclease, and an expression vector of the aforementioned RNA-guided nuclease. In the genome editing kit according to the eleventh aspect, the guide RNA, the guide RNA expression vector, the RNA-guided nuclease, and the RNA-guided nuclease expression vector are the same as those described in the above-mentioned [Genome Editing Method]. The RNA-guided nuclease can be a Cas protein of a V-type CRISPR / Cas system, preferably a Cas12a protein. When the guide RNA is a guide RNA of a CRISPR / Cas system, additional nucleotide residues are added to the 5' end of the crRNA. The guide RNA can be a guide RNA of a V-type CRISPR / Cas system, preferably a guide RNA of a Cas12a protein.
[0172] The target gene transcription regulation kit according to the fifth aspect, the base editing kit according to the sixth aspect, and the genome editing kit according to the eleventh aspect may contain other components. Other components are not particularly limited, for example, instructions for use, reagents for introducing components (A) and / or (B) into cells, etc.
[0173] [Pharmaceutical composition, treatment or prevention method] The twelfth aspect of the present specification is a pharmaceutical composition comprising: (A) at least one selected from the group consisting of (a1) a guide RNA having one or more nucleotide residues added to the 5' end and (a2) an expression vector for the guide RNA of the aforementioned (a1); and (B) at least one selected from the group consisting of a fusion protein comprising an RNA-guided nuclease with inactivated nuclease activity and a transcriptional regulation-related domain, the mRNA of the aforementioned fusion protein, and an expression vector for the aforementioned fusion protein. In the pharmaceutical composition according to the twelfth aspect, the guide RNA, the expression vector for the guide RNA, the fusion protein, and the expression vector for the fusion protein are the same as those described above in the [Method for Transcriptional Regulation of a Target Gene]. Examples of RNA-guided nucleases with inactivated nuclease activity include Cas proteins that do not have nuclease activity, preferably dCas. When the guide RNA is a guide RNA for a CRISPR / Cas system, additional nucleotide residues are added to the 5' end of the crRNA. The pharmaceutical composition according to the twelfth aspect can be used to treat or prevent diseases caused by abnormal expression (overexpression or underexpression) of specific genes.
[0174] The thirteenth aspect of the present specification is a pharmaceutical composition comprising: (A) at least one guide RNA selected from (a1) having a repeat sequence on the 5' side of the spacer sequence and one or more nucleotide residues added to the 5' end, and (a2) an expression vector for the guide RNA of the aforementioned (a1). The guide RNA and its expression vector in the pharmaceutical composition according to the thirteenth aspect are the same as those described in the above-mentioned [Genome Editing Method]. The pharmaceutical composition according to the thirteenth aspect may also include at least one selected from (B) RNA-guided nuclease, the mRNA of the aforementioned RNA-guided nuclease, and the expression vector of the aforementioned RNA-guided nuclease. The aforementioned RNA-guided nuclease and its expression vector are the same as those described in the above-mentioned [Genome Editing Method]. The aforementioned RNA-guided nuclease includes the Cas protein of the V-type CRISPR / Cas system, preferably the Cas12a protein. When the guide RNA is the guide RNA of the CRISPR / Cas system, additional nucleotide residues are added to the 5' end of the crRNA. The guide RNA includes the guide RNA of the V-type CRISPR / Cas system, preferably the guide RNA of the Cas12a protein. The pharmaceutical composition according to the thirteenth aspect can be used to treat or prevent genetic diseases, etc. Examples of genetic diseases include, but are not limited to, cancer, sickle cell disease, Huntington's disease, Duchenne muscular dystrophy, fibrodysplasia ossificans progressiva (FOP), and hereditary hypertyrosinemia type 1 (HT-1).
[0175] The fourteenth aspect of the present specification is a pharmaceutical composition comprising: (A) a guide RNA selected from (a1) that regulates at least one of (1) the addition of 5'-terminal nucleotide residues, (2) the length of the spacer sequence, and (3) the introduction of mismatched nucleotide residues in the spacer sequence, and (a2) at least one expression vector of the guide RNA of the aforementioned (a1); and (B) at least one selected from a base editor, the mRNA of the aforementioned base editor, and the expression vector of the aforementioned base editor. The guide RNA, guide RNA expression vector, base editor, and base editor expression vector in the pharmaceutical composition according to the fourteenth aspect are the same as those described above in the [Base Editing Method]. The base editor preferably uses nCas. When the guide RNA is a guide RNA for a CRISPR / Cas system, additional nucleotide residues are added to the 5' end of the crRNA. The pharmaceutical composition according to the fourteenth aspect can be used to treat or prevent genetic diseases caused by SNPs, including but not limited to cancer, sickle cell disease, Huntington's disease, Duchenne muscular dystrophy, fibrodysplasia ossificans progressiva (FOP), and hereditary hypertyrosinemia type 1 (HT-1), etc.
[0176] The pharmaceutical composition according to aspects 12 to 14 may further comprise other ingredients in addition to the above-mentioned ingredients. Examples of other ingredients include pharmaceutically acceptable carriers. The pharmaceutical composition may be formulated by mixing it with a pharmaceutically acceptable carrier. Examples of pharmaceutically acceptable carriers include excipients, binders, disintegrants, lubricants, colorants, flavorings, stabilizers, emulsifiers, absorption enhancers, surfactants, pH regulators, preservatives, and antioxidants.
[0177] The route of administration of the pharmaceutical composition is not particularly limited and can be administered orally or parenterally. Examples of parenterally administered routes include intravenous injection, intravenous drip, subcutaneous injection, intradermal injection, and intraperitoneal injection. The dosage of the pharmaceutical composition can be appropriately determined based on the type of disease, disease symptoms, age, sex, weight, susceptibility of the subject, method of administration, timing of administration, dosing interval, dosing cycle, properties of the formulation, type of active ingredient, etc.
[0178] The fifteenth aspect of the present specification is a method for treating or preventing a disease caused by abnormal gene expression, which comprises administering to a subject in need of treatment or prevention: (A) at least one selected from (a1) a guide RNA having one or more nucleotide residues added to the 5' end and (a2) an expression vector for the guide RNA of the aforementioned (a1); and (B) at least one selected from a fusion protein comprising an RNA-guided nuclease with inactivated nuclease activity and a transcriptional regulation-related domain, the mRNA of the aforementioned fusion protein, and an expression vector for the aforementioned fusion protein. In the treatment or prevention method according to the fifteenth aspect, the guide RNA, guide RNA expression vector, fusion protein and fusion protein expression vector are the same as those described above in the [method for transcriptional regulation of target genes]. Examples of RNA-guided nucleases with inactivated nuclease activity include Cas proteins that do not have nuclease activity, preferably dCas. When the guide RNA is a guide RNA for a CRISPR / Cas system, additional nucleotide residues are added to the 5' end of the crRNA. The aforementioned (A) and (B) can be administered simultaneously or separately.
[0179] The sixteenth aspect of the present specification is a method for treating or preventing a genetic disease, comprising administering to a subject in need of treatment or prevention: (A) a guide RNA selected from (a1) having a repeat sequence at the 5' end of a spacer sequence and one or more nucleotide residues added to the 5' end, and (a2) at least one expression vector of the guide RNA of the aforementioned (a1); and (B) at least one selected from an RNA-guided nuclease, an mRNA of the aforementioned RNA-guided nuclease, and an expression vector of the aforementioned RNA-guided nuclease. In the treatment or prevention method according to the sixteenth aspect, the guide RNA, the guide RNA expression vector, the RNA-guided nuclease, and the RNA-guided nuclease expression vector are the same as those described above in the [Genome Editing Method]. Examples of RNA-guided nucleases include Cas proteins of V-type CRISPR / Cas systems, preferably Cas12a proteins. When the guide RNA is a guide RNA of a CRISPR / Cas system, additional nucleotide residues are added to the 5' end of the crRNA. Examples of guide RNA include guide RNAs of V-type CRISPR / Cas systems, preferably guide RNAs of Cas12a proteins. (A) and (B) can be administered simultaneously or separately.
