Application of CsPOD7 in cucumber haploid breeding

By knocking out the cucumber CsPOD7 gene using CRISPR/Cas9 gene editing technology, a cucumber parthenogenetic haploid induction line was created, solving the problem of low efficiency in cucumber haploid breeding in existing technologies and achieving a highly efficient breeding process.

CN120829924BActive Publication Date: 2026-01-27CHINA AGRI UNIV SANYA RES INST
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202511331534.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-09-18
Publication Date
2026-01-27
Estimated Expiration
2045-09-18

AI Technical Summary

Technical Problem

Current cucumber haploid breeding technology mainly relies on in vitro haploid induction, which is inefficient and easily affected by genotype and culture conditions. There is a lack of effective in vivo parthenogenetic haploid induction lines.

Method used

By using CRISPR/Cas9 gene editing technology to knock out or silence the cucumber CsPOD7 gene, a cucumber parthenogenetic haploid induction line was created. The cucumber haploid induction line was constructed by genetic engineering and identified using fluorescent labeling and flow cytometry.

Benefits of technology

A haploid induction line was successfully developed in cucumber, which improved haploid breeding efficiency, shortened breeding time, and provided a new technical means for efficient breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120829924B_ABST
    Figure CN120829924B_ABST
Patent Text Reader

Abstract

The application discloses a gene CsPOD7 The application belongs to the technical field of molecular breeding and is applied to haploid breeding of cucumber. CsPOD7 The application clones a parthenogenic haploid induction gene CsPOD7 from cucumber, knocks out the gene cspod7 by CRISPR-Cas9 gene editing technology, and crosses the mutant as a male parent with other cucumber materials as female parents to generate parthenogenic haploids. CsPOD7 The application is the first application of developing a parthenogenic haploid induction line in dicotyledonous plants, realizes the application of the haploid induction line based on the gene CsPOD7 CsPOD7 CsPOD7 CsPOD7 CsPOD7 CsPOD7 CsPOD7 CsPO in cucumber genetic breeding, accelerates the breeding process of cucumber, and has great potential application value and market prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of plant genetic engineering and plant genetic breeding, and more specifically, to genes. CsPOD7 Application in cucumber haploid breeding. Background Technology

[0002] cucumber( Cucumissativus Cucumber (L.) is one of the most widely cultivated vegetable crops globally, possessing high economic and nutritional value and enjoying great popularity among consumers. Meanwhile, cucumber is also one of my country's important vegetable crops, holding a significant position in the country's agricultural production. According to data released by the Food and Agriculture Organization of the United Nations (FAO), in 2022, China's cucumber planting area was approximately 1.31 × 10⁶ hm², with a total output of 77.31 million tons, accounting for 60.3% and 81.6% of the global cucumber planting area and output, respectively. Therefore, cultivating high-yielding, highly resistant, and high-quality cucumber varieties is a primary goal of market demand. However, cucumber breeding still mainly relies on the traditional method of obtaining stable genetic material through multiple generations. This lengthy process severely hinders the progress of cucumber genetic breeding. Haploid breeding technology, which can obtain stable homozygous material in just two generations, is one of the important techniques in modern breeding. To date, cucumber haploid breeding technology has only been used to a limited extent, primarily through in vitro haploid induction. This method is easily affected by factors such as genotype and culture conditions, resulting in very low haploid induction efficiency. Furthermore, our previous use of gene... CsDMP A haploid induction line for in vivo parthenogenesis haploidization in cucumber has been developed. In order to improve the promotion and application efficiency of cucumber haploid induction lines, it is necessary to further develop more haploid induction lines for in vivo parthenogenesis haploidization based on different genes. Summary of the Invention

[0003] The technical problem to be solved by this invention is to provide genes. CsPOD7 Application in cucumber haploid breeding.

[0004] To achieve the objectives of this invention, in a first aspect, this invention provides a gene. CsPOD7 Application in cucumber haploid breeding.

