Application of lysophosphatidylcholine and dihydromyricetin in preparation of medicine for treating or preventing porcine reproductive and respiratory syndrome virus infection

Abstract

The invention belongs to the technical field of antiviral drugs for livestock and poultry, and discloses application of lysophosphatidylcholine and dihydromyricetin in preparation of drugs for treating or preventing porcine reproductive and respiratory syndrome virus infection. The CAS number of the lysophosphatidylcholine is 17364 to 16 to 8, and the CAS number of the dihydromyricetin is 27200 to 12 to 0. The applicant performs cell level and animal body level anti-infection research on the pharmaceutical composition, and finds that the pharmaceutical composition shows a remarkable anti-PRRSV effect in vivo and in vitro, can reduce proliferation of viruses in a pig body, reduces damage of PRRSV infection to lung tissues and organs, effectively controls adverse effects of PRRSV infection to the body, and has a remarkable anti-PRRSV effect. The clinical disease symptoms of the pigs in the PRRSV infection period can be weakened, and the porcine reproductive and respiratory syndrome can be prevented and controlled.

Description

Technical Field

[0001] This invention belongs to the field of small molecule compounds for antiviral treatment of livestock and poultry, specifically relating to the application of lysophosphatidylcholine and dihydromyricetin in the preparation of drugs for the treatment or prevention of porcine reproductive and respiratory syndrome virus infection. Background Technology

[0002] Porcine Reproductive and Respiratory Syndrome (PRRS) is an infectious disease caused by Porcine Reproductive and Respiratory Syndrome Virus (PRRSSV), characterized by reproductive disorders in pregnant sows and respiratory distress in pigs of all ages. Because infected pigs exhibit cyanosis (blue discoloration) of the ears, it is also known as "blue ear disease." PRRSV is an RNA virus belonging to the Arteriviridae family. It primarily infects porcine alveolar macrophages (PAMs), affecting their biological functions and leading to respiratory abnormalities and disorders in infected pigs. PRRSV infection mainly manifests as premature birth, abortion, weak piglets, stillbirths, and mummified fetuses in late pregnancy in sows, ultimately resulting in a significantly increased mortality rate in affected piglets and severely impacting the economic benefits of the pig farming industry.

[0003] Despite more than 30 years of research on PRRSV, its prevention and control remains a global challenge. Therefore, it is urgent to discover new, cost-effective, and safe anti-PRRSV drugs. Developing new anti-PRRSV drugs is crucial for the prevention and control of PRRS and for reducing costs and increasing profits in the pig farming industry.

[0004] Lysophosphatidylcholine is an intermediate product of lecithin metabolism in the body, playing an important role in cell membrane composition, signal transduction, and cell metabolism. Phosphatidylcholine is an important membrane component involved in immune regulation and also has certain antiviral activity. Dihydromyricelin (DHM), also known as ampelopsis, is a dihydroflavonol flavonoid compound. Current research shows that dihydromyricelin has various pharmacological effects, including antioxidant, antitumor, anti-inflammatory, and antiviral activity. Dihydromyricelin is widely found in plants of the genus *Ampelopsis* in the family Vitaceae, with a content reaching up to 30% in vine tea. It has advantages such as low cost and easy availability. Related studies have shown that dihydromyricelin has certain antiviral activity against influenza virus and hepatitis B virus. However, the anti-PRRSV activity of lysophosphatidylcholine and dihydromyricetin has not been reported. Therefore, it is of great significance to explore the anti-PRRSV activity of lysophosphatidylcholine and dihydromyricetin and investigate whether there is a combined drug activity between lysophosphatidylcholine and dihydromyricetin. Summary of the Invention

[0005] The purpose of this invention is to address the difficulty in preventing and treating porcine reproductive and respiratory syndrome virus (PRRSV) infection by providing the use of a composition containing lysophosphatidylcholine and dihydromyricetin in the preparation of a medicament for the treatment or prevention of porcine reproductive and respiratory syndrome.

[0006] To achieve the above objectives, the present invention adopts the following technical measures:

[0007] The scope of protection of this invention includes:

[0008] The use of a composition containing lysophosphatidylcholine and dihydromyricetin in the preparation of a medicament for the treatment or prevention of porcine reproductive and respiratory syndrome.

[0009] The use of a composition containing lysophosphatidylcholine and dihydromyricetin in the preparation of a drug for the treatment or prevention of porcine reproductive and respiratory syndrome virus infection.

