Fusion gene for microbial battery, recombinant vector and application of fusion gene and recombinant vector

By introducing a fusion gene of the IcsA gene and the light-driven proton pump gene GR into a microbial battery, and combining it with the biotinylation localization of the Avi gene and the BirA gene, the problem of low efficiency in microbial batteries was solved, and a highly efficient and flexible micron-level power generation effect was achieved.

CN120829908APending Publication Date: 2025-10-24谭舒龙
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510871537.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-26
Publication Date
2025-10-24

AI Technical Summary

Technical Problem

Existing microbial batteries have low efficiency in anaerobic environments. Increased electrolyte exchange membrane and substrate diffusion rate increase battery resistance, and insufficient contact area between bacteria and electrodes leads to low efficiency.

Method used

By using fusion genes A and B, which contain the IcsA gene and the light-driven proton pump gene GR, as well as the Avi gene and BirA gene, respectively, polar localization and magnetic field control of microbial batteries are achieved through the expression and biotinylation of localization proteins at the old pole, thus constructing an engineered bacterium similar to the electric eel's electrocyte.

Benefits of technology

This invention achieves high-efficiency power generation of micron-scale microbial batteries, which can generate a potential difference when receiving light stimulation and control the orientation of the bacteria through a magnetic field to avoid potential cancellation, thereby improving power generation efficiency and flexibility.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120829908A_ABST
    Figure CN120829908A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of recombinant vectors, in particular to a fusion gene for a microbial battery, a recombinant vector and application of the fusion gene. The invention provides a fusion gene for a microbial battery. The fusion gene comprises a fusion gene A and a fusion gene B, the fusion gene A comprises an IcsA gene and a CD-ROM proton pump gene GR; the fusion gene B comprises an IcsA gene, an Avi gene and a BirA gene. The research finds that the IcsA protein in the fusion gene A can be localized to the old pole when the bottom cell is split, so that the polarity localization of the CD-ROM proton pump GR in the bottom cell is realized; the fusion gene B performs biotinylation on Avi-tag in the fusion protein through IcsA protein, so that biotinylation of viable bacterium surface protein by biotin ligase BirA outside a membrane is realized, thalli can be combined with magnetic beads coated with streptavidin in an old pole through biotin, and directional movement of engineering bacteria is controlled through a magnetic field.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of recombinant vector, and particularly relates to a fusion gene for a microbial battery, a recombinant vector and application thereof. BACKGROUND

[0002] With the aggravation of energy shortage problem, renewable energy has become an important part of global energy system, including solar energy, wind energy, water energy and biomass energy, etc., wherein the microbial battery in biomass energy can utilize the electrons generated in the redox reaction during bacterial metabolism to supply energy, and the essence is to convert the chemical energy in biomass into electrical energy, which can not only make full use of organic matter, but also convert organic matter into electrical energy, however, the current developed electricity-producing bacteria need anoxic environment, and the electrolyte exchange membrane, substrate and product diffusion rate increase the battery resistance, and the low efficiency problem caused by the contact area between the bacterial body and the electrode.

[0003] Biomimetic materials design new materials by simulating the structure, energy supply and processing method of organisms in nature, and electric eel can generate a voltage as high as 600V or more through electric cells, which provides a basis for biomimetic energy technology, however, the prior art does not construct a microbial battery by imitating electric eel to get rid of the shackles of traditional biological battery relying on substrate redox. SUMMARY

[0004] Therefore, in order to solve the above problems, the present application provides a fusion gene for a microbial battery, a recombinant vector and application thereof.

[0005] Therefore, in order to solve the above problems, the present application provides a fusion gene for a microbial battery, a recombinant vector and application thereof.

[0006] Therefore, in order to solve the above problems, the present application provides a fusion gene for a microbial battery, a recombinant vector and application thereof.

[0007] In a third aspect, the present application provides a method for constructing the recombinant vector for the microbial battery, the method comprising the following steps: using the second vector as a template, and using the first primer and the second primer to perform PCR reaction to obtain a first target product, wherein the sequence of the second vector is shown as SEQ ID NO: 3, the sequence of the first primer is shown as SEQ ID NO: 4, and the sequence of the second primer is shown as SEQ ID NO: 5; performing enzyme digestion on the third vector, and performing homologous recombination between the first target product and the third vector to form the recombinant vector containing the fusion gene A, wherein the sequence of the third vector is shown as SEQ ID NO: 20; and the method for constructing the recombinant vector containing the fusion gene B, comprising the following steps: using the third vector as a template, and using the fifth primer and the sixth primer to perform PCR reaction to obtain a third target product, and using the third target product as a template, and using the fifth primer and the seventh primer to perform PCR reaction to obtain a fourth target product, wherein the sequence of the third vector is shown as SEQ ID NO: 20, the sequence of the fifth primer is shown as SEQ ID NO: 10, the sequence of the sixth primer is shown as SEQ ID NO: 11, and the sequence of the seventh primer is shown as SEQ ID NO: 12; performing enzyme digestion on the fifth vector, and performing homologous recombination between the fourth target product and the fifth vector to form the recombinant vector containing the fusion gene B, wherein the sequence of the fifth vector is shown as SEQ ID NO: 22.

[0008] In some embodiments, the second vector is a vector in which the codon of the optimized photophore proton pump gene is inserted, and the sequence of the photophore proton pump gene is shown as Genebank accession number WP_011140202.1, and the sequence of the first vector is shown as SEQ ID NO: 23.

[0009] In some embodiments, the third vector is a vector in which the codon of the optimized IcsA residue is inserted, and the sequence of the IcsA gene is shown as Genebank accession number AY294290.1, and the residue sequence number is 1-104.

[0010] In some embodiments, the method further comprises a step of resistance conversion, and the specific steps are as follows: using the fourth vector as a template, and using the third primer and the fourth primer to perform PCR reaction to obtain a second target product, wherein the fourth vector is pGADT7, the sequence of the third primer is shown as SEQ ID NO: 7, and the sequence of the fourth primer is shown as SEQ ID NO: 8.

[0011] In some embodiments, the recombinant vector containing the fusion gene A is subjected to enzyme digestion, and homologous recombination is performed between the second target product and the recombinant vector to form a recombinant vector for resistance conversion.

[0012] In some embodiments, the fifth vector is a vector in which the codon of the optimized biotin ligase gene is inserted based on the first vector, and the biotin ligase is BirA enzyme.

[0013] In some embodiments, the third vector is a vector in which the codon of the optimized IcsA residue is inserted based on the first vector, and the IcsA gene sequence is as shown in Genebank accession number AY294290.1, and the residue sequence number is 1-104.