[0005] In this invention, cucumber CsPOD7 The nucleotide sequence of the gene is as follows:

[0006] (a) The nucleotide sequence shown in SEQ ID NO:1; or

[0007] (b) A nucleotide sequence of the nucleotide sequence shown in SEQ ID NO:1 that has been substituted, deleted and / or added with one or more nucleotides and expresses a protein with the same function;

[0008] (c) A nucleotide sequence that hybridizes with the sequence shown in SEQ ID NO:1 under stringent conditions and expresses the same functional protein, wherein the stringent conditions are hybridization at 65°C in 0.1×SSPE containing 0.1% SDS or 0.1×SSC containing 0.1% SDS and washing the membrane with the solution; or (d) A nucleotide sequence that has more than 80% homology with the nucleotide sequences of (a), (b) or (c) and expresses the same functional protein.

[0009] cucumber CsPOD7 The amino acid sequence of the protein encoded by the gene is as follows:

[0010] (a) The amino acid sequence shown in SEQ ID NO:2; or

[0011] (b) An amino acid sequence having equivalent functional activity by substituting, deleting and / or adding one or more amino acids of the amino acid sequence shown in SEQ ID NO:2.

[0012] (c) An amino acid sequence that is more than 80% identical to any of the amino acid sequences defined in (a) or (b) and is derived from cucumber and has the same function.

[0013] Furthermore, the application includes: using at least one of the following methods to manipulate cucumber genes: mutagenesis, site-directed mutagenesis, homologous recombination, etc. CsPOD7 The gene is modified to lose or weaken its function.

[0014] Secondly, this invention provides a method for constructing a cucumber parthenogenetic haploid inducible line, which utilizes genetic engineering techniques to knock out cucumber genes. CsPOD7 Or silence or suppress cucumber genes. CsPOD7 By expressing the gene, positive transgenic plants are obtained, which are the cucumber parthenogenetic haploid induction lines.

[0015] Furthermore, the gene knockout, silencing, or repression methods can be selected from at least one of CRISPR / Cas9, TALEN gene editing technology, EMS mutagenesis, T-DNA insertion, RNAi interference, promoter mutation, and VIGS interference.

[0016] The knockout CsPOD7 Genes that enable the cucumber genome CsPOD7 The expression level of [something] is reduced or [something] in the cucumber genome is reduced. CsPOD7 Genes undergo mutations involving base insertion, deletion, or substitution.

[0017] Preferably, the cucumber gene is knocked out using CRISPR / Cas9 gene editing technology. CsPOD7 .

[0018] The method includes: using genes CsPOD7To target the target, a CRISPR / Cas9-based sgRNA sequence was designed. A DNA fragment containing the sgRNA sequence was ligated into a vector carrying CRISPR / Cas9 (such as the pKSE402 vector) and transformed into cucumber.

[0019] Preferably, the nucleotide sequence of the sgRNA action site is 5'-TCGGTTATTACCAAAAAAC-3' and 5'-TGCTAAGACCAACCTCGAA-3'.

[0020] Thirdly, the present invention provides the application of transgenic plants obtained according to the method in cucumber breeding. Breeding methods include, but are not limited to, transgenic, hybridization, backcrossing, self-pollination, or asexual reproduction.

[0021] Fourthly, this invention provides a method for preparing and identifying cucumber haploids. The method for preparing cucumber haploid inducible lines includes: using CRISPR / Cas9 gene editing technology to knock out cucumber... CsPOD7 Gene editing was performed to obtain homozygous edited plants that stably carry green fluorescence, which are the cucumber haploid induction lines. The cucumber haploid induction lines obtained using the above method, or their self-pollinated offspring, were used as the male parent and crossed with other cucumber materials used as the female parent. The resulting hybrid offspring were subjected to haploid phenotypic identification, fluorescent labeling identification, or ploidy identification. Hybrid offspring plants identified as haploid by at least one method were selected as the cucumber parthenogenetic haploids.

[0022] The beneficial effects of this invention are:

[0023] This invention reveals the gene for the first time CsPOD7 Its biological function is to induce parthenogenesis and haploidy in cucumbers, and it was knocked out using CRISPR / Cas9 gene editing technology. CsPOD7 The gene then led to the creation of a cucumber parthenogenetic haploid induction line, which was further successfully demonstrated through hybridization experiments. CsPOD7 Gene mutations can induce parthenogenetic haploids in cucumbers. This invention is the first successful development of a knockout-based gene mutation in the dicotyledonous plant cucumber. CsPOD7 The in vivo haploid induction line for the gene is POD This provides a basis for the application of genes in haploid breeding of dicotyledonous plants, provides materials for improving the efficiency of haploid breeding of cucumbers, and is of great significance in accelerating the cucumber breeding process. It has huge application value and market prospects. Attached Figure Description