[0010] The applications described above:

[0011] The lysophosphatidylcholine mentioned above is 1-Palmitoyl-sn-glycero-3-phosphocholine (referred to as 1-P in this invention), with the molecular formula C. 24 H 50 NO7P, with a molecular weight of 495.63 and CAS number 17364-16-8, has the following structural formula:

[0012]

[0013] Dihydromyricetin has the molecular formula C2. 15 H 12 O8, with a molecular weight of 320.25 and CAS number 27200-12-0, has the following structural formula:

[0014] .

[0015] In the above-described applications, preferably, the lysophosphatidylcholine and dihydromyricetin are one of the main active ingredients in the composition.

[0016] In the above-described applications, the molar ratio of lysophosphatidylcholine to dihydromyricetin is 0.5-1:1-2.

[0017] In the above-described applications, preferably, when the porcine reproductive and respiratory syndrome virus is PRRSV NADC30-like, the molar ratio of lysophosphatidylcholine to dihydromyricetin is 0.5:2.

[0018] In the above-described applications, preferably, when the porcine reproductive and respiratory syndrome virus is PRRSV WUH3, the molar ratio of lysophosphatidylcholine to dihydromyricetin is 1:1.

[0019] Compared with the prior art, the advantages of the present invention are as follows:

[0020] 1. The use of 1-Palmitoyl-sn-glycero-3-phosphocholine in combination with Dihydromyricetin in the preparation of PRRSV inhibitors is disclosed for the first time, and the two have a synergistic inhibitory effect on PRRSV.

[0021] 2. The small molecule compounds 1-Palmitoyl-sn-glycero-3-phosphocholine and Dihydromyricetin in this invention can reduce the infectivity of PRRSV cells at the cellular level, inhibit PRRSV infection of cells, and reduce viral proliferation on cells, and can be used to prevent and control PRRSV infection.

[0022] 3. Animal experiments have confirmed that the small molecule compounds 1-Palmitoyl-sn-glycero-3-phosphocholine and Dihydromyricetin in this invention, when administered orally to experimental pigs, can effectively protect against morbidity and mortality caused by PRRSV infection. The survival rate of pigs in the control group was 20%, while the survival rate of pigs fed with the small molecule compounds 1-Palmitoyl-sn-glycero-3-phosphocholine and Dihydromyricetin reached 100%. They significantly inhibit PRRSV shedding, reduce environmental pollution, and significantly alleviate clinical symptoms such as fever, depression, and reduced feed intake caused by PRRSV infection. They can effectively control the adverse effects of PRRSV infection on the body and can be used for the prevention and control of PRRSV. Attached Figure Description

[0023] Figure 1 Schematic diagram of the cytotoxicity of 1-P and Dihydromyricetin on Marc145 and primary PAM cells;

[0024] In this study, A represents the cytotoxicity assay of 1-P and Dihydromyricetin against Marc145 cells, and B represents the cytotoxicity assay of 1-P and Dihydromyricetin against primary PAM cells.

[0025] Figure 2 The effects of 1-P and Dihydromyricetin on the proliferation of PRRSV in Marc145 cells and primary PAM cells;

[0026] Where A represents the effect of 1-P on the proliferation of NADC30 in Marc145 cells and primary PAM cells, and B represents the effect of Dihydromyricetin on the proliferation of NADC30 in Marc145 cells and primary PAM cells.

[0027] Figure 3 The HSA index for the combined use of 1-P and Dihydromyricetin.

[0028] Figure 4 Loewe index for the combined use of 1-P and Dihydromyricetin.

[0029] Figure 5 The Bliss index represents the combined use of 1-P and Dihydromyricetin.

[0030] Figure 6 ZIP index for the combined use of 1-P and Dihydromyricetin.

[0031] Figure 7 To investigate the validation of the FIC index for the combined use of 1-P and Dihydromyricetin;

[0032] Wherein: A represents the effect of different drug treatments on the proliferation of PRRSV WUH3 in Marc145 cells, and B represents the effect of different drug treatments on the proliferation of PRRSV WUH3 in PAM cells.

[0033] Figure 8 The effect of combined 1-P and Dihydromyricetin on the clinical symptoms of PRRSV-infected pigs.

[0034] Figure 9 The effect of combined administration of 1-P and Dihydromyricetin on the survival rate of PRRSV-infected pigs.

[0035] Figure 10 The effect of combined administration of 1-P and Dihydromyricetin on the viral load in PRRSV-infected swine serum.