[0180] The seventeenth aspect of the present specification is a method for treating or preventing a genetic disease, comprising administering to a subject in need of treatment or prevention: (A) a guide RNA selected from (a1) that regulates at least one of (1) the addition of 5'-terminal nucleotide residues, (2) the length of the spacer sequence, and (3) the introduction of mismatched nucleotide residues in the spacer sequence, and (a2) at least one expression vector of the guide RNA of the aforementioned (a1); and (B) at least one selected from a base editor and an expression vector thereof. In the treatment or prevention method according to the seventeenth aspect, the guide RNA, guide RNA expression vector, base editor, and base editor expression vector are the same as those described above in the [Base Editing Method]. The base editor preferably uses nCas. When the guide RNA is a guide RNA of the CRISPR / Cas system, additional nucleotide residues are added to the 5' end of the crRNA. (A) and (B) can be administered simultaneously or separately.
[0181] In the treatment or prevention methods according to the fifteenth to seventeenth aspects above, the dosage of components (A) and (B) may be a therapeutically effective amount. A therapeutically effective amount refers to a dosage that can exert a therapeutic or preventive effect. A therapeutically effective amount can be appropriately determined based on the type of disease, disease symptoms, age, sex, weight and susceptibility of the subject, method of administration, timing of administration, dosing interval, dosing cycle, properties of the formulation and the type of active ingredient. [Example]
[0182] The present invention will be described in more detail below with reference to the embodiments, but the present invention is not limited to these embodiments.
[0183] In the following experimental examples, the nucleotide residues added to the guide RNA are referred to as "additional nucleotide residues". The additional nucleotide residues added to the 5' end of the spacer sequence are referred to as "5' additional nucleotide residues". For example, Figure 1 In the sequence, the nucleotide residues represented by "NNN---NNN" are additional nucleotide residues.
[0184] When the additional nucleotide residues are composed of the same nucleotide residues, the additional nucleotide residues are indicated by adding the number of nucleotide residues to the left of the abbreviation indicating the type of nucleotide residues constituting the additional nucleotide residues. Figure 1 In the sgRNA shown, the additional nucleotide residues consist of 15 cytosine nucleotide residues. In this case, the additional nucleotide residues are represented as [15C]. Unless otherwise specified, [nN]gRNA refers to a gRNA having additional nucleotide residues consisting of n N nucleotide residues at the 5' end of the spacer sequence. N represents any type of nucleotide residue, which can be an adenine residue (A), a guanine residue (G), a cytosine residue (C), or a thymine residue (T). The brackets [] and / or the term "gRNA" can be omitted.
[0185] The symbol [N] represents an additional nucleotide residue consisting of N nucleotide residues of any length, where N represents any type of nucleotide residue, for example, an adenine residue (A), a guanine residue (G), a cytosine residue (C) or a thymine residue (T).
[0186] The nucleotide residues that make up the gRNA target sequence can be represented by adding numbers starting from the 5' side according to the type of base. Figure 11 In the target sequence shown, "A5" indicates the fifth adenine residue from the 5' side of the target sequence. "A6" indicates the sixth adenine residue from the 5' side of the target sequence. "A9" indicates the ninth adenine residue from the 5' side of the target sequence.
[0187] <Example 1> (Cultivation of Mouse Embryonic Stem Cells) Mouse embryonic stem cells (mESCs) were cultured in 2 iL of Dulbecco's modified Eagle's medium (DMEM, Nacalai Tesque), 2 mM Glutamax (Nacalai Tesque), 1× nonessential amino acids (Nacalai Tesque), 1 mM sodium pyruvate (Nacalai Tesque), 100 U / mL penicillin, 100 μg / mL streptomycin (P / S) (Nacalai Tesque), 0.1 mM 2-mercaptoethanol (Sigma), and 15% fetal bovine serum (FBS) (Gibco). The cells were supplemented with 0.2 μM PD0325901 (Sigma), 3 μM CHIR99021 (Cayman), and 1000 U / mL recombinant mouse leukemia inhibitory factor (LIF) (Millipore). 1 μM PD0325901 was used in 2 iL of culture medium. mESC colonies were dissociated with trypsin (Nacalai Tesque) and seeded on gelatin-coated culture dishes. Y-27632 (10 μM, Sigma) was added during cell passaging.
[0188] (Plasmid Construction) To construct integrated CRISPR plasmids for expressing [5C](3A), [10C](8A), [15C](13A), [20C](18C), [25C](23A), and [30C](28A), each spacer linker was inserted into the BpiI site of the PX459 plasmid. In this plasmid, cytosine at positions 3, 8, 13, 18, 23, or 28 was replaced with adenine, as the CACC overhang sequence is required for linker ligation. A standard spacer linker (20 nt) was inserted into the BpiI site of the [0C], [5C](3A), [10C](8A), [15C](13A), [20C](18A), [25C](23A), or [30C](28A) PX459 plasmid, or a long spacer linker (30 nt or 40 nt) was inserted into the BpiI site of the PX459 plasmid to create an integrated Cas9 plasmid expressing [5C] to [30C] sgRNAs, which can be used for puromycin selection.
[0189] (Northern blot hybridization) Total RNA was extracted from mESCs 68 hours after transfection with the P2A1-[C]sgRNA1-PX459 plasmid. Transfected cells were selected with puromycin (1.5 μg / mL) for 2 days and resuspended in ISOGEN II (NIPPON GENE). Samples were incubated at room temperature for 10 minutes and then heated at 55°C for 10 minutes. Total RNA was extracted according to the manufacturer's instructions. After incubation at 70°C for 10 minutes, 30 μg of RNA was loaded onto Extra PAGE One Precast Gels (5-20%) (Nacalai Tesque) in Tris-borate-EDTA buffer. RNA was transferred to a Hybond N+ membrane (GE Healthcare) and cross-linked using a CX-2000 (Analytik Jena). The sgRNA tracer probe was labeled with alkaline-labeled digoxigenin (DIG)-11-deoxyuridine triphosphate (dUTP) using a PCR DIG Probe Synthesis Kit (Roche). After hybridization, specific bands were visualized using CDP-Star reagent (Roche) and a luminescent image analyzer (LAS-3000, FUJIFILM). The DIG probe was labeled by PCR amplification of DNA fragments. The mU6 DIG probe was prepared by amplifying DNA fragments from mESC cDNA using specific primers. cDNA was synthesized using specific primers for U6 snRNA (Ranganathan, V., Wahlin, K., Maruotti, J. & Zack, DJ Nat Commun 5, 4516, doi: 10.1038 / ncomms5516 (2014).).
[0190] (Measurement of sgRNA expression levels) The effect of the number of nucleotide residues added to the 5' end on sgRNA expression levels was investigated. Cas9 plasmids expressing sgRNAs ranging from [0C] to [30C] were transfected into mouse embryonic stem cells. Sixty-eight hours after transfection, total RNA was extracted from each mESC, and sgRNA expression levels were analyzed by Northern blotting.
[0191] The results are as follows Figure 3 As shown in the figure, the expression level of sgRNA decreases with the increase of the number of nucleotide residues added to the 5' end. The asterisk in the figure indicates the sgRNA with nucleotide residues added to the 5' end, and "trim" indicates the sgRNA after the nucleotide residues added to the 5' end are trimmed.
[0192] Figure 4 Yes Figure 3 Results from Northern blot analysis of the sgRNA signal were quantified. The results demonstrated that the logarithm of sgRNA expression levels was negatively correlated with the number of nucleotide residues added to the 5' end. These results confirm that sgRNA expression levels can be regulated by the number of nucleotide residues added to the 5' end.