[0014] In a fourth aspect, the present application provides a biomaterial, which comprises the fusion gene for the microbial battery, the recombinant vector for the microbial battery, or the recombinant vector for the microbial battery constructed by the construction method.

[0015] In some embodiments, the construction method of the biomaterial comprises introducing the fusion gene for the microbial battery, the recombinant vector for the microbial battery, or the recombinant vector for the microbial battery constructed by the construction method into a chassis cell, and optionally, the chassis cell is selected from Escherichia coli, and optionally, the method further comprises streptavidin-coated magnetic beads.

[0016] The biomaterial provided by the present application is used for constructing an electrically active engineered bacterium and a microbial battery.

[0017] Term explanation:

[0018] Old pole and new pole: when Escherichia coli divides, it is binary fission, and when it divides, the two poles of the parent cell do not change, which are old poles, and the two new poles produced from the middle of the parent cell are new poles.

[0019] The technical scheme of the present application has the following advantages:

[0020] 1. The application provides a fusion gene for a microbial battery, comprising a fusion gene A and a fusion gene B; the fusion gene A comprises an IcsA gene and a light-driven proton pump gene GR; the fusion gene B comprises an IcsA gene, an Avi gene and a BirA gene; the application research finds that the above-mentioned fusion gene is used for the construction of a microbial battery, by introducing the above-mentioned fusion gene into a chassis cell to be constructed into a microbial battery, in the recombinant cell obtained, on the one hand, the fusion protein IcsA-GR expressed by the fusion gene A, the IcsA protein can be positioned to the old pole during the division of the chassis cell, so that the light-driven proton pump GR protein can be positioned to the old pole of the chassis cell, the engineering bacteria similar in structure to the electric eel power generation cell are constructed, when receiving light stimulation, the light-driven proton pump GR is opened, hydrogen ions flow out, a proton gradient potential is generated, the old pole membrane potential changes, the potential difference between the old pole and the new pole is generated, and the engineering bacteria are successfully constructed into a battery with the old pole and the new pole as positive and negative poles, wherein the Escherichia coli is binary fission when dividing, during the division, the two poles of the parent cell do not change, and are old poles, and the two new poles generated from the middle of the parent cell are new poles; on the other hand, the fusion protein IcsA-Avi-BirA is expressed by the fusion gene B, the fusion protein IcsA-Avi-BirA is positioned to the old pole of the chassis cell by the IcsA protein, the biotin ligase BirA can biotinylate the Avi-tag in the fusion protein extracellularly under the condition that biotin is added extracelluarly, the biotin ligase BirA realizes the biotinylation of the surface protein of the living bacteria in the extracellular part, the bacteria can be combined with the streptavidin-coated magnetic beads at the old pole through biotin, and then the movement and direction of the bacteria can be controlled through a magnetic field, and the directional movement of the engineering bacteria can be further controlled through the magnetic field, so that the bacteria can be better powered for the microelement, the bacteria can be controlled to move to the position needing power supply through the magnetic field, and the direction of the bacteria can be ensured to be consistent through the magnetic beads, so that the potential offset can be avoided when multiple bacteria supply power at the same time.

[0021] Meanwhile, the application simplifies the traditional microbial battery power generation principle, avoids the complicated microbial battery device, simplifies the whole power generation process into a single Escherichia coli, further significantly reduces the size of the battery, is only microns, and can rely on the directional movement of the magnetic beads, and is more flexible; the microbial battery provided by the application is living bacteria, can well play the stability of the organism itself, and can be self-charged, and the sufficient endurance is ensured.

[0022] 2. The recombinant vector for the microbial battery comprises a recombinant vector containing fusion gene A, and the sequence of the recombinant vector containing fusion gene A is shown in SEQ ID NO: 17 or SEQ ID NO: 18. The recombinant vector containing fusion gene A can realize polar expression of the light-driven proton pump protein, so that the light-driven proton pump protein is expressed at one pole of the donor bacteria, and an electric potential difference between the two poles of the donor bacteria can be generated when a certain stimulus is received.

[0023] Further, the recombinant vector containing fusion gene B is also included, and the sequence of the recombinant vector containing fusion gene B is shown in SEQ ID NO: 21. The recombinant vector containing fusion gene B can biotinylate the polar localization protein, and realize directional regulation of the donor bacteria by applying a magnetic field with a proper intensity.

[0024] 3. The biomaterial provided by the present application comprises the recombinant vector containing fusion gene A and / or the recombinant vector containing fusion gene B. The biomaterial formed by biotinylating the protein outside the cell membrane and binding the living bacteria to the surface of the living bacteria using the streptavidin-coated magnetic beads has the functions of generating an electric potential difference and being capable of directional regulation when a certain stimulus is received, under the premise of maintaining the activity of the bacteria. BRIEF DESCRIPTION OF DRAWINGS

[0025] In order to more clearly illustrate the specific embodiments of the present application or the technical solutions in the prior art, the drawings needed in the following specific embodiment or prior art description will be briefly introduced. Obviously, the drawings in the following description are some embodiments of the present application, and other drawings can also be obtained by those skilled in the art without creative labor.

[0026] Figure 1 is the functional detection result of the polar localization protein of E. coli containing the third vector in the embodiment of the present application, wherein, Figure 1 A1 in is the field of view of E. coli under laser with a wavelength of 488 nm at a first magnification, Figure 1 A2 in is the field of view of E. coli under bright field, Figure 1 A3 in is the superposition of the field of view of E. coli under excitation light with a wavelength of 488 nm and the field of view under bright field, Figure 1 B1 in is the field of view of E. coli under laser with a wavelength of 488 nm at a second magnification, Figure 1 B2 in is the field of view of E. coli under bright field, Figure 1 B3 in is the superposition of the field of view of E. coli under excitation light with a wavelength of 488 nm and the field of view under bright field, Figure 1 C1 in is the field of view of E. coli under laser with a wavelength of 488 nm at a third magnification,Figure 1 C2 is the field of view of E. coli under bright field, Figure 1 C3 is the superposition of the field of view of E. coli under excitation light with a wavelength of 488 nm and the field of view under bright field;

[0027] Figure 2 is the functional detection result of the polar localization protein of E. coli containing the first product plasmid in the embodiment of the present application, Figure 2 A1 is the field of view of E. coli under laser with a wavelength of 488 nm under the first magnification, Figure 2 A2 is the field of view of E. coli under bright field, Figure 2 A3 is the superposition of the field of view of E. coli under excitation light with a wavelength of 488 nm and the field of view under bright field, Figure 2 B1 is the field of view of E. coli under laser with a wavelength of 488 nm under the second magnification, Figure 2 B2 is the field of view of E. coli under bright field, Figure 2 B3 is the superposition of the field of view of E. coli under excitation light with a wavelength of 488 nm and the field of view under bright field, Figure 2 C1 is the field of view of E. coli under laser with a wavelength of 488 nm under the third magnification, Figure 2 C2 is the field of view of E. coli under bright field, Figure 2 C3 is the superposition of the field of view of E. coli under excitation light with a wavelength of 488 nm and the field of view under bright field;