[0036] Figure 11 The effect of combined administration of 1-P and Dihydromyricetin on body temperature in PRRSV-infected pigs.

[0037] Figure 12 The effect of combined administration of 1-P and Dihydromyricetin on body weight in PRRSV-infected pigs.

[0038] Figure 13 The effect of combined administration of 1-P and Dihydromyricetin on the viral load of PRRSV-infected pig swabs.

[0039] Figure 14 The effect of combined administration of 1-P and Dihydromyricetin on the viral load of PRRSV-infected pig swabs.

[0040] Figure 15 The effect of combined administration of 1-P and Dihydromyricetin on the viral load of PRRSV-infected pig swabs.

[0041] Figure 16 The effect of combined 1-P and Dihydromyricetin on lung organ lesions in PRRSV-infected pig swabs. Detailed Implementation

[0042] To better understand the content of this invention, the following detailed description, in conjunction with specific embodiments, further illustrates the invention. However, the scope of protection of this invention is not limited to the following embodiments. Unless otherwise specified, the experimental methods and conditions in the embodiments of this invention are conventional methods. Unless otherwise specified, the technical solutions described in this invention are conventional solutions in the field; unless otherwise specified, the reagents or materials are all derived from commercial sources.

[0043] The PRRSV Wh3 virus used in the embodiments of the present invention is the highly pathogenic PRRSV strain WUH3 (i.e., the highly pathogenic PRRSV WUH3 strain involved in DOI: 10.7666 / d.Y2004267), and the PRRSV NADC30-GFP used is obtained by adding GFP fluorescent labeling to the PRRSV NADC30-like strain screened by the applicant.

[0044] In this embodiment of the invention, the molecular formula of 1-Palmitoyl-sn-glycero-3-phosphocholin (1-P) is C0. 24 H 50 NO7P, with a molecular weight of 495.63 and CAS number 17364-16-8, has the following structural formula:

[0045]

[0046] Dihydromyricetin (DHM) is a dihydroflavonol flavonoid compound with the molecular formula C0. 15 H 12 O8, with a molecular weight of 320.25 and CAS number 27200-12-0, has the following structural formula:

[0047] .

[0048] Example 1:

[0049] Screening of small molecule compounds against PRRSV infection

[0050] 1. Culture of Marc-145 cells

[0051] Marc145 cells stored in liquid nitrogen were removed from the liquid nitrogen container and quickly placed in a 37°C water bath to rapidly lyse the cells. The cell suspension was then centrifuged at 1000 rpm for 7 minutes. After centrifugation, the supernatant was discarded, and the cells were resuspended in 1640 medium (10% serum + 1% antibiotics). The cell suspension was transferred to a T25 cell culture flask and cultured in a 37°C incubator containing 5% CO2. Once the cells had grown into a uniform monolayer, they were passaged. First, the cells were washed three times with PBS, then digested with trypsin at 37°C for 3-5 minutes. Digestion was terminated with 1640 medium (10% serum + 1% antibiotics). The cell suspension was collected, centrifuged at 1000 rpm for 7 minutes, and the supernatant was discarded. The cells were resuspended in fresh 1640 medium (10% serum + 1% antibiotics) and then transferred to a new cell culture flask or plate for later use.

[0052] 2. Preparation and culture of alveolar macrophages (PAM) cells

[0053] Primary PAM cells were obtained from the lungs of 30-day-old piglets. First, after euthanizing the piglets, the thoracic cavity was slowly opened, the trachea was separated, and sealed with sterile hemostatic forceps to prevent external air from entering the lungs. The piglets' lungs, heart, and trachea (up to the larynx) were then removed together and quickly placed in an autoclaved plastic bag and stored on ice for no more than 4 hours. Next, the surface and opening of the plastic bag were disinfected with 75% alcohol, and the bag was transferred to a biosafety cabinet. The lungs were removed and placed on a sterilized tray. The entire outer surface of the lungs was rinsed with sterile PBS to thoroughly remove blood and other substances. Excess tissue around the larynx and trachea was trimmed with sterile scissors, and the larynx was trimmed to avoid contamination of the cell solution. Lung lavage was then performed. First, the trachea was lifted with sterile hemostatic forceps, and 1640 culture medium (10% serum + 1% penicillin-dextrin antibiotics) was continuously injected into the lungs through the larynx using a pipette. Each lung lobe was gently massaged to promote full entry of the culture medium into the alveoli. Once the lungs are full, pour the fluid into 50 mL centrifuge tubes. Repeat this irrigation process several times until the lavage fluid is clear and transparent. Then, centrifuge at 1500 rpm for 7 min at 4°C, discard the supernatant, and resuspend the cells in 20 mL of RPMI 1640 medium in each tube. Centrifuge again. Repeat this process 3 times. For the 4th centrifugation, centrifuge at 1500 rpm for 5 min at 4°C, discard the supernatant, and resuspend the cells in a small amount of RPMI 1640 medium in each tube. Collect the fluid from all centrifuge tubes into one centrifuge tube. Filter the solution through a 70 μm filter to remove mucus and other substances, then transfer it to a new 50 mL centrifuge tube. Take 20 μL of the cell suspension and add it to a counting chamber for automatic cell counting. After counting, replenish with RPMI 1640 medium (10% serum + 1% penicillin antibiotics) at a concentration of 5 × 10⁶ cells / mL. 6 Each cell was seeded into a 24-well plate and incubated in a 37°C, 5% CO2 incubator.