[0193] <Example 2> (HEK293T cell culture) HEK293T cells were cultured in a 10% FBS-containing medium consisting of DMEM, 2 mM L-glutamine (Nacalai Tesque), 100 U / mL penicillin, 100 μg / mL streptomycin (P / S) (Nacalai Tesque), and 10% FBS. HEK293T cells were cultured at 37°C in a 5% CO2 atmosphere.
[0194] (Measurement of sgRNA expression levels) The effect of the type of nucleotide residue added to the 5' end on sgRNA expression levels was investigated. Cas9 plasmids expressing the sgRNAs [15G], [25G], [15A], [25A], [15T], [15hp], and [15s] were constructed. [15hp] is an sgRNA with 15 nucleotide residues added to the 5' end, forming a hairpin structure. [15s] is an sgRNA with 15 nucleotide residues added to the 5' end, forming a non-hairpin structure. Cas9 plasmids expressing the sgRNAs [0C]-[30C], [15G], [25G], [15A], [25A], [15T], [15hp], and [15s] were transfected into HEK293 cells. Sixty-four hours after transfection, total RNA was extracted from each HEK293 cell line, and sgRNA expression levels were analyzed by Northern blot analysis.
[0195] The results are as follows Figure 5 As shown in Figure 3, sgRNA expression levels decreased with increasing numbers of nucleotide residues added to the 5' end. Among [C], [A], [G], and [T], [C] had the strongest inhibitory effect on sgRNA expression. This inhibitory effect on gRNA expression was also confirmed at 15 hp. These results confirm that sgRNA expression levels can be consistently regulated by the number of nucleotide residues added to the 5' end, regardless of the type of nucleotide residue.
[0196] Regulating RNA expression can reduce excess gRNA (which may be toxic) in cells, thereby achieving safe genome editing. Regulating gRNA expression can control the genome editing activity of RNA-guided nucleases. Regulating gRNA expression can inhibit off-target genome editing by RNA-guided nucleases. Regulating gRNA expression can inhibit base editors from inducing unwanted mutations (e.g., bystander mutations), thereby achieving safe medical applications.
[0197] It was demonstrated that in addition to conventional regulation of RNA expression by regulating the promoter, RNA expression can also be regulated by regulating the length of added nucleotide residues.
[0198] <Example 3> (Construction of CRISPRa Plasmid) A puromycin-selective integrated plasmid for CRISPRa was constructed by replacing the GFP expression cassette in the pLV hU6-gRNA (antisense) hUbC-VP64-dCas9-VP64-T2A-GFP (sgRNA-VP64-GFP) plasmid (Addgene #66707) with a puromycin N-acetyltransferase (PuroR) expression cassette. The synthetic gene encoding VP64-T2A-PuroR (AZENTA) was inserted into the sgRNA-KRAB-GFP plasmid using the NheI and AgeI sites to obtain the sgRNA-VP64-Puro plasmid. Figure 6 In the sgRNA-VP64-Puro plasmid, the spacer linker of [1C] to [10C] targeting ASCL1 (Chavez, A. et al. Nat Methods 13, 563-1240 567, doi: 10.1038 / nmeth.3871 (2016).) was inserted. Figure 7 In this study, a [0C] to [30C] spacer linker targeting ASCL1 and TTN (Chavez, A. et al. Nat Methods 13, 563-1240 567, doi: 10.1038 / nmeth.3871(2016)) was inserted into the BpiI site of the sgRNA expression plasmid. This was then co-transfected with a spacer-free integrated CRISPRa plasmid.
[0199] (qRT-PCR) cDNA was synthesized from total RNA using SuperScript III Reverse Transcriptase (Thermo Fisher Scientific) according to the manufacturer's instructions. qRT-PCR was performed using THUNDERBIRD (registered trademark) SYBR qPCR Mix (Toyobo) and the CFX Connect Real-Time PCR Detection System (Bio Rad) according to the manufacturer's instructions. GAPDH levels were used as a normalization control.
[0200] (Transcriptional activation assay using CRISPRa) We investigated whether CRISPRa-mediated transcriptional activity was regulated by additional 5' nucleotide residues. 4 HEK293T cells were seeded into 96-well plates. The cells were transfected with an integrated CRISPRa plasmid (50 ng, 1 / 5 the size of a 24-well plate) containing 5' additional nucleotide residues of [0C] to [25C]. The transfected cells were cultured for 24 hours. Subsequently, the cells were treated with puromycin (5.0 μg / mL) for 2 days to remove untransfected cells. After removing puromycin, the transfected cells were cultured for 1 day, and total RNA was extracted using ISOGEN II. Next, the mRNA expression levels of ASCL1 and TTN were measured by qRT-PCR.
[0201] The results are as follows Figure 6 and Figure 7 As shown in the figure, the mRNA expression levels of ASCL1 and TTN decreased with the increase of the number of 5' additional nucleotide residues, confirming that the transcriptional activity of CRISPRa can be regulated by the number of 5' additional nucleotide residues.
[0202] <Example 4> (Construction of CRISPRi Plasmid) The [5C]-[30C] linker containing a BmsBI site was inserted into the BsmBI site of the LV hU6-sgRNA hUbC-dCas9-KRAB-T2a-Puro (sgRNA-KRAB-Puro) plasmid (Addgene #71236) to construct an all-in-one CRISPRi plasmid for [C]sgRNA expression. The sgRNA spacer sequences targeting BRCA1 and CXCR4 used in previous studies were inserted into the BsmBI site of this all-in-one plasmid (Yeo, NC et al. Nat Methods 15, 611-616, doi:10.1038 / s41592-018-0048-5 (2018).).
[0203] (Transcriptional inhibition assay via CRISPRi) We investigated whether CRISPRi-mediated transcriptional repression is regulated by additional 5' nucleotide residues. One day before transfection, 3 × 10 4 HEK293T cells were seeded in 96-well plates. The cells were transfected with an integrated CRISPRi plasmid (50 ng, 1 / 5 of the size of a 24-well plate) containing 5' additional nucleotide residues of [0C] to
[15] . The transfected cells were cultured for 24 hours. Subsequently, the cells were treated with puromycin (5.0 μg / mL) for 2 days to remove untransfected cells. After removing puromycin, the transfected cells were cultured for 2 days, and total RNA was extracted using ISOGEN II. Next, the mRNA expression levels of BRCA1 and CXCR4 were measured by qRT-PCR.
[0204] The results are as follows Figure 8 As shown in Figure 3, the mRNA expression levels of BRCA1 and CXCR4 increased with the increase in the number of 5' additional nucleotide residues. These results confirm that the transcriptional repression effect of CRISPRi decreases with the increase in the number of 5' additional nucleotide residues and that the activity of CRISPRi can be regulated by the number of 5' additional nucleotide residues.
[0205] This suggests that as the number of 5' additional nucleotide residues increases, the activity of the CRISPR / Cas system decreases. In the CRISPRi system, the amount of transcriptional activation is adjusted by changing the type of transcriptional activation domain, but studies have shown that the degree of transcriptional activation can be fine-tuned by changing the length of the 5' additional nucleotide residues without changing the transcriptional activation domain.
[0206] <Example 5> (Preparation of AIMS cells) AIMS cells are cells that can detect the insertion / deletion (indel) pattern of genome editing by detecting the fluorescence of the cells after genome editing (see Figure 2 AIMS cells were prepared based on the method described in International Publication No. 2020 / 122195. AIMS cells (Cdh1-AIMS) were prepared by knocking in the P2A2:Venus gene cassette and the P2A2:tdTomato gene cassette into the 3' region adjacent to the Cdh1 coding region in mouse embryonic stem cells.