[0028] Figure 3 is the functional detection result of the proton pump of E. coli containing the second carrier in the embodiment of the present application;

[0029] Figure 4 is the functional detection result of the proton pump of E. coli containing the first product plasmid in the embodiment of the present application;

[0030] Figure 5 is the magnetic bead polarity binding detection result of the second product plasmid in the embodiment of the present application, Figure 5 A1 is the field of view of E. coli under laser with a wavelength of 488 nm under the first magnification, Figure 5 A2 is the field of view of E. coli under bright field, Figure 5 A3 is the superposition of the field of view of E. coli under excitation light with a wavelength of 488 nm and the field of view under bright field, Figure 5 B1 is the field of view of E. coli under laser with a wavelength of 488 nm under the second magnification, Figure 5 B2 is the field of view of E. coli under bright field, Figure 5 B3 is the superposition of the field of view of E. coli under excitation light with a wavelength of 488 nm and the field of view under bright field, Figure 5C1 is the field of view of E. coli under laser with wavelength of 488 nm at a third magnification, Figure 5 C2 is the field of view of E. coli under bright field, Figure 5 C3 is the superposition of the field of view of E. coli under excitation light with wavelength of 488 nm and the field of view under bright field.

[0031] Figure 6 is the detection result of the proton pump function of E. coli containing the first product plasmid and the second product plasmid in the embodiment of the present application;

[0032] Figure 7 is the detection result of the magnetic bead polarity binding of E. coli containing the first product plasmid and the second product plasmid in the embodiment of the present application, Figure 7 A1 is the field of view of E. coli under laser with wavelength of 488 nm at a first magnification, Figure 7 A2 is the field of view of E. coli under bright field, Figure 7 A3 is the superposition of the field of view of E. coli under excitation light with wavelength of 488 nm and the field of view under bright field, Figure 7 B1 is the field of view of E. coli under laser with wavelength of 488 nm at a second magnification, Figure 7 B2 is the field of view of E. coli under bright field, Figure 7 B3 is the superposition of the field of view of E. coli under excitation light with wavelength of 488 nm and the field of view under bright field, Figure 7 C1 is the field of view of E. coli under laser with wavelength of 488 nm at a third magnification, Figure 5 C2 is the field of view of E. coli under bright field, Instrument name C3 is the superposition of the field of view of E. coli under excitation light with wavelength of 488 nm and the field of view under bright field. DETAILED DESCRIPTION

[0033] The following examples are provided to better further understand the present application, and are not limited to the best mode, and do not constitute a limitation on the content and protection scope of the present application. Any person under the inspiration of the present application or the combination of the present application with other prior art features, any product same or similar to the present application, falls within the protection scope of the present application.

[0034] The specific experimental steps or conditions not mentioned in the examples can be carried out according to the conventional experimental steps described in the literature or the operation or conditions. The reagents or instruments not mentioned by the manufacturer are conventional reagent products that can be obtained by market purchase.

[0035] In the embodiment of the present application, E. coli is used as a chassis, and light-driven proton pump protein is expressed in polarity to realize the fusion of the light-driven proton pump protein and Rigion 1 in IcsA protein (i.e., as Genebank accession number AY294290.1, residue sequence number is 1-104) to realize the polar positioning of the ion channel, meet the purpose of the potential difference between the two poles of the engineering bacteria when receiving appropriate light stimulation, and after a discharge, the self-provided ion pump can play a function to quickly restore the resting state to receive the next light stimulation, and the ion pump plays a function. Further, by biotinylating the polar positioning IcsA protein, mixing the engineering bacteria and streptavidin-coated magnetic beads to realize the connection of the magnetic beads and the engineering bacteria, the purpose of the directional regulation of the engineering bacteria is met.

[0036] All materials, equipment and reagents in the embodiment of the present application are as follows:

[0037] Materials:

[0038] Strains: E. coli (Escherichia coli, E. coli) DH5α, DE3 strains are preserved in the laboratory.

[0039] Plasmids: The prokaryotic expression vector GEP-pET-30a(+) is the first vector (the sequence is as shown in SEQ ID NO: 15), and the eukaryotic expression vector pGADT7 is the fourth vector (the sequence is as shown in SEQ ID NO: 16) preserved in the laboratory.

[0040] Gene information:

[0041] IcsA (Rigion 1), Genbank accession number: AY294290.1 (residue 1-104 number);

[0042] GR (light-driven proton pump), Genbank accession number: NP_923144;

[0043] BirA (R118G, biotin ligase), Addgene plasmid number: 36047;

[0044] The gene sequence of the fluorescent protein gene GFP is SEQ ID NO: 14.

[0045] Note that the gene sequence of the biotin ligase is Addgene plasmid No. 36047, and is referenced from the literature Roux KJ, Kim DI, Raida M, Burke B. A promiscuous biotin ligase fusion protein identifies proximal and interacting proteins in mammalian cells. J Cell Biol. 2012 Mar 19;196(6):801-10. doi: 10.1083 / jcb.201112098. Epub 2012 Mar 12. PMID: 22412018; PMCID: PMC3308701.

[0046] Reagents: Agarose gel DNA recovery kit, rapid plasmid extraction kit, Taq DNA polymerase, mis-purchased from Tiangen Biosciences (Beijing) Co., Ltd.; Q5 high-fidelity enzyme, purchased from NEB company; restriction endonuclease, purchased from TaKara company; seamless cloning kit, purchased from Selleck company; all-trans retinal, purchased from Aladdin company; D-biotin, purchased from Biotopped company; magnetic beads, purchased from Invitrogen company; other chemical reagents, purchased from National Pharmaceutical Group.

[0047] The main instruments and equipment are shown in Table 1.