[0024] Figure 1 The wild-type cucumber material Changchun dense-thorned in this invention and cspod7 Phenotypic images of the fruit and seeds of the mutant. A and B represent mature cucumber fruits and seeds of the wild type; C and D represent... cspod7Mature cucumber fruit and seeds of the mutant; E and F are wild type and cspod7 Mutant seed count statistics. *** indicates statistically significant differences between treatment groups, *** indicates... P <0.001. Among these, "absentee seeds" refers to seeds that did not form a normal embryo, representing a normal phenotypic statistic.

[0025] Figure 2 The images show the results of fluorescence screening of cucumber haploid seeds. Figure A is the actual image under normal light, and Figure B is the fluorescence image.

[0026] Figure 3 This is a phenotypic comparison of diploid and haploid cucumber plants and leaves.

[0027] Figure 4 This is a flow cytometry result graph of diploid and haploid cucumber plants. Detailed Implementation

[0028] This invention provides a method for creating a cucumber parthenogenetic haploid inducible line using gene editing technology, particularly... cspod7 The application of mutant plants of the gene as parthenogenetic haploid induction lines in inducing parthenogenetic haploids in cucumbers.

[0029] The technical solution adopted in this invention is as follows:

[0030] This invention provides a method for preparing a cucumber parthenogenetic haploid inducible line, the method comprising: knocking out CsPOD7 Genes may be silenced or suppressed. CsPOD7 By expressing the gene, positive transgenic plants are obtained, which are the cucumber parthenogenetic haploid induction lines.

[0031] In the method described above, the knockout refers to the elimination of certain components in the cucumber genome. CsPOD7 Gene mutations involving base insertion, deletion, or substitution, or silencing or repression, can cause changes in the cucumber genome. CsPOD7 Gene expression levels are reduced.

[0032] In the method described, the knockout of cucumber genome CsPOD7 Methods include CRISPR / Cas9, EMS mutagenesis, T-DNA insertion, or TALEN.

[0033] In the method described, silencing or inhibiting the cucumber genome CsPOD7 The ways in which expression levels are reduced include RNAi interference, promoter mutation, or VIGS interference.

[0034] Furthermore, the method described in the cucumber genome CsPOD7 The method that allows for base insertion, deletion, or substitution is the CRISPR / Cas9 gene editing technology.

[0035] Furthermore, the target sequence of the CRISPR / Cas9 is positions 86-104 and / or positions 324-342 of SEQ ID NO:1.

[0036] In one specific embodiment of the present invention, the step of making cucumber genome CsPOD7 The method for generating gene mutations involving base insertion, deletion, or substitution involves the following steps: CsPOD7 The target sequence was introduced into a CRISPR / Cas9 vector, and then Bacillus thuringiensis introduced the vector into the cucumber genome by infecting cucumber cotyledons. Positive transgenic plants were obtained by screening with green fluorescence.

[0037] The present invention also provides a method for preparing cucumber parthenogenetic haploids, the steps of which are as follows: the cucumber parthenogenetic haploid induction line obtained by the above method is used as the male parent and hybridized with other cucumber materials as the female parent. The hybrid offspring are identified by screening with green fluorescent labeling, flow cytometry ploidy detection or phenotypic observation. The hybrid offspring plants identified as haploids by at least one method are selected as cucumber parthenogenetic haploids.

[0038] The method for screening haploids using green fluorescent labeling is performed as follows: In the presence of... CsPOD7 The target sequence is contained in a CRISPR / Cas9 vector with an EGFP expression cassette. Fluorescence irradiation is used to perform preliminary haploid screening on freshly harvested hybrid seeds. If the hybrid seeds show no green fluorescence and are generally small and shriveled, they are considered candidate haploids; if the tested seeds show green fluorescence and are generally normal and plump, they are heterozygous diploids.