[0207] (Construction of Cas12a plasmid) A synthetic DNA fragment (AZENTA) encoding the U6 promoter and two BpiI sites was inserted into the PX459 plasmid, and the U6-gRNA box was removed using the PciI and XbaI sites. Next, the CBh-AsCpf1 fragment of the pY036_ATP1A1_G3_Array plasmid (Addgene #86619) (Agudelo, D. et al. Nat Methods 14, 615-620, doi: 10.1038 / nmeth.4265 (2017).) was digested with KpnI and FseI to replace the CBh-Cas9 region of the crRNA-Cas9-puro plasmid. This constructed an integrated crRNA-AsCpf1-puro plasmid (PX459 plasmid backbone). The crRNA linker targeting the P2A2 site of Cdh1-AIMS consists of a 5′ hairpin, a 20-nt spacer sequence, and a U4AU4 3′ overhang and is inserted into the BpiI site of the crRNA-AsCpf1-puro plasmid.
[0208] (Indel induction testing using the Cas12a platform) We investigated whether the insertion / deletion (indel) induction rate in the Cas12a platform can be regulated by adding additional nucleotide residues. The position of the additional nucleotide residue was set to (1) the 5' end of the sgRNA, (2) the 5' end of the spacer sequence, or (3) the 3' end of the sgRNA. An integrated plasmid of AsCpf1 with additional nucleotide residues of [10C] or [25C] added at any position from (1) to (3) was constructed. These Cas12a integrated plasmids were introduced into Cdh1-AIMS. The insertion / deletion pattern induced by Cas12a genome editing was subsequently confirmed using fluorescence microscopy (BZ-X800, Keyence and IX73, Olympus).
[0209] The results are as follows Figure 9 As shown in Figure 1, when the position of the additional nucleotide residues is set at the 5' end of (1) sgRNA, the greater the number of additional nucleotide residues, the lower the insertion / deletion introduction rate. In addition, the insertion / deletion introduction rate in only one allele increased. From this result, it is speculated that the additional nucleotide residues reduce the genome editing activity and produce an off-target inhibitory effect. This is believed to be able to effectively induce genome editing in one allele. When the position of the additional nucleotide residues is set between the (2) repeat sequence and the spacer sequence, no insertion / deletion is introduced. When the position of the added nucleotide residue is set to the 3' end of (3) sgRNA, the additional nucleotide residue does not affect the insertion / deletion introduction rate.
[0210] These results confirm that the genome editing activity of Cas12a can be regulated by adding additional nucleotide residues to the 5' end of the sgRNA in the Cas12a platform. Therefore, using the integrated Cas12a plasmid, additional nucleotide residues ranging from [0C] to [30C] were added to the 5' end of the sgRNA to study the effect of the number of additional nucleotide residues.
[0211] The results are as follows Figure 10 As shown, as the number of added nucleotide residues increases, the insertion / deletion introduction rate decreases. In addition, the greater the number of additional nucleotide residues, the higher the insertion / deletion introduction rate in only one allele. These results confirm that the Cas12a platform can regulate genome editing activity by adjusting the number of additional nucleotide residues added to the 5' end of the sgRNA. By inhibiting genome editing activity, off-target inhibitory effects can be expected. By combining with HDR, it can be applied to create heterozygous SNP disease model cells and disease model animals that do not contain unnecessary mutations. It is also believed to contribute to the implementation of precise gene therapy for diseases associated with heterozygous SNPs.
[0212] <Example 6> (Cultivation of mESCs) mESCs were cultured in DMEM (Nacalai Tesque) medium. The DMEM used for culture contained 2 mM Glutamax (Nacalai Tesque), 1× non-essential amino acids (NEAA) (Nacalai Tesque), 1 mM sodium pyruvate, 100 U / mL penicillin, 100 μg / mL streptomycin (P / S) (Nacalai Tesque), 0.1 mM 2-mercaptoethanol (Sigma), and 15% fetal bovine serum (FBS) (GIBCO), supplemented with 0.2 μM PD0325901 (Sigma), 3 μM CHIR99021 (Cayman), and 1,000 U / mL recombinant mouse LIF (Millipore). mESCs were maintained under feeder-free conditions at 37°C and 5% CO2. When cells were passaged, Y-27632 (10 μM, Sigma) was added to the culture medium.
[0213] (Base substitution test using ABE8e) At the end of the CdH1 gene coding sequence, the P2A sequence and tdTomato and Venus were knocked into the CdH1-AIMS of the two alleles (see Figure 1 ; Kawamata et al., Nat. Biomed. Eng. 7, 672-691 (2023), International Publication No. 2020 / 122195). An integrated plasmid expressing ABE8e targeting the P2A-3 site (spacer sequence: GCTGAAGCAGCTGGAGACGTGG: SEQ ID NO. 1; the "TGG" at the 3' end is the PAM sequence) was constructed and transfected into Cdh1-AIMS to guide base substitution.
[0214] The ABE8e integrated plasmid (SEQ ID NO. 2) expresses ABE8e, the puromycin resistance cassette, and the gRNA. The ABE8e plasmid (Addgene, Plasmid #138489) (SEQ ID NO. 3) was digested with SpeI and BglII, and fragments were excised. The pSpCas9(BB)-2A-Puro(PX459) V2.0 plasmid (Addgene, Plasmid #62988) (SEQ ID NO. 4) was digested with XbaI and BglII, and the resulting fragments were ligated. This produced the ABE8e integrated plasmid.
[0215] Insert the following adapters into the BpiI site directly below the U6 promoter of the ABE8e integration plasmid. (F) indicates a forward linker. (R) indicates a reverse linker.
[0216] 5C(3A) Adapter Connector: (F)5'-CACCGCCACCGGGTCTTCGAGAAGACCT-3'(SEQ ID NO.5) (R)5'-AAACAGGTCTTCTCGAAGACCCGGTGGC-3'(SEQ ID NO.6) 10C (8A) adapter connector: (F)5'-CACCGCCCCCCCACCGGGTCTTCGAGAAGACCT-3'(SEQ ID NO.7) (R)5'-AAACAGGTCTTTCTCGAAGACCCGGTGGGGGGGC-3'(SEQ ID NO.8) 15C (13A) adapter connector: (F)5'-CACCGCCCCCCCCCCCCCCCACCGGGTCTTCGAGAAGACCT-3'(SEQ ID NO.9) (R)5'-AAACAGGTCTTCTCGAAGACCCGGTGGGGGGGGGGGGC-3'(SEQ ID NO.10) 20C(18A): (F)5'-CACCGCCCCCCCCCCCCCCCCCCCCCCCACCGGGTCTTCGAGAAGACCT-3'(SEQ IDNO.11) (R)5'-AAACAGGTCTTCTCGAAGACCCGGTGGGGGGGGGGGGGGGGGGGC-3'(SEQ IDNO.12) 25C(23A): (F)5'-CACCGCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCGGTCTTCGAGAAGACCT-3'(SEQ ID NO.13) (R)5'-AAACAGGTCTTCTCGAAGACCCGGTGGGGGGGGGGGGGGGGGGGGGGGGGGC-3'(SEQ ID NO.14) 30C(28A): (F)5'-CACCGCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCGGTCTTCGAGAA GACCT-3'(SEQ ID NO.15) (R)5'-AAACAGGTCTTCTCGAAGACCCGGTGGGGGGGGGGGGGGGGGGGC-3'(SEQ IDNO.16)
[0217] Thus, 5C (3A) linker ABE8e integration, 10C (8A) linker ABE8e integration, 15C (13A) linker ABE8e integration, 20C (18A) linker ABE8e integration, 25C (23A) linker ABE8e integration, and 30C (28A) linker ABE8e integration plasmids were constructed, respectively. By inserting the coding sequence of the desired spacer sequence into the BpiI site of these plasmids, sgRNAs with 5C, 10C, 15C, 20C, 25C, and 30C added to the 5' side can be expressed, respectively. However, in these plasmids, in order to introduce the overhang sequence CACC for connecting to the BpiI site, the 3rd C of 5C, the 8th C of 10C, the 13th C of 15C, the 18th C of 20C, the 23rd C of 25C, and the 28th C of 30C were replaced by A, respectively.