[0048] Table 1 Instrument and equipment information

[0049] Model Manufacturer Thermostatic oscillator THZ-C Taicang Haocheng Experimental Instrument Manufacturing Co., Ltd. Thermostatic oscillator ZQPZ-115 Tianjin Leibolter Instrument Equipment Co., Ltd. Oscillating incubator Multitron Standard INFORS AG Ultra-clean bench JBCJ-2FD Suzhou Jiabao Purification Engineering Equipment Co., Ltd. Small high-speed centrifuge Centrifuge 5424 Eppendorf Micro pipette gun 10 μL-1000 μL Eppendorf Vertical refrigerated cabinet SC-316 Hair Refrigerator-freezer BCD-256KF B Hair PCR amplifier Bio-Rad T100 Visible spectrophotometer SOPTOP Shunyu Optics Technology Co., Ltd. Laser confocal scanning microscope ZEISS710 Carl Zeiss Company Laser confocal scanning microscope ZEISS880 Carl Zeiss Company High-pressure sterilization pot GI54TW Beijing Zimeng Technology Co., Ltd. Ultra-pure water purifier Milli-Q Millipore Electrophoresis instrument DYY-7C Beijing Liuyi Instrument Factory pH meter STARTER 3100 Oakwood Instrument (Shanghai) Co., Ltd. Ingredient

[0050] LB medium: take 2.5 g of yeast extract, 5 g of tryptone, 5 g of sodium chloride, and use deionized water to make up to 500 mL, sterilize at 121℃ high temperature and high pressure for 15 min, when the medium temperature drops to 50-60℃, add screening antibiotics (working concentration 100 mg / L of kanamycin (Kana), working concentration 100 mg / L of ampicillin (Amp)) to the medium, then pour the plate; add 7.5 g of agar to the formula of solid medium.

[0051] 2-fold nutrient LB medium: take 5 g of yeast extract, 10 g of tryptone, 5 g of sodium chloride, and use deionized water to make up to 500 mL, sterilize at 121℃ high temperature and high pressure for 15 min, when the medium temperature drops to 50-60℃, add screening antibiotics (working concentration 100 mg / L of kanamycin or working concentration 100 mg / L of ampicillin (Amp)) to the medium, then pour the plate; add 7.5 g of agar to the formula of solid medium.

[0052] Antibiotic preparation: the corresponding mass of kanamycin (Kana) and ampicillin (Amp) powder was weighed and dissolved in 10 mL of deionized water. After complete dissolution, the solution was filtered with a 0.22 μM filter membrane in a clean bench to remove bacteria, and then was divided into 1.5 mL centrifuge tubes and stored at -20℃. The concentration of Kana was 50 mg / mL, and the concentration of Amp was 100 mg / mL.

[0053] The corresponding mass of isopropyl-β-D-thiogalactoside (IPTG) was weighed and dissolved in deionized water. After complete dissolution, an IPTG solution with a concentration of 500 mM was prepared, filtered with a 0.22 μM filter membrane in a clean bench to remove bacteria, and then divided into 1.5 mL centrifuge tubes and stored at -20℃.

[0054] The corresponding mass of all-trans retinal was weighed and dissolved in dimethyl sulfoxide. After complete dissolution, an all-trans retinal solution with a concentration of 10 mM was prepared, filtered with a 0.22 μM filter membrane in a clean bench to remove bacteria, and then divided into 1.5 mL centrifuge tubes and stored at -20℃.

[0055] The corresponding mass of D-biotin was weighed and dissolved in dimethyl sulfoxide. After complete dissolution, a D-biotin solution with a concentration of 250 mM was prepared, filtered with a 0.22 μM filter membrane in a clean bench to remove bacteria, and then divided into 1.5 mL centrifuge tubes and stored at -20℃.

[0056] 0.02922 g of NaCl, 0.05550 g of CaCl2, and 0.06019 g of MgSO4 were weighed and dissolved in 40 mL of deionized water. 500 μL of Tris-HCl (pH = 7.5) was added and stirred uniformly, and then the volume was adjusted to 50 mL to form a starvation solution, which was stored at room temperature.

[0057] Example

[0058] 1. Vector construction

[0059] 1.1. Synthesis of target gene

[0060] The GR gene was codon-optimized by GenScript for E. coli as the target organism, and after synthesis, it was cloned into the first vector pET-30a(+) (SEQ ID NO: 23) to form the second vector GR-pET-30a(+). The specific sequence of the second vector is SEQ ID NO: 19.

[0061] The residues of IcsA sequence 1-104 were codon-optimized by GenScript for E. coli as the target organism, and after synthesis, they were cloned into the first vector pET-30a(+) to form the third vector IcsA-pET-30a(+). The specific sequence of the third vector is SEQ ID NO: 20.

[0062] The BirA (R118G) gene codon optimization was performed by GenScript Corporation with E. coli as the target organism, and after synthesis, all were cloned into the first vector pET-30a (+) to form the fifth vector BirA-pET-30a (+). The specific sequence of the fifth vector is SEQ ID NO: 22, and the sequence of the second product plasmid obtained by recombination and transformation of the third vector and the fifth vector is SEQ ID NO: 21.

[0063] The second vector GR-pET-30a (+) as a template (SEQ ID NO: 19) was used for PCR reaction using primers numbered 1 and 2 (SEQ ID NO: 4-5) and the PCR amplification reaction program in Table 2 and the PCR amplification reaction program in Table 3, and the first target product was obtained by agarose gel electrophoresis loading and DNA recovery;

[0064] The third vector IcsA-pET-30a (+) as a template (SEQ ID NO: 20) was used for PCR reaction using primers numbered 3 and 4 (SEQ ID NO: 10-11) and the PCR amplification reaction program in Table 2 and the PCR amplification reaction program in Table 3, and the third target product was used as a template, and primers numbered 3 and 5 (SEQ ID NO: 10, 12) were used for PCR reaction according to the PCR amplification reaction program in Table 2 and the PCR amplification reaction program in Table 3, and the fourth target product was obtained by agarose gel electrophoresis loading and DNA recovery;

[0065] The first product plasmid sequence obtained by recombination and transformation of the first vector, the second vector and the first target product according to the steps of the present embodiment is SEQ ID NO: 17.

[0066] The second product plasmid sequence obtained by recombination and transformation of the third vector, the fifth vector and the fourth target product according to the steps of the present embodiment is SEQ ID NO: 21.

[0067] In order to verify the experiment, the GEP gene was connected to the first vector to form the first vector 'GEP-pET-30a (+)', and the GR gene codon optimization was performed by GenScript Corporation with E. coli as the target organism, and after synthesis, all were cloned into the first vector 'GEP-pET-30a (+)' to form the second vector 'GR-GFP-pET-30a (+)', and the specific sequence is SEQ ID NO: 3.

[0068] Further, the fluorescent protein gene GFP is also fused on the IcsA gene, and the Jinersi Company is commissioned to code optimize the residues of IcsA sequence 1-104, and then the synthesized code is cloned on the first vector 'GEP-pET-30a(+)' to form the third vector 'IcsA-GFP-pET-30a(+)', and the specific sequence of the third vector is SEQ ID NO: 6.