[0054] 3. Anti-PRRSV treatment with small molecule compounds in Marc 145 cells and alveolar macrophages (PAM)

[0055] Marc145 cells were evenly seeded into 24-well cell culture plates and cultured in a constant temperature cell culture incubator. After the cells grew into a uniform monolayer, the supernatant was discarded, and the cells were washed three times with sterile PBS and then inoculated into 1640 medium containing 0 μM, 5 μM, 10 μM, 20 μM, and 40 μM of compound 1-P, respectively. A blank control group without compound 1-P was also set up. After 6 hours, the supernatant was discarded, and the cells were washed three times with PBS. They were then inoculated again with a mixture of 0 μM, 5 μM, 10 μM, 20 μM, and 40 μM 1-P compound in 1640 medium (0% serum + 1% penicillin antibody) and PRRSV WUH3 virus (0.1 MOI). After culturing for 2 hours, the supernatant was discarded, and the cells were washed three times with PBS. They were then inoculated with fresh medium containing different concentrations of the compound, and the 24-well plates were placed in a constant temperature cell culture incubator for 24-36 hours. The concentrations of Dihydromyricetin used to treat the cells were 0 μM, 25 μM, 50 μM, and 100 μM, with other treatment methods the same as for compound 1-P. The method of treating PAM cells with the compound was the same as for Marc145.

[0056] 4. Determination of PRRS viral load in cells and viral fluids

[0057] The 24-well cell plates treated as described above were placed in a -80℃ freezer and thawed three times to ensure the full release of viral particles from the cells. The supernatant was then collected by centrifugation for viral load detection. The detection method followed the real-time quantitative PCR method recommended in the National Standard of the People's Republic of China for the Detection of Porcine Reproductive and Respiratory Syndrome (PRRS) (GB / T18090-2023). The primer sequences were: F: 5'-GCACTGATTGACAYTGTGCC-3'; R: 5'-CGCATGGTTCTCGCCAAT-3'; and the probe primer was: 5'-(FAM)AGTCACCTATTCAATTAGGGCGACCG(TAMRA)-3'.

[0058] 5. Small molecule compound cytotoxicity assay (CCK-8)

[0059] First, healthy Marc145 cells and PAM cells were seeded into 96-well cell culture plates at a density of 100 μL per well, with the Marc145 cell density being 1 × 10⁻⁶ cells / well. 6 / ml, PAM cell density is 1×10⁶ 6 / mL, and cultured in a constant temperature cell culture incubator for 24h; after 24h, the medium was changed, and each well was inoculated with fresh medium containing the corresponding concentration of compound 1-P. A cell-free control group was also set up and cultured in a constant temperature cell culture incubator for 48h. The medium was then discarded, and 100μL of 1640 medium containing 10μL of LCK-8 reagent was added to each well. The cells were incubated at 37℃ in the dark for 2h, and the OD450nm reading was measured using a microplate reader to calculate cell viability. Cell viability (%) = (OD450nm of drug-treated group - OD450nm of cell-free control group) / OD450nm of drug-free control group × 100%. Results are as follows: Figure 1 As shown, 40 μM of compound 1-P had no toxic side effects on Marc145 cells and primary PAM cells, and 50 μM of DHM had no toxic side effects on Marc145 cells and primary PAM cells. 6. Determination of viral titer in cells and viral fluid.