[0218] The coding sequence for the spacer sequence for P2A-3 was inserted into the BpiI site of the ABE8e integrated plasmid containing a linker. In addition, the coding sequence for the spacer sequence for P2A-3 was inserted into the BpiI site of the ABE8e integrated plasmid without a linker. Thus, P2A-sgRNA3_ABE8e integrated (0C), P2A-sgRNA3_ABE8e integrated (5C(3A)), P2A-sgRNA3_ABE8e integrated (10C(8A)), P2A-sgRNA3_ABE8e integrated (15C(13A)), P2A-sgRNA3_ABE8e integrated (20C(18A)), P2A-sgRNA3_ABE8e integrated (25C(23A)), and P2A-sgRNA3_ABE8e integrated (30C(28A)) were prepared, respectively. The base sequences of the linkers used to prepare sgRNA targeting P2A-3 are shown in SEQ ID NO. 17 and SEQ ID NO. 18.
[0219] The plasmid prepared as described above was introduced into CdH1-AIMS using Lipofectamine (registered trademark) 3000 (Thermo Fisher Scientific). 500 μL of 2iL+Y culture medium was dispensed into a 24-well plate coated with collagen. ES cells dissociated with trypsin (Nacalai Tesque) were inoculated into the culture medium. The nucleic acid-Lipofectamine 3000 complex was prepared according to the standard operating procedures of Lipofectamine 3000. 1 μL of Lipofectamine 3000 was added to 25 μL of Opti-MEM culture medium (Thermo Fisher SCIENTIFIC). In addition, 250 ng of plasmid and 1 μL of P3000 reagent were added to another 25 μL of Opti-MEM culture medium and mixed. These mixtures were mixed together and incubated at room temperature for 5 minutes. Then, they were added to a 24-well plate seeded with ES cells and incubated overnight. One day after transfection, the cells were treated with puromycin (1.5 μg / mL) for 2 days. Puromycin-resistant cells selected by puromycin treatment were cultured for several days in the absence of puromycin, trypsinized, and then re-seeded onto collagen-coated culture plates.
[0220] After culturing for several days, the colonies that appeared were picked. Using the picked colony DNA as a template, the region containing the target sequence of the Cdh1-P2A-tdTomato chimeric gene (SEQ ID NO.19) was amplified by PCR. The nucleotide sequence of the amplified DNA fragment was then obtained by Sanger sequencing. The base editing pattern was determined by comparing the obtained nucleotide sequence with the nucleotide sequence of the Cdh1-P2A-tdTomato chimeric gene (SEQ ID NO.19). The PCR primer sequences used for clone sequence analysis are shown in SEQ ID NOs.20-21, respectively.
[0221] The results are as follows Figure 11 As shown, in [0C]gRNA, no clones were detected in which only the active center (A6) was replaced by a guanine residue (A6→G), and in 96% of the clones, A5, A6, and A9 were all replaced by guanine. On the other hand, clones with guanine substitutions (A6→G) only in the active center (A6) were detected using [10C]gRNA and [25C]gRNA. Furthermore, the proportion of clones with guanine substitutions at all of A5, A6, and A9 decreased. When using [25C]gRNA, 4% of clones had guanine substitutions at A6 and A9.
[0222] These results confirm that the width of the ABE8e activity window can be adjusted by adjusting the number of 5'-additional nucleotide residues. By adjusting the number of 5'-additional nucleotide residues, the width of the activity window can be adjusted at the 1-bp level. In other words, the 5'-additional nucleotide residues can be said to suppress the bystander effect of ABE8e. Furthermore, adjusting the number of 5'-additional nucleotide residues also demonstrated that the position of the activity window can be altered.
[0223] <Example 7> The same experiments as in Example 6 were performed using [30G]gRNA, [35G]gRNA, and [40G]gRNA. Except for changing the linkers used for sgRNA preparation to [30G], [35G], and [40G]sgRNA preparation linkers (SEQ ID NOs. 24-29), the remaining operations were performed using the same method as above, and P2A-sgRNA3_ABE8e integrated (30G), P2A-sgRNA3_ABE8e integrated (35G), and P2A-sgRNA3_ABE8e integrated (40G) were prepared in the same manner. Using these plasmids, base substitution experiments and base substitution analysis were performed in the same manner as in Example 6. The PCR primers used for clone sequence analysis were the same as in Example 6.
[0224] The results are as follows Figure 12 As shown, in both [30G]gRNA and [35G]gRNA, clones were detected in which only guanine substitution (A6→G) occurred in the active center (A6).
[0225] These results confirm that the activity window width of ABE8e can be tuned even using a guanine residue as the added nucleotide residue. The results of Examples 6 and 7 indicate that the width and position of the activity window can be freely controlled by adjusting the number and type of 5' additional nucleotide residues.
[0226] <Example 8> The same experiments as in Example 6 were performed using gRNAs ranging from [0C] to [30C]. Base substitution experiments and base substitution analysis were performed in the same manner as in Example 6, except that PCR and sequence analysis were performed using DNA from transfected bulk cells as a template. The PCR primer sequences for amplicon sequence analysis are shown in SEQ ID NOs. 22-23, respectively.
[0227] The results are as follows Figure 13 As shown, "A5A6--A9→G5G6--G9" indicates the editing frequency when all adenines (A5, A6, A9) in the active window are replaced by guanines (G5, G6, G9), "A5A6--A9→G5G6--A9" indicates the editing frequency when adenines (A5, A6) are replaced by guanines (G5, G6), "A5A6--A9→A5G6--A9" indicates the editing frequency when A6 is replaced by guanine (G6), and "A5A6--A9→A5G6--A9" indicates the editing frequency when none of the adenines (A5, A6, A9) are replaced by guanines.
[0228] The editing frequency of "A5A6--A9→G5G6--G9" was 92%. On the other hand, the editing frequency of "A5A6--A9→G5G6--G9" was significantly reduced in gRNAs containing additional nucleotide residues. The editing frequency of "A5A6--A9→G5G6--G9" decreased as the number of additional nucleotide residues increased. The editing frequency of "A5A6--A9→G5G6--A9" was significantly increased compared with [0C]gRNA; as the number of additional nucleotide residues increased, the editing frequency of "A5A6--A9→G5G6--A9" showed a decreasing trend. The editing frequency of "A5A6--A9→A5G6--A9" was 0%. On the other hand, for gRNA containing additional nucleotide residues, even [5C] gRNA, the editing frequency of "A5A6--A9→A5G6--A9" was 0.17. % The editing frequency of "A5A6--A9→A5G6--A9" increases with the number of additional nucleotide residues.
[0229] These results confirm that the activity window of ABEe can be narrowed by adjusting the number of additional nucleotide residues.
[0230] <Example 9> ABE8e is known to induce indels, but its indel incorporation rate is low. Therefore, based on the amplicon sequence analysis results from Example 8, the indel incorporation rate was investigated. Based on the amplicon sequence analysis results for [0C]gRNA, [5C]gRNA, and [10C]gRNA, the total proportion of DNA with an indel rate of 0.2% or higher was calculated.
[0231] The results are as follows Figure 14 As shown, the indel rate of [0C]gRNA was 0.61%, while the indel rates of [5C]gRNA and [10C]gRNA were 0%. These results confirm that the addition of nucleotide residues inhibits the induction of indels in ABE8e.
[0232] <Example 10> The same experiment as in Example 8 was performed using a Cdh1-P2A (P2A(A6→G))-tdTomato chimeric gene (SEQ ID NO. 30), in which the active center A6 of the ABE8e activity window is replaced with G. The results revealed that the phenomenon of widening the ABE8e activity window was related to stepwise editing from A5G6A9 to G5G6G9. Specifically, the mechanism of narrowing the ABE8e activity window by using gRNA with additional nucleotide residues at the 5' end was investigated, as was whether this was related to off-target inhibitory effects.