[0069] Further, the fluorescent protein gene GFP is also fused on the BirA gene, and the Jinersi Company is commissioned to code optimize the BirA(R118G) gene, and then the synthesized code is cloned on the first vector 'GEP-pET-30a(+)' to form the fifth vector 'BirA-GFP-pET-30a(+)', and the specific sequence of the fifth vector is SEQ ID NO: 13.

[0070] Further, in order to verify the experiment, the second vector GR-GFP-pET-30a(+) is used as a template (SEQ ID NO: 3), the primers numbered 1 and 2 (SEQ ID NO: 4-5) are used, the PCR amplification reaction program in Table 2 and the PCR amplification reaction program in Table 3 are used for PCR reaction, the first target product is obtained by agarose gel electrophoresis and DNA recovery;

[0071] Further, the third vector IcsA-GFP-pET-30a(+) is used as a template (SEQ ID NO: 6), the primers numbered 3 and 4 (SEQ ID NO: 10-11) are used, the PCR amplification reaction program in Table 2 and the PCR amplification reaction program in Table 3 are used for PCR reaction, the third target product is used as a template, the primers numbered 3 and 5 (SEQ ID NO: 10, 12) are used, the PCR amplification reaction program in Table 2 and the PCR amplification reaction program in Table 3 are used for PCR reaction, and the fourth target product is obtained by agarose gel electrophoresis and DNA recovery;

[0072] The first product plasmid' sequence obtained by recombination and transformation of the first vector', the second vector' and the first target product' is SEQ ID NO: 1.

[0073] The second product plasmid' sequence obtained by recombination and transformation of the third vector', the fifth vector' and the fourth target product' is SEQ ID NO: 9.

[0074] The method of agarose gel electrophoresis weighs the appropriate amount of agarose according to the sample quantity and measures the corresponding volume of 1xTAE, heats in the microwave oven until the agarose is completely dissolved, and after the gel solution is slightly cooled, adds the fluorescent dye according to the ratio of 25 μL / 100 mL, then pours into the gel tank and waits for 30 min to completely solidify. Then, according to the experimental needs, sample and set a reasonable electrophoresis time, after electrophoresis, develop.

[0075] The method of recovering DNA in agarose gel is to cut the gel block containing the target band with a scalpel, put it into a 1.5 mL centrifuge tube, then follow the Tiangen agarose gel DNA recovery kit steps, dissolve the DNA in deionized water, and store it in a refrigerator at -20°C.

[0076] Table 2 PCR amplification reaction system

[0077] Volume Primer F (10 μM) 2 μL Primer R (10 μM) 2 μL Plasmid or PCR product 1 μL Q5 high-fidelity enzyme 25 μL Deionized water Supplemented to 50 μL Ingredient

[0078] Table 3 PCR amplification reaction system

[0079]

[0080] Table 4 primer information

[0081]

[0082]

[0083] 1.2, recombinant vector

[0084] According to the enzyme digestion system in Table 5, the synthesized third vector 'IcsA-GFP-pET-30a(+) and the synthesized fifth vector 'BirA-GFP-pET-30a(+) are digested, and the specific steps are as follows: mix the enzyme digestion system in Table 5 in a PCR tube, place the PCR tube in a 37°C metal bath for 30 min, obtain the first vector digestion product and the second vector digestion product, and directly store them in a refrigerator at -20°C.

[0085] Table 5 Vector enzyme digestion system

[0086] Volume Ingredient Volume Vector 20 μL 10×buffer 5 μL Fast-cutting enzyme A 1 μL Deionized water Supplemented to 50 μL Fast-cutting enzyme B 1 μL Ingredient

[0087] According to the homologous recombination ligation system in Table 6, the first vector digestion product and the first target product are mixed, and the second vector digestion product and the fourth target product are mixed, and the ligation is carried out in a 37°C metal bath for 30 min, to realize the ligation of the vector and the target product, forming the first ligation product and the second ligation product.

[0088] Table 6 Homologous recombination ligation system

[0089] Content Ingredient Content Target gene fragment After dilution to 5-10 ng / μL, 1 μL was added 5×Cell buffer 2 μL Linear vector 5 μL Deionized water Supplemented to 10 μL Ligase 2 μL Ingredient

[0090] 1.3, transformation

[0091] The first ligation product and the second ligation product were respectively transferred to 50 μL DH5α E. coli competence, and rested on ice for 20 min. The competence was heat shocked at 42°C for 1 min, and rested on ice for 2 min after heat shock. 800 μL of LB without antibiotics was added, and the mixture was incubated at 37°C for 40 min. Then, the mixture was coated on LB solid medium with corresponding resistance (Kana) and incubated in a 37°C constant temperature incubator overnight.

[0092] The single colony was picked in the super-clean bench, mixed into the system after streaking on a blank plate, and reacted according to the PCR amplification reaction system in Table 7 and the PCR reaction program in Table 3. After electrophoresis and fluorescence imaging, the positive single colony was picked into 4 mL LB medium containing corresponding resistance (Kana), and incubated at 37°C on a shaker overnight.

[0093] The bacterial solution of overnight shaking culture was transferred to a 2 mL centrifuge tube, and centrifuged at 12000 g at room temperature for 1 min to collect the bacteria. The supernatant was discarded, and then the Tiangen rapid small plasmid extraction kit was operated according to the steps to obtain the first product plasmid' and the second product plasmid'. The first product plasmid' and the second product plasmid' were dissolved in deionized water and stored in a -20°C refrigerator. The sequencing of the plasmid was entrusted to Huada Gene or Qikgene. The sequence of the first product plasmid' is shown in SEQ ID NO: 1, and the sequence of the second product plasmid' is shown in SEQ ID NO: 9.

[0094] Table 7 Transformation PCR amplification reaction system

[0095] Volume Ingredient Volume Primer F (10 μM) 1 μL Taq DNA Polymerase mix 10 μL Primer R (10 μM) 1 μL Deionized water Supplemented to 20 μL Figure 1

[0096] The forward primer and the reverse primer of the transformation PCR of the first product plasmid' are numbered 1 and 2 in Table 4 (SEQ ID NO: 4-5), and the forward primer and the reverse primer of the transformation PCR of the first product plasmid' are numbered 3 and 5 in Table 4 (SEQ ID NO: 10 and 12).