[0060] After 24 hours of culture, the 24-well cell plates were repeatedly frozen and thawed three times at -80°C to ensure complete release of viral particles. The viral solution was then collected in 1.5 mL centrifuge tubes and centrifuged at 3000 rpm for 10 min. The precipitate was discarded, and the supernatant viral solution was stored at -80°C for TCID treatment. 50 Detection. First, take a 96-well plate uniformly confluent with Mar145 cells, then serially dilute the collected virus solution 10-fold to 10⁻⁶. -8 Six replicates of each concentration gradient were then inoculated into 96-well plates, 100 μL per well. The 96-well plates were then incubated at 37°C in a cell culture incubator containing 5% CO2. After 72 h, cytopathic effects were observed and the number of wells with cytopathic effects was recorded. Viral titers were calculated using the Reed-Mueneh method. Results are as follows: Figure 2 As shown, both 1-P and DHM significantly inhibited the proliferation of PRRSV WUH3 in Marc145 and PAM cells in a dose-dependent manner.

[0061] 7.1-Palmitoyl-sn-glycero-3-phosphocholine and Dihydromyricetin combined drug checkerboard experiment

[0062] After digestion, cultured Marc145 cells were evenly seeded into three 96-well black transparent-bottom cell culture plates and incubated in a constant temperature cell culture incubator for 24 h. After 24 h, 1-P and DHM were mixed at different concentrations and seeded into different wells of the 96-well plates for drug pretreatment. After 6 h of pretreatment, the cell supernatant was discarded and different concentrations of small molecule compounds were repeatedly inoculated for drug pretreatment. After 6 h, the supernatant was discarded and new small molecule compounds containing different concentrations of PRRSV NADC30-GFP or PRRSV WUH3 were inoculated and the cell plates were incubated at 37 °C. After 2 h of incubation, the supernatant was discarded and the cells were washed three times with sterile PBS. Different concentrations of small molecule compounds were inoculated again and the cell plates were incubated at 37 °C for 24 h. After 24 h, samples were collected to detect the inhibition rate of different concentrations of drug treatment on PRRSV-GFP in Marc145 cells. The calculation formula was: Inhibition rate = (Viral load in control group - Viral load in drug-treated group) / Viral load in control group × 100%.

[0063] Evaluation of the synergistic effect of 8.1-Palmitoyl-sn-glycero-3-phosphocholine and Dihydromyricetin on the NADC30-GFP strain

[0064] The combined application of different concentrations of 1-Palmitoyl-sn-glycero-3-phosphocholine and Dihydromyricetin obtained from the above checkerboard experiment was analyzed to investigate the proliferation of NADC30-GFP in Marc145 cells. The inhibition rates are shown in Table 1, where Tables 1-3 represent the results of three replicates per well. Further analysis of the data in Table 1 using SynergyFinder was conducted to explore the synergistic index of 1-Palmitoyl-sn-glycero-3-phosphocholine and Dihydromyricetin. The results are as follows: Figure 3 , 4 As shown in Figures 5 and 6, the SynergyFinder analysis indicators HSA score, Bliss score, ZPI score, and Loewe score all showed a strong synergistic effect between 1-Palmitoyl-sn-glycero-3-phosphocholine and Dihydromyricetin. Among them, the Bliss score of -0.25 < 0 met the synergistic effect condition, and the HSA score of 12.36 showed a strong synergistic effect between 1-Palmitoyl-sn-glycero-3-phosphocholine and Dihydromyricetin.

[0065] Table 1. Inhibition rate (%) of drugs on PRRSV NADC30-GFP in Marc145 cells after combined administration of 1-P and DHM

[0066]

[0067] Evaluation of the combined effect of 9.1-Palmitoyl-sn-glycero-3-phosphocholine and Dihydromyricetin on PRRSV WUH3

[0068] After determining the synergistic effect of 1-P and DHM ( Figure 7 ), in order to further evaluate the specific situation of the combined administration of 1-P and DHM, the samples inoculated with PRRSV WUH3 in the checkerboard experiment were further detected by fluorescence quantitative detection. The detection results are shown in Table 2 below. Table 1~Table 3 in Table 1 are the results of three replicates per well.

[0069] Table 2. Detection of PRRSV Wh3 viral load (CT) in Marc145 cells after combined administration of 1-P and DHM

[0070]

[0071] The synergistic effect is shown in Table 3:

[0072] Calculated from Table 1, the minimum concentration of 1-P against NADC30-GFP is 4 μM, and the minimum concentration of DHM against