[0233] The P2A-3 target sequence region of the Cdh1-P2A-tdTomato chimeric gene was changed to a sequence in which A6 was replaced by guanine (G) (P2A(A6→G)), and the spacer sequence of the gRNA was changed to P2A(A6→G). In addition, the base substitution test and base substitution analysis were performed in the same manner as in Example 8. The nucleotide sequence of the Cdh1-P2A(A6→G)-tdTomato chimeric gene is shown in SEQ ID NO.30. The PCR primers used for amplicon sequence analysis were the same as those used in Experimental Example 8.
[0234] The results are as follows Figure 15 As shown, "A5G6--A9→G5G6--G9" indicates the editing frequency of adenine (A5, A9) replaced by guanine (G5, G9), "A5G6--A9→G5G6--A9" indicates the editing frequency of adenine (A5) replaced by guanine (G5), and "A5G6--A9→A5G6--A9" indicates the editing frequency of neither adenine (A5, A9) replaced by guanine (No edit).
[0235] [0C] In gRNA, the editing frequency of "A5G6--A9→G5G6--G9" was 89%. On the other hand, in gRNA with added nucleotide residues, the editing frequency of "A5G6--A9→G5G6--G9" was significantly reduced. The editing frequency of "A5G6--A9→G5G6--G9" decreased as the number of additional nucleotide residues increased. The editing frequency of "A5G6--A9→G5G6--A9" was significantly increased compared with [0C]gRNA, and as the number of additional nucleotide residues increased, the editing frequency of "A5A6--A9→G5G6--A9" showed a decreasing trend. The editing frequency of "A5G6--A9→A5G6--A9" substitution was 0.73%. On the other hand, for gRNA containing additional nucleotide residues, "A5G6--A9" substitution was not performed. 9> The editing frequency of the "A5G6--A9" replacement for [5C] is 0.87 % , for [10C] is 2.67%. 9> The editing frequency of the "A5G6--A9" substitution increases with the number of additional nucleotide residues.
[0236] Figure 16 Shown Figure 15 In "A5G6--A9→G5G6--G9", divide the "Efitting frequency (%)" by Figure 13 The value (Off / On ratio) obtained from the "Efitting frequency (%)" for "A5A6--A9→G5G6--G9" in the figure is shown in Figure 1. The Off / On ratio for [5C]gRNA is approximately half that for [0C]gRNA. The Off / On ratio tends to decrease with increasing the number of added nucleotide residues.
[0237] These results confirm that gRNAs with additional 5' nucleotide residues can reduce off-target activity relative to on-target activity, thereby avoiding ABE8e re-editing and narrowing the activity window.
[0238] <Example 11> Similar to Example 8, the experiment was performed using HEK293T cells instead of Cdh1-AIMS. The target sequence of the gRNA was "TTGCATAGACCTGCCCACTGTGG" (SEQ ID NO. 31; the "TGG" at the 3' end is the PAM sequence). An ABE8e integrated plasmid expressing a gRNA targeting this target sequence was prepared. This plasmid was transfected into HEK293T cells to induce base substitution. The target region was amplified by PCR using the transfected cell DNA as a template. The nucleotide sequence of the amplified DNA fragment was then obtained by Sanger sequencing. The connecting sequences used to prepare the plasmid are shown in SEQ ID NOs.34-35, the PCR primer sequences used for amplicon sequence analysis of the on-target region are shown in SEQ ID NOs.32-33, the PCR primer sequences used for amplicon sequence analysis of the off-target 1 (SEQ ID NO.36) region are shown in SEQ ID NOs.38-39, and the PCR primer sequences used for amplicon sequence analysis of the off-target 2 (SEQ ID NO.37) region are shown in SEQ ID NOs.38-39.
[0239] Target area analysis results are as follows Figure 17 As shown, Figure 17 The sequence shown above is the target sequence for the gRNA. As the number of added nucleotide residues increases, the frequency of target editing decreases.
[0240] The analysis results of off-target regions are as follows Figure 18 As shown, Figure 18 The sequences listed above each figure represent the sequences of off-target 1 and off-target 2, respectively. The nucleotide residues marked within the boxes are mismatched residues. In both off-target 1 and off-target 2, the editing frequency decreases with increasing number of added nucleotide residues.
[0241] Figure 19 The values obtained by dividing the editing frequency of the off-target region by the editing frequency of the on-target region (off-target / on-target ratio) are shown. The upper graph uses the editing frequency of the off-target region 1, and the lower graph uses the editing frequency of the off-target region 2. For both off-target 1 and off-target 2, the off-target / on-target ratio decreases with increasing number of added nucleotide residues.
[0242] These results confirmed that a greater number of added nucleotide residues resulted in better off-target inhibition.
[0243] <Example 12> An experiment similar to Example 6 was performed using embryonic stem cells from fibrodysplasia ossificans (FOP) model mice (Kawamata et al., Nat. Biomed. Eng. 7, 672-691 (2023), WO2020 / 122195) instead of Cdh1-AIMS. A heterozygous SNP (GGCTCACCAGATAACCCTGTTGG: SEQ ID NO. 42; "TGG" at the 3' end is a PAM sequence) is present in the Acvr1 gene of FOP model mice (see Figure 20 An ABE8e integrated plasmid expressing a sgRNA targeting a SNP in the Acvr1 gene was prepared. This plasmid was transfected into ES cells of FOP model mice to induce base substitutions. Using the cloned DNA obtained after transfection as a template, PCR was used to amplify the SNP region of the Acvr1 gene. The amplified DNA fragment was sequenced by Sanger sequencing to obtain the nucleotide sequence. The PCR primer sequences used for Sanger sequencing analysis of the SNP region of the Acvr1 gene are shown in SEQ ID NOs. 43-44, respectively.
[0244] The results are as follows Figure 21 As shown, Figure 21 In the data, "No edit" indicates clones with no base substitutions, and "Byproduct correction" indicates clones in which two adenines (A6, A9) were replaced by guanines (G6, G9) in the Acvr1 gene SNP region. "Precise correction" indicates clones in which one adenine (A6) was replaced by guanine (G6) in the Acvr1 gene SNP region. When [0C] gRNA was used, all clones showed "Byproduct correction." On the other hand, clones with "Precise correction" were detected when [10C] gRNA and [20C] gRNA were used. The "Precise correction" rate was higher with [20C] gRNA than with [10C] gRNA.
[0245] As a mechanism for the occurrence of "Byproduct correction", it is considered Figure 20 Byproducts (1) to (3) are shown. In the gRNA with the additional nucleotide residue, all the mechanisms of byproducts (1) to (3) are suppressed, so it is speculated that the ratio of "Precise correction" will increase. In other words, in the gRNA with the additional nucleotide residue, it is speculated that the activity window of ABE8e is narrowed, thereby suppressing the mechanism of byproduct (1). In addition, in the gRNA with the additional nucleotide residue, it is speculated that the mechanism of byproduct (2) can be suppressed by suppressing the re-editing of the allele after replacing adenine (A6) with guanine (G6). In addition, it is speculated that the gRNA with the additional nucleotide residue can suppress the off-target effect, thereby suppressing the mechanism of byproduct (3).
[0246] <Example 13> Disease model mice with hereditary tyrosinemia type 1 (HT-1) 1R / 1R ) were used to perform a base substitution test using ABE8e. HT-1 in this mouse model is caused by the substitution of a guanine residue with an adenine residue in exon 8 of the Fah gene.
[0247] Figure 22 A therapeutic strategy for HT-1 was demonstrated. HT-1 can be treated by replacing the SNP adenine residue (A9) in the Fah gene with a guanine residue (G9), thereby restoring the Fah gene to normal. A9 is outside the activity window of ABE8e. Within the activity window of ABE8e lies an adenine residue (A6), which is not a SNP. Therefore, for the treatment of HT-1, it is necessary to narrow the activity window of ABE8e and move the activity window to the 3' side. Whether this precise correction can be achieved using a guide RNA with an additional nucleotide residue was investigated.