[0097] The preparation method of the E. coli competence is as follows:

[0098] 1. The DH5α competence was streaked on LB without antibiotics, and incubated in a 37°C constant temperature incubator overnight. 2. The colony of overnight culture was picked and inoculated in 5 mL LB without antibiotics, 200 g, and incubated at 37°C on a shaker overnight. 3. The 5 mL bacterial solution was inoculated in 500 mL SOD culture medium, 180 g, and incubated at 18°C on a shaker. The OD of the bacterial solution was detected during the incubation. 600Value to 0.35-0.4; 4, quickly the bacteria liquid on ice for 10 min; 5, with 50 mL centrifuge tube 5000g, 4℃ bacteria collection, discard supernatant; 6, with pre-cooled TB solution gently suspended cell precipitate (500mL SOD medium plus 160mL TB solution), ice for 10 min; 7, 5000g, 4℃ bacteria collection, discard supernatant; 8, with pre-cooled TB solution gently suspended cell precipitate (500mL SOD medium plus 40mL TB solution); 9, to the suspended bacteria liquid plus DMSO to the final concentration of 7%, ice bath 2h, obtain E. coli competence; 10, the E. coli competence to 1.5mL sterile centrifuge tube (30-50μL / tube), and quickly placed in liquid nitrogen, -80℃ refrigerator storage.

[0099] 1.4, plasmid fusion

[0100] The fourth vector plasmid pGADT7 as a template (SEQ ID NO: 16), using the primer numbered 6 and 7 in table 4 (SEQ ID NO: 7-8), with the PCR amplification reaction program of table 2 and the PCR amplification reaction program of table 3, the second target product is obtained by PCR reaction;

[0101] The first product plasmid template is digested according to the enzyme digestion system of table 5, the specific steps are as follows: mix the enzyme digestion system in table 5 in the PCR tube, and place the PCR tube in the 37℃ metal bath for 30 min to obtain the third vector digestion product. The third vector digestion product and the second target product are mixed according to the homologous recombination connection system of table 6, and the connection of the vector and the target product is realized in the 37℃ metal bath for 30 min to form the third connection product.

[0102] The third connection product is transformed according to the steps of 1.3 to obtain the third product plasmid, and the sequence of the third product plasmid is SEQ ID NO: 18.

[0103] In order to verify the experiment, the first product plasmid 'template is digested according to the enzyme digestion system of table 5, the specific steps are as follows: mix the enzyme digestion system in table 5 in the PCR tube, and place the PCR tube in the 37℃ metal bath for 30 min to obtain the third vector digestion product. The third vector digestion product and the second target product 'are mixed according to the homologous recombination connection system of table 6, and the connection of the vector and the target product is realized in the 37℃ metal bath for 30 min to form the third connection product.

[0104] The third connection product is transformed according to the steps of 1.3 to obtain the third product plasmid ', and the sequence of the third product plasmid 'is SEQ ID NO: 2.

[0105] The genetic sequence information of each vector, product plasmid and the like in the embodiment is as follows:

[0106] SEQ ID NO: 1, first product plasmid'sequence:

[0107]

[0108] SEQ ID NO: 2, third product plasmid' sequence:

[0109]

[0110] SEQ ID NO: 3 Sequence of the second vector 'GR-GFP-pET-30a(+):

[0111]

[0112] SEQ ID NO: 6, Third vector 'IcsA-GFP-pET-30a(+) sequence:

[0113]

[0114] SEQ ID NO: 9, second product plasmid' sequence:

[0115]

[0116] SEQ ID NO: 13, Fifth vector 'BirA-GFP-pET-30a(+) sequence:

[0117]

[0118] SEQ ID NO: 14, GFP gene sequence:

[0119] ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCTTCACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCACGGCATGGACGAGCTGTACTGA;

[0120] SEQ ID NO: 15, first vector 'GEP-pET-30a(+) sequence:

[0121]

[0122] SEQ ID NO: 16, fourth vector pGADT7 sequence:

[0123]

[0124] SEQ ID NO: 17, first product plasmid sequence:

[0125]

[0126] SEQ ID NO: 18, third product plasmid sequence:

[0127]

[0128] SEQ ID NO: 19 sequence of the second vector GR-pET-30a(+):

[0129]

[0130] SEQ ID NO: 20, Third vector IcsA-pET-30a(+) sequence:

[0131]

[0132] SEQ ID NO: 21, second product plasmid sequence:

[0133]

[0134] SEQ ID NO: 22, fifth vector BirA-pET-30a(+) sequence:

[0135]

[0136] SEQ ID NO: 23, first vector pET-30a(+) sequence:

[0137]

[0138] 2. Performance verification

[0139] 2.1. Detection of polar localization protein function

[0140] 2.1.1. Respectively take 1 μL of the synthesized third carrier 'IcsA-GFP-pET-30a(+)' and the first product plasmid 'into 50 μL of DE3 E. coli competence, and stand on ice for 20 min. Heat shock the E. coli competence in a 42°C water bath for 1 min, and stand on ice for 2 min after heat shock. Add 800 μL of LB without antibiotics, and recover at 37°C for 40 min. Then, spread on the corresponding resistant LB solid medium, and invert in a 37°C constant temperature incubator for overnight culture.

[0141] 2.1.2. Draw a colony in 4 mL of LB medium containing the corresponding resistance (Kaba), and culture overnight at 37°C on a shaker. The next day, inoculate in 4 mL of LB medium containing the corresponding resistance at a ratio of 1:10, and culture at 37°C on a shaker for 4 h. Then, add IPTG at a final concentration of 0.5 mM, and induce at 22°C at 130 rpm for 16 h before microscopic examination.

[0142] The specific steps of microscopic examination are as follows:

[0143] (1) Film preparation: take 15 μL of mixed bacterial solution, and drop on the center of a glass slide. Cover the glass slide with forceps, and try not to generate bubbles during film preparation; (2) Turn on the microscope according to the sequence, open the software, and set the excitation wavelength. The excitation wavelength of EGFP is 488 nm; (3) Place the glass slide on the stage, set the parameters of the microscope, and first observe with a low-power lens. After finding the approximate position of the focus plane, switch to a high-power lens for observation. Add an appropriate amount of pine oil in time according to the type of lens, and take pictures and process the pictures with ZEN 2012 software; (4) After taking pictures, export the pictures, and turn off the instrument according to the sequence.

[0144] The microscopic examination results are shown in Figure 2 and Figure 1 From Figure 2 , it can be seen that a certain number of E. coli in the field of view have normal fluorescence localization at the old pole of the bacteria, and some E. coli have fluorescence at both ends. This is because they are in the division stage, and the proportion is small. The place where there is fluorescence aggregation is the old pole, and the place where there is no fluorescence aggregation is the new pole. If there is fluorescence at both ends, it is in the process of E. coli division, Figure 1-Figure 2 The orange arrow in the figure indicates the morphology of E. coli when the fluorescence is only distributed at the old pole of E. coli. According to Figure 3-Figure 4 , it can be seen that the first product plasmid 'exhibits similar polar localization phenomenon as the synthesized carrier IcsA-GFP-pET-30a(+)'.