[0039] The haploid ploidy identification method includes the following steps: The candidate haploids are sown and allowed to grow to a suitable size. A 0.5 square centimeter sample of a young leaf (approximately the size of a little fingernail) is taken and its nucleus extracted. The nucleus of a young leaf from a wild-type diploid cucumber material, Changchun Mici, is used as a control. First, the nucleus signal of the control material is detected using flow cytometry, with 100 being the peak value of the diploid nucleus signal. Then, the nucleus signal of the candidate haploids is detected using flow cytometry. If the detected signal peak is at 50, the plant is considered a haploid plant; if the detected signal peak is at 100, the plant is considered a diploid plant.

[0040] The haploid phenotype identification method refers to the following: If the hybrid offspring plants are weak and exhibit characteristics such as dwarfism, smaller leaves and floral organs, and male sterility, then the plant is a candidate or haploid plant; if the hybrid offspring plants are strong and exhibit characteristics such as normal plant height, normal development of leaves and floral organs, and normal pollen activity, then they are considered normal diploid plants.

[0041] The present invention further provides a cucumber containing the above-mentioned cucumber. CsPOD7 Gene expression cassettes.

[0042] The present invention further provides a cucumber containing the above-mentioned cucumber. CsPOD7 Recombinant gene expression vectors.

[0043] The present invention further provides a cucumber containing the above-mentioned cucumber. CsPOD7 Engineered bacteria or transgenic cells containing genes or recombinant expression vectors.

[0044] This invention provides the above-mentioned cucumber CsPOD7 Application of the gene or the protein encoded by the gene in the creation of cucumber parthenogenetic haploid inducible lines.

[0045] The present invention further provides the above-mentioned cucumber CsPOD7 Application of the gene or a mutant of the gene-encoded protein in the induction of parthenogenetic haploids in cucumber.

[0046] The following examples are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, the examples are conducted under conventional experimental conditions, such as those described in Sambrook et al., Molecular Cloning: a Laboratory Manual (Sambrook J & Russell DW, 2001), or as recommended by the manufacturer's instructions.

[0047] The cucumber materials used in the following examples are Changchun Mici, 2073-1, and 2073-2, which were obtained from the Cucumber Genetic Improvement Research Group of China Agricultural University. (See attached image for details.) ​ (Chen eta1.,2016,171:1156-1168), ​ (Zhai et al., 2022, doi.org / 10.1093 / hr / uhac146), publicly available (for research and teaching purposes only).

[0048] The pKSE402 vector was donated by Professor Huang Sanwen of the Shenzhen Institute of Agricultural Genomics, Chinese Academy of Agricultural Sciences.

[0049] Example 1: Obtaining Cucumbers ​ Gene-edited plants

[0050] 1. Target sequence design of sgRNA sequences

[0051] Using the CRISPR-P v2.0 online website (http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR) to... ​ The nucleotide sequence of the gene was predicted, and two specific target site sequences of 19 bp in length were selected.

[0052] The first target site sequence is located at positions 86-104 of SEQ ID NO:1, and the sequence of the sgRNA1 target site is 5'-TCGGTTATTACCAAAAAAC-3'.

[0053] The second target site sequence is located at positions 324-342 of SEQ ID NO:1, and the sequence of the sgRNA2 target site is 5'-TGCTAAGACCAACCTCGAA-3'.

[0054] 2. CRISPR / Cas9 mediated ​ Construction of gene knockout vector

[0055] The CRISPR / Cas9 vector is a recombinant vector obtained by ligating the sgRNA1 sequence of the first target site and the sgRNA2 sequence of the second target site into the pKSE402 vector.

[0056] 3. Obtain ​ transgenic plants

[0057] The successfully constructed CRISPR / Cas9 vector plasmid was chemically transformed into GV3101 Agrobacterium competent cells to obtain the recombinant strain GV3101 (CRISPR / Cas9). The specific procedures were performed according to the Agrobacterium competent cell transformation instructions provided by the biotechnology company. Subsequently, using 9 Changchun Mici 9 as material, the recombinant Agrobacterium was delivered into cucumber cotyledons through infection. Positive transgenic cucumber plants were preliminarily identified by screening the newly formed shoots using green fluorescent labeling.