[0248] Experiments similar to those in Example 8 were performed using HT-1 model mouse embryonic stem cells instead of Cdh1-AIMS. "ACTGGAGCAGTAATGCCTGGTGG" (SEQ ID NO. 45; the "TGG" at the 3' end is the PAM sequence) was used as the gRNA target sequence. An ABE8e integrated plasmid expressing a gRNA targeting this target sequence was prepared. This plasmid was transfected into HT-1 model mouse embryonic stem cells to induce base substitution. Using the transfected cell DNA as a template, the target sequence region was amplified by PCR. The nucleotide sequence of the amplified DNA fragment was then obtained by Sanger sequencing. The PCR primer sequences used for amplicon sequence analysis are shown in SEQ ID NOs. 46-47, respectively.
[0249] The results are as follows Figure 23 The figure above shows the precise correction frequency. When using [0C] gRNA, the precise correction frequency is 0.02%. On the other hand, using gRNA containing additional nucleotide residues significantly increases the precise correction frequency. When using [10C] gRNA, the precise correction frequency can be increased to 0.63%.
[0250] Figure 23 The bottom graph shows the proportion of precise corrections in alleles with base substitutions. This was used to investigate whether the added nucleotide residues had the property of shifting the activity window of ABE8e toward A9. The proportion of precise corrections increased with increasing numbers of added nucleotide residues. These results confirm that the added nucleotide residues have the effect of shifting the activity window of ABE8e, enabling precise editing of A6.
[0251] <Example 14> The additional nucleotide residues used were those obtained by adding three additional nucleotide residues ([XXX]) to the 5' side of [20C] (see Figure 24 ). [XXX] is [CTG], [AGC] or [CGG]. Prepare ABE8e integrated plasmid expressing [XXX][20C]gRNA ( Figure 24 The plasmid in the expression vector ([XXX][20C]sgRNA-ABE8e-Puro) was transfected into HT-1 mouse embryonic stem cells to induce base substitutions. The target sequence region was amplified by PCR using DNA from the transfected bulk cells as a template. The nucleotide sequence of the amplified DNA fragment was then obtained by amplicon sequencing. The linker sequences used for sgRNA generation are shown in SEQ ID NOs. 50-55. The PCR primer sequences used for amplicon sequencing analysis were the same as those in Example 13.
[0252] The results are as follows Figure 25 The top graph shows the precise correction frequency. Adding three additional nucleotide residues to the 5' end of [20C] altered the precise correction frequency. Compared to [20C]gRNA, [AGC][20C]gRNA increased the precise correction frequency by 3.1-fold.
[0253] Figure 25 The bottom panel shows the proportion of precise correction for base-substituted alleles. Adding three additional nucleotide residues to [20C] increases the proportion of precise correction compared to [20C] gRNA.
[0254] These results suggest that by adjusting the number and sequence of added nucleotide residues, the activity window of ABE8e can be narrowed and moved to the desired position. This will make it possible to repair SNPs that were originally untargetable, thereby expanding the range of treatable diseases.
[0255] <Example 15> P2A-8 (GGAGACGTGGAGGAGAGAACCCTGG: SEQ ID NO. 56; "TGG" at the 3' end is the PAM sequence) was used as the target sequence and an experiment similar to Example 6 was performed. The spacer sequences of the sgRNA were a 20nt spacer sequence (SEQ ID NO. 74) and a 17nt spacer sequence (SEQ ID NO. 75) (see Figure 26 ). The linker sequences for preparing sgRNA with a 20nt spacer sequence (20ntgRNA) are shown in SEQ ID NOs.57-58, respectively. The linker sequences for preparing sgRNA with a 17nt spacer sequence (17ntgRNA) are shown in SEQ ID NOs.59-60, respectively.
[0256] The base substitution test and base substitution analysis were performed in the same manner as in Example 8, except that the ABE8e integrated plasmid expressing either 20nt gRNA or 17nt gRNA was used. The same PCR primers as in Example 8 were used for amplicon sequence analysis.
[0257] The results are as follows Figure 26 As shown, for the case of using 17nt gRNA, A3 and A 11 The bystander effect in A5 was significantly suppressed, and the editing frequency of base substitutions in A5 was significantly increased. These results confirm that the activity window can be narrowed by adjusting the length of the spacer sequence. This is believed to enable precise genome editing that avoids bystander effects.
[0258] <Example 16> The base substitution test and base substitution analysis were the same as in Example 15, except that the sgRNA spacer sequences used were 20nt spacer sequences (SEQ ID NO. 74) and 25nt spacer sequences (SEQ ID NO. 76), respectively (see Figure 27 The linker sequences used to prepare 25nt spacer sgRNA (25nt gRNA) are shown in SEQ ID NOs. 61-62, respectively. Amplicon sequence analysis was performed using the same PCR primers as in Example 8.
[0259] The results are as follows Figure 27 As shown, after using 25nt gRNA, A -5 The editing frequency increased 1.9-fold compared to that using a 20nt gRNA. These results confirm that increasing the length of the spacer sequence can shift the activity window to the 5' side. By enabling editing in regions where base substitutions are difficult due to PAM sequence constraints, it is believed that its practical application as a genome editing tool will be expanded.
[0260] <Example 17> The base substitution assay and base substitution analysis were the same as in Example 15, except that AID-BE4max (cytidine base editor) was used instead of ABE8e.
[0261] The AID integrated plasmid (SEQ ID NO. 63) was prepared as follows: First, the region containing the NLS-P2A-GFP-NLS cassette was excised from the AID-BE4max-P2A-GFP plasmid (Addgene, Plasmid #157948) (SEQ ID NO. 64) using EcoRI and PmeI. Then, the T2A-Puro cassette (SEQ ID NO. 65) from the pSpCas9(BB)-2A-Puro(PX459) V2.0 plasmid (SEQ ID NO. 4) was ligated into the EcoRI and PmeI restriction sites. In this way, the AID integrated plasmid was prepared. The T2A-Puro expression cassette (SEQ ID NO. 65) was obtained by PCR amplification using the pSpCas9(BB)-2A-Puro(PX459) V2.0 plasmid as a template. An EcoRI site and a nuclear localization signal (NLS) (SEQ ID NO. 66) were added to the 5' end of the forward primer, and the Puro expression cassette's stop codon (TGA) and a PmeI site (SEQ ID NO. 67) were added to the 3' end of the reverse primer.
[0262] P2A-8 (SEQ ID NO. 56) was used as the target sequence. The 20nt gRNA preparation linker, 17nt gRNA preparation linker, and PCR primers for amplicon sequence analysis were the same as those in Example 15.
[0263] The results are as follows Figure 28 As shown, in the 17nt gRNA, C -12 、C -6 、C -2 The bystander effect at C6 was strongly suppressed, and the editing frequency at C6 was increased. This narrowed the activity window of AID-BE4max. These results confirm that the activity window can be narrowed by adjusting the length of the spacer sequence.
[0264] <Example 18> The sgRNA spacer sequences used were 20nt spacer sequence (SEQ ID NO. 74), 25nt spacer sequence, 30nt spacer sequence and 30nt+2 mismatch spacer sequence (there are two mismatches within the 30nt spacer sequence) (see Figure 29 ). The linker sequences for preparing sgRNA with a 20nt spacer sequence (20nt gRNA) are shown in SEQ ID NOs.57-58. The linker sequences for preparing sgRNA with a 25nt spacer sequence (25nt gRNA) are shown in SEQ ID NOs.61-62. The linker sequences for preparing sgRNA with a 30nt spacer sequence (30nt gRNA) are shown in SEQ ID NOs.68-69. The linker sequences for preparing sgRNA with a 30nt+2 mismatch spacer sequence (30nt+2mm gRNA) are shown in SEQ ID NOs.70-71.