[0145] 2.2, Proton pump function detection

[0146] 2.2.1, Respectively take 1 μL of the synthesized second vector 'GR-GFP-pET-30a(+)' and the first product plasmid 'into 50 μL of DE3 E. coli competence, stand on ice for 20 min, heat shock in a 42°C water bath for 1 min, stand on ice for 2 min after heat shock, add 800 μL of anti-LB to 37°C for 40 min, then coat on the corresponding resistant LB solid medium, and invert in a 37°C constant temperature incubator for overnight culture.

[0147] 2.2.2, Take the overnight treated E. coli competence, draw colonies in 4 mL of LB medium containing the corresponding resistance, culture at 37°C overnight, the next day inoculate in 40 mL of 2x nutrient LB medium containing the corresponding resistance at a ratio of 1:10, culture at 37°C for 4 h, add IPTG with a final concentration of 0.5 mM, 10 μM of all-trans retinal, and induce at 22°C for 16 h with 130 rpm shaking, then use a pH meter to detect the function of the proton pump.

[0148] 2.2.3, Centrifuge at 5500 rpm for 10 min to collect the bacteria, and resuspend in a small beaker containing 25 mL of starvation solution, add a magnetic rotor, wrap the small beaker with tin foil, and place it on a magnetic stirrer for 1 h of recovery. After recovery, insert the pH probe below the liquid surface, record the initial pH, and start the light-dark alternation for 5 min (0-5 min, 10-15 min and 20-25 min are light, and the remaining time is dark), measure the pH every minute, and the measurement process lasts for 30 min.

[0149] The results are shown in Figure 3 From Figure 4 the pH change, it can be seen that GR can normally perform the function of light-driven proton pump when receiving light, pumping protons from the intracellular to the extracellular, and producing a sudden change in the pH of the surrounding environment; in the dark, the ion channels on the surface of the bacteria can allow protons to flow into the bacteria, restoring the pH of the surrounding environment, according to Figure 5 It can be seen that the E. coli containing the first product plasmid'still exhibits similar proton pump function as the vector GR-GFP-pET-30a(+)'.

[0150] 2.3, Magnetic bead polarity binding detection

[0151] 2.3.1, take 1 μL of the second product plasmid' to 50 μL of DE3 E. coli competence, stand on ice for 20 min, heat shock the E. coli competence in a 42°C water bath for 1 min, stand on ice for 2 min after heat shock, add 800 μL of LB without antibiotics to 37°C for 40 min, then spread on the corresponding resistant LB solid medium, and invert in a 37°C incubator overnight.

[0152] 2.3.2, the overnight treated E. coli competence, streak the colonies in 4 mL of LB medium containing the corresponding resistance, incubate at 37°C overnight, the next day inoculate 4 mL of LB medium containing the corresponding resistance (Kana) at a ratio of 1:10, incubate at 37°C for 4 h, add IPTG to a final concentration of 0.5 mM, and continue to shake at 22°C and 130 rpm for 10 h, then add 120 mM D-biotin and continue to shake under the same conditions, 4 h later mix the bacterial solution with the magnetic bead suspension at a ratio of 1:1 in a glass sample tube, incubate at room temperature for 1 h, and then perform microscopic examination. The method of microscopic examination is described in detail in 3.1.2.

[0153] The results are shown in Figure 6-Figure 7 It can be seen that, by using the second product plasmid', the biotinylation of BirA on the surface of live bacteria outside the membrane is successfully achieved, and the magnetic beads are combined with the old pole by means of streptavidin, which can further control the directional movement of the engineered bacteria by a magnetic field, providing a possibility for precise energy supply of the battery. E. coli divides by binary fission, and the two poles of the parent cell do not change during division, which are old poles, while the two new poles produced from the middle of the parent cell are new poles. By using the first product plasmid', the polar localization of the light-driven proton pump (GR) in E. coli is successfully achieved, and an engineered bacterium similar in structure to the electric eel power cell is constructed. When receiving light stimulation, the old pole membrane potential changes, and a potential difference is generated between the old and new poles, which successfully constructs the engineered bacteria as a battery with the old and new poles as the positive and negative electrodes. Further, by using the second product plasmid', the magnetic beads are combined with the old pole by means of streptavidin, which can control the directional movement of the engineered bacteria by a magnetic field.

[0154] 2.4, performance identification of the fusion strain

[0155] Take 1 μL of the second product plasmid' and the third product plasmid' respectively, and add them to 50 μL of DE3 E. coli competence at the same time, stand on ice for 20 min, heat shock the E. coli competence in a 42°C water bath for 1 min, stand on ice for 2 min after heat shock, add 800 μL of LB without antibiotics to 37°C for 40 min, then spread on the corresponding resistant LB solid medium, and invert in a 37°C incubator overnight.

[0156] The colonies were drawn on 4 mL of LB medium containing the corresponding resistance (antibodies Kana and apm, the concentration of Kana was 100 mg / L, the concentration of Amp was 100 mg / L), 37°C shaking overnight culture, the next day according to the ratio of 1:10 inoculated in 4 mL of LB medium containing the corresponding resistance, 37°C shaking culture for 4h, the final concentration of 0.5mM IPTG was added to 22℃ 130rpm induction for 16h to obtain the target strain, the performance of the fusion strain was identified according to the steps of steps 2.1-2.3, the results are shown in Figure 6-Figure 7 .

[0157] According to ​ It can be seen that the E. coli containing the first product plasmid'and the second product plasmid'exhibits similar proton pump function as the vector GR-GFP-pET-30a(+), and successfully realizes the biotinylation of the active bacterial surface protein by BirA outside the membrane, and realizes the binding of magnetic beads to the old pole by streptavidin, and further realizes the directional movement of the engineering bacteria by the magnetic field, which provides the possibility for the precise energy supply of the battery.

[0158] 2.5, test of the electrical activity of the constructed engineering bacteria:

[0159] Using the method in the literature "Ni L, Kc P, Mulvany E, et al. A microfluidic device for noninvasive cell electrical stimulation and extracellular field potential analysis [J]. Biomedical Microdevices, 2019, 21(1): 20.1-20.12. DOI: 10.1007 / s10544-019-0364-2.", a microfluidic device was manufactured, and the culture solution (OD 600 =1.137) of the target strain in 2.4 was loaded into the device instead of the cell cluster in the literature, and a flow controller was used to control the flow. After part of the bacteria reached the surface of the measuring electrode, the external stimulation voltage was selected in the literature, but in this simulation experiment, an external flash stimulation was required, and then the field potential signal of the part of the bacteria could be measured by the measuring electrode. By analyzing the measured field potential signal, the conclusion was obtained.