[0058] 4. Targeting identification of transgenic plants

[0059] Plant genomic DNA was extracted from young leaves of T0 generation transgenic plants to design... ​Transgenic targeting identification cloning and sequencing primers: CRCsPOD7-Seq-F: ATAGATAAGGAGGAAGCCATTAAG and CRCsPOD7-Seq-R: CCATGAAAGAGGTGTGATGGGAAATAT. Subsequently, the DNA of the obtained T0 generation transgenic plants was cloned using these primers, the product was purified, ligated into the pToPo vector, transformed into DH5α competent cells, incubated, and then plated on LB solid medium containing ampicillin resistance. Single clones were picked and placed on LB liquid medium containing ampicillin resistance. PCR verification of the picked single clones was performed using these primers. Sanger sequencing was performed on single clones containing the correct target band. The sequencing results were compared with those of the wild type. ​ Gene sequences were compared. Identification was performed according to the following principles. ​ Genotype of transgenic plants: If the sequencing results show only wild-type sequences, the line is considered to have not been targeted for editing, i.e., a wild-type plant; if the sequencing results show both wild-type sequences and sequences with mutations, the line is considered a heterozygous mutant plant; if the sequencing results show only mutant sequences and no wild-type sequences, the line is considered a homozygous mutant plant.

[0060] In accordance with the above identification principles, four T0 generation transgenic cucumber plants were identified. Among them, two plants showed heterozygous mutations and two plants showed biallelic mutations. The results are shown in Table 1.

[0061] Table 1 Cucumber ​ Targeting identification results of T0 generation transgenic plants

[0062]

[0063] Sequencing results showed that among the four T0 generation transgenic plants, the T0-3 mutant line was similar to the wild-type cucumber genome. ​ Compared to the gene sequence, the specific mutation type is: the base G in the first target site of the two chromosomes is replaced with the base T, and the replacement position is the 89th position of SEQ ID NO:1.

[0064] Furthermore, analysis of the sequencing results revealed that another transgenic plant line, the T0-4 mutant, is similar to the wild-type cucumber genome. ​ Compared to the gene sequence, the specific mutation type is: the 12bp base AAGACCAACCTC in the second target site of the two chromosomes is replaced by CACGCTCAGCT, located between positions 328 and 339 of SEQ ID NO:1.

[0065] 5. T2 generation ​ Identification of Editing Types in Transgenic Plants

[0066] The T0 generation mutant plants T0-3 and T0-4 obtained in step 4 were self-pollinated. After the cucumber fruits matured, the T1 generation seeds were harvested and the seeds with green fluorescence were screened by green fluorescent labeling. After sowing, the edit type was identified (the identification method is the same as in step 4). The targeted plants were self-pollinated and the T2 generation seeds were harvested. The lines with all seeds carrying green fluorescence and homozygous mutations were screened by green fluorescent labeling (green fluorescence is used for subsequent haploid screening, and the target mutation identification method is the same as in step 4) as cucumber parthenogenetic haploid induction lines.

[0067] After screening, lines T1-3-6, T1-3-8, T1-4-3, T1-4-5, and T1-4-12 were ultimately identified as homozygous edited lines whose seeds all carried green fluorescent markers. The edit types of each line are as follows:

[0068] Sequencing and identification analysis showed it to be similar to wild-type cucumber. ​ Compared to the gene sequence, the editing type of the T1-3-6 and T1-3-8 homozygous edited lines is: the base G in the first target site of both chromosomes is replaced with the base T, and the base substitution position is as follows:

[0069] It is the 89th bit of SEQ ID NO:1.

[0070] Sequencing and identification analysis showed it to be similar to wild-type cucumber. ​ Compared to gene sequences, T1-4-3, T1-4-5, and T1-4-

[0071] The mutation type of the 12 homozygous mutant line is: 12 bp bases at the second target site on both chromosomes.

[0072] AAGACCAACCTC should be replaced with CACGCTCAGCT, located between bits 328 and 339 of SEQ ID NO:1.

[0073] Example 2 T2 generation ​ Application of gene-hybrid edited plants in the induction of parthenogenetic haploids in cucumber

[0074] 1. Cucumber ​ Seed setting rate and development of pure and edited plants

[0075] Compared to wild-type cucumber material Changchun Mici, ​ The number of seeds in the fruit of gene-homogeneous and edited plants was significantly reduced, and the number of undeveloped seeds in edited plants was significantly increased. ​ This indicates that... ​ Mutations in this type of plant can affect the normal development of seeds, leading to a decrease in seed set.