[0265] Except for using AID integrated plasmids expressing 20nt gRNA, 25nt gRNA, 30nt gRNA, or 30nt + 2mm gRNA, the rest of the operations were the same as in Example 17 to perform base substitution experiments and base substitution analysis. Amplicon sequence analysis used the same PCR primers as in Example 17.
[0266] The results are as follows Figure 29 As shown, when using 25nt gRNA and 30nt gRNA, C -12 、C -6 、C -2 These results confirm that extending the spacer sequence on the 5' side has the effect of expanding the activity window of AID-BE4max on the 5' side. When using 30nt+2mm gRNA, compared with 30nt gRNA, C -6 The editing efficiency is similar to that at C6, but C -2 When 30nt+2mm gRNA was used, the editing frequency at the target genomic site C was significantly reduced. -2 The nucleotide residues are converted to guanine residues (G). -2 The reduction in editing frequency at the site is thought to be caused by this mismatch. These results demonstrate that by introducing mismatches in the 5' extension of the spacer sequence, the activity window can be extended to the 5' side while preventing any base substitutions. This may enable the design of base substitutions that precisely correct specific disease SNPs.
[0267] The sequences used in Examples 1 to 5 are shown in Tables 1 to 7. In the tables, "F" represents forward and "R" represents reverse.
[0268]
Table 1
[0269]
Table 2
[0270]
Table 3
[0271]
Table 4
[0272]
Table 5
[0273]
Table 6
[0274]
Table 7
[0275] The sequences used in Examples 6 to 18 are shown in Tables 8 to 11.
[0276]
Table 8
[0277]
Table 9
[0278]
Table 10
[0279]
Table 11
[0280] This specification provides novel methods for regulating RNA transcription and designing RNA expression vectors, as well as novel methods for the application of RNA-guided nuclease technologies. Furthermore, guide RNAs, expression vectors, and kits useful in these methods are also provided. These methods can be applied to treat or prevent genetic diseases and diseases caused by abnormal gene expression. Furthermore, these methods can be applied to a wide range of industrial fields, including drug screening, disease model construction, food development such as functional foods, and animal husbandry.
[0281] While preferred embodiments of the present invention have been described above, the present invention is not limited to these embodiments. Modifications such as additions, omissions, and substitutions of the structure may be made without departing from the spirit of the present invention. The present invention is not limited to the foregoing description but is limited only by the scope of the claims.< / rna>
Claims
1. A method for regulating RNA transcription, characterized in that: The method comprises the steps of transcribing the RNA from an RNA expression vector, wherein the RNA is an RNA with one or more nucleotide residues added to the 5' end.
2. The RNA transcription control method according to claim 1, wherein The number of the added nucleotide residues is 3 or more.
3. The method for regulating RNA transcription according to claim 1 or 2, wherein: The RNA is a guide RNA.
4. A method for designing an RNA expression vector, characterized in that: The RNA expression vector is designed by regulating at least one of the number and / or type of nucleotide residues added to the 5' end of the RNA coding sequence to control the transcription efficiency of the RNA.
5. The method for designing an RNA expression vector according to claim 4, wherein: The RNA is a guide RNA.
6. A method for regulating transcription of a target gene, characterized in that: The steps include introducing the following components into cells: (A) at least one selected from (a1) a guide RNA having one or more nucleotide residues added to the 5' end, and (a2) an expression vector for the guide RNA of (a1); and (B) at least one selected from the group consisting of a fusion protein comprising an RNA-guided nuclease with inactivated nuclease activity and a transcriptional regulation-related domain, mRNA for the fusion protein, and an expression vector for the fusion protein; Wherein, the guide RNA targets the transcriptional regulatory region of the target gene.
7. The method for regulating target gene transcription according to claim 6, wherein The number of the added nucleotide residues is 3 or more.
8. A genome editing method, characterized in that The steps include introducing the following components into cells: (A) at least one selected from (a1) a guide RNA having a repeat sequence at the 5' end of the spacer sequence and one or more nucleotide residues added to the 5' end, and (a2) an expression vector for the guide RNA of (a1); and (B) at least one selected from the group consisting of an RNA-guided nuclease, an mRNA of the RNA-guided nuclease, and an expression vector of the RNA-guided nuclease.
9. The genome editing method according to claim 8, characterized in that The number of the added nucleotide residues is 3 or more.
10. The genome editing method according to claim 8 or 9, characterized in that The RNA-guided nuclease is a Cas protein of the V-type CRISPR / Cas system.
11. A base editing method, characterized in that: The steps include introducing the following components into cells: (A) at least one selected from (a1) a guide RNA that regulates at least one of (1) the addition of a 5'-terminal nucleotide residue, (2) the length of a spacer sequence, and (3) the introduction of a mismatched nucleotide residue in the spacer sequence, and (a2) an expression vector for the guide RNA of (a1); and (B) at least one selected from a base editor, an mRNA of the base editor, and an expression vector of the base editor.
12. The base editing method according to claim 11, characterized in that The activity window of the base editor is controlled by regulating at least one of (1) the addition of 5'-terminal nucleotide residues, (2) the length of the spacer sequence, and (3) the introduction of mismatched nucleotide residues in the spacer sequence.
13. The base editing method according to claim 12, characterized in that The activity window of the base editor is controlled by regulating the addition of the 5'-end nucleotide residues, and the number of the added nucleotide residues is greater than 3.
14. The base editing method according to claim 12, wherein: By regulating the length of the spacer sequence, the activity window of the base editor can be controlled.
15. The base editing method according to claim 12, wherein: The activity window of the base editor is controlled by regulating the introduction of the mismatched nucleotide residues in the spacer sequence.
16. A target gene transcription regulation kit, characterized in that: include: (A) at least one selected from (a1) a guide RNA having one or more nucleotide residues added to the 5' end, and (a2) an expression vector for the guide RNA of (a1); and (B) at least one selected from the group consisting of a fusion protein comprising an RNA-guided nuclease with inactivated nuclease activity and a transcriptional regulation-related domain, mRNA for the fusion protein, and an expression vector for the fusion protein; Wherein, the guide RNA targets the transcriptional regulatory region of the target gene.
17. A base editing kit, characterized in that include: (A) at least one selected from (a1) a guide RNA that regulates at least one of (1) the addition of 5'-terminal nucleotide residues, (2) the length of the spacer sequence, and (3) the introduction of mismatched nucleotide residues in the spacer sequence, and (a2) an expression vector for the guide RNA of (a1); and (B) at least one selected from a base editor, an mRNA of the base editor, and an expression vector of the base editor.
18. An expression vector, characterized in that The expression vector is capable of expressing: (A) a guide RNA with one or more nucleotide residues added to its 5' end; and (B) A fusion protein comprising an RNA-guided nuclease with inactivated nuclease activity and a protein involved in transcriptional regulation.
19. An expression vector, characterized in that The expression vector is capable of expressing: (A) a guide RNA with one or more nucleotide residues added to its 5' end; and (B) Base editor.
20. A guide RNA, characterized in that There is a repeat sequence at the 5' end of the spacer sequence, and one or more nucleotide residues are added to the 5' end.
21. An expression vector, characterized in that Capable of expressing the guide RNA according to claim 20.
22. The expression vector according to claim 21, characterized in that It is also possible to express RNA-guided nucleases.
23. A genome editing kit, characterized in that include: (A) at least one selected from (a1) a guide RNA having a repeat sequence at the 5' end of the spacer sequence and one or more nucleotide residues added to the 5' end, and (a2) an expression vector for the guide RNA of (a1); and (B) at least one selected from the group consisting of an RNA-guided nuclease, mRNA of the RNA-guided nuclease, and an expression vector of the RNA-guided nuclease.
Citation Information
Patent Citations
Production method for genome-edited cells
WO2020122195A1