[0160] The OD 600 of the bacterial solution was 1.137, and the proportion of live bacteria (bacteria that could be observed to have a polar distribution of fluorescence) in the total was 1.34% in the microscopic examination, and the average length of the live bacteria in the microscopic examination was 3.83 μm and the average width was 0.52 μm.

[0161] The hydrogen ion concentration changes by 2.10*10 -9 M, 1.06*10 -9 M, 1.04*10 -9 M, and the average is 1.40*10 -9 M.

[0162] According to the calculation formula of the bacterial concentration, OD 600 = 1.137, the bacterial concentration is 1.137*10 9 / mL, and the number of viable bacteria per milliliter of culture solution is 1.52*10 7 , and the hydrogen ion change caused by a single bacterium is 9.21*10 -20 mol, that is, 5.55*10 4 hydrogen ions are pumped out by each bacterium in a single light stimulation. It can be calculated that the hydrogen ion flow at the bacterial pole per unit time is 185 / s.

[0163] The single E. coli is abstracted as a cylinder, and one end of the ion channel is a circular biological membrane with a diameter of 0.52pm. According to the E. coli membrane capacitance data provided in the literature “Ekaterina Krasnopeeva, Chien-Jung Lo, Teuta Pilizota, Single-Cell Bacterial Electrophysiology Reveals Mechanisms of Stress-Induced Damage, Biophysical Journal, 116, 2019.”, the capacitance can be calculated as 1.91*10 -16 F, further, by the hydrogen ion flow and the number of hydrogen ion charges, the change in the membrane potential of the pole caused by the change is 0.1553V, and the difference between the membrane potentials of the other pole is 0.1553V.

[0164] Through the above experiment, it can be proved that the engineering bacteria provided by the application have electrical activity and can be used as raw materials for microbial batteries.

[0165] Obviously, the above embodiments are only examples for clearly illustrating, and not limited to the implementation. For those skilled in the art, other different forms of changes or variations can be made on the basis of the above description. Here, all the implementation is not exhaustive. The obvious changes or variations derived therefrom are still within the protection scope of the application.

Claims

1. A fusion gene for a microbial battery, characterized by, The fusion gene A and the fusion gene B are included; The fusion gene A includes an IcsA gene and a light-driven proton pump gene GR; The fusion gene B includes an IcsA gene, an Avi gene and a BirA gene.

2. A recombinant vector for use in a microbial battery, characterized in that, It includes: The recombinant vector containing the fusion gene A in claim 1, and the sequence of the recombinant vector containing the fusion gene A is shown in SEQ ID NO: 17 or SEQ ID NO: 18; And, the recombinant vector containing the fusion gene B in claim 1, and the sequence of the recombinant vector containing the fusion gene B is shown in SEQ ID NO:

21.

3. The construction method of the recombinant vector for the microbial battery in claim 2, wherein, The construction method of the recombinant vector containing the fusion gene A includes the following steps, PCR reaction is carried out by using the second vector as a template and using the first primer and the second primer, the sequence of the second vector is shown in SEQ ID NO: 3, the sequence of the first primer is shown in SEQ ID NO: 4, and the sequence of the second primer is shown in SEQ ID NO: 5; The third vector is digested, and the first target product is subjected to homologous recombination to form the recombinant vector containing the fusion gene A, and the sequence of the third vector is shown in SEQ ID NO: 20; And, The construction method of the recombinant vector containing the fusion gene B includes the following steps, PCR reaction is carried out by using the third vector as a template and using the fifth primer and the sixth primer to obtain the third target product, and PCR reaction is carried out by using the third target product as a template and using the fifth primer and the seventh primer to obtain the fourth target product, wherein the sequence of the third vector is SEQ ID NO: 20, the sequence of the fifth primer is SEQ ID NO: 10, the sequence of the sixth primer is SEQ ID NO: 11, and the sequence of the seventh primer is SEQ ID NO: 12; The fifth vector is digested, and the fourth target product is subjected to homologous recombination to form the recombinant vector containing the fusion gene B, wherein the sequence of the fifth vector is SEQ ID NO:

22.

4. The method for constructing a recombinant vector for a microbial cell according to claim 3, wherein The second vector is a vector in which the first vector is used as a template and the codon of the optimized light-driven proton pump gene is inserted, and the sequence of the light-driven proton pump gene is shown in Genebank accession number WP_011140202.1, and the sequence of the first vector is SEQ ID NO:

23.

5. The method for constructing a recombinant vector for a microbial cell according to claim 3, wherein The third vector is a vector in which the first vector is used as a template and the codon of the optimized IcsA residue is inserted, and the sequence of the IcsA gene is shown in Genebank accession number AY294290.1, and the residue sequence number is 1-104.

6. The method for constructing a recombinant vector for a microbial cell according to claim 3, wherein Further including the step of resistance conversion, and the specific steps are as follows, PCR reaction is carried out by using the fourth vector as a template and using the third primer and the fourth primer to obtain the second target product, the fourth vector is pGADT7, the sequence of the third primer is shown in SEQ ID NO: 7, and the sequence of the fourth primer is shown in SEQ ID NO: 8; The recombinant vector containing the fusion gene A is digested, and the second target product is subjected to homologous recombination to form the recombinant vector of resistance conversion.

7. The method for constructing a recombinant vector for a microbial cell according to any one of claims 3 to 6, wherein The fifth vector is a vector with codon-optimized biotin ligase gene inserted into the first vector as a template, and the biotin ligase is BirA enzyme; The third vector is a vector with codon-optimized IcsA residue inserted into the first vector as a template, and the IcsA gene sequence is as shown in Genebank accession number AY294290.1, and the residue sequence number is 1-104.

8. A biomaterial, characterized by, The biological material comprises the fusion gene for microbial battery according to claim 1, the recombinant vector for microbial battery according to claim 2, or the recombinant vector for microbial battery constructed by the construction method according to any one of claims 2-7.

9. The biomaterial of claim 8, wherein, The construction method of the biological material comprises introducing the fusion gene for microbial battery according to claim 1, the recombinant vector for microbial battery according to claim 2, or the recombinant vector for microbial battery constructed by the construction method according to any one of claims 2-7 into a chassis cell, Optionally, the chassis cell is selected from Escherichia coli, Optionally, the method further comprises streptavidin-coated magnetic beads.

10. Use of the biological material according to any one of claims 8-9 in constructing an electroactive engineered bacterium or constructing a microbial battery.