[0076] 2. Identification of haploid plants and ​The probability of inducing haploid production in cucumbers by gene homozygous edited plants

[0077] by ​ The T2 generation homozygous plants T1-3-6, T1-3-8, T1-4-3, T1-4-5, and T1-4-12 were used as male parents and hybridized with different cucumber materials (Changchun Mici, 2073-1, and 2073-2) as female parents. The resulting hybrid offspring were subjected to haploid screening and ploidy identification using the following methods:

[0078] (1) Preliminary screening of haploids using green fluorescent labeling

[0079] The above description uses ​ Genetically homozygous edited plants were used as the male parent and crossed with different cucumber materials as the female parent. Given that the CRISPR / Cas vector carries an independently expressed EGFP green fluorescent protein tag (i.e., the chromosome from the male parent carries the green fluorescent protein tag), the harvested F1 hybrid seeds were initially screened for haploidity using green fluorescence. Hybrid offspring exhibiting green fluorescence were considered heterozygous diploids; those without green fluorescence were preliminarily considered haploids. ​ ).

[0080] (2) Ploid identification using flow cytometry

[0081] Seeds without green fluorescence selected in step (1) were sown. After they grew to a suitable size, 0.5 square centimeters (about the size of a little fingernail) of young leaves were taken to extract cell nuclei. Using the cell nuclei of young leaves of the wild-type diploid cucumber material *Changchun Mici* as a control, flow cytometry was first used to detect the peak signal of the cell nuclei of the diploid cucumber material *Changchun Mici*, with 100 set as the diploid signal peak value. Then, flow cytometry was used to sequentially detect the plants initially selected in step (1). If the detected signal peak value appeared around 50, the plant was a haploid plant; if the detected signal peak value appeared around 100, the plant was a diploid plant. ​ ).

[0082] (3) Observation and identification of plant phenotype

[0083] Phenotypic observations were performed on the haploid plants identified in steps (1) and (2) above. Compared with diploid plants, haploid plants were generally stunted, with smaller leaves and various organs. ​ ).

[0084] (4) ​ Statistical results of haploid induction rate of knockout plants

[0085] Based on the above identification results, statistics ​Haploid induction rate of knockout plants (Table 2):

[0086] Haploid induction rate (%) = (Number of haploids / Total number of hybrid seeds) × 100

[0087] Table 2 ​ Haploid induction rate statistics

[0088]

[0089] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. A method for constructing a cucumber parthenogenetic haploid induction line, characterized in that, The specific steps involve using genetic engineering techniques to knock out the cucumber gene CsPOD7, or to silence or inhibit the expression of the cucumber gene CsPOD7, in order to obtain positive transgenic plants, which are cucumber parthenogenetic haploid induction lines. The gene knockout, silencing, or suppression method is selected from the CRISPR / Cas9 gene editing technology to knock out the cucumber gene CsPOD7; Specifically, the gene CsPOD7 is used as the target, and a CRISPR / Cas9-based sgRNA sequence is designed. The DNA fragment containing the sgRNA sequence is ligated into a vector carrying CRISPR / Cas9 and transformed into cucumber. The nucleotide sequences of the sgRNA action site are 5'-TCGGTTATTACCAAAAAAC-3' and 5'-TGCTAAGACCAACCTCGAA-3'; The nucleotide sequence of the cucumber CsPOD7 gene is the nucleotide sequence shown in SEQ ID NO:1; In the positive transgenic plants obtained by the above CRISPR / Cas9 gene editing technology, the mutation types of their CsPOD7 gene are as follows: for the sgRNA action site with nucleotide sequence 5'-TCGGTTATTACCAAAAAAC-3', the G base at position 89 of SEQ ID NO:1 in both chromosomes is replaced with the T base; for the sgRNA action site with nucleotide sequence 5'-TGCTAAGACCAACCTCGAA-3', the 12 bp base AAGACCAACCTC between positions 328 and 339 of SEQ ID NO:1 in both chromosomes is replaced with CACGCTCAGCT; The base G in the first target site of both chromosomes is replaced with the base T, and the substitution position is the 89th position of SEQ ID NO:1; The 12bp base AAGACCAACCTC in the second target site of the two chromosomes is replaced with CACGCTCAGCT, located between positions 328 and 339 of SEQ ID NO:1.

Citation Information

Patent Citations

  • Application of gene CsDMP in cucumber haploid breeding

    CN119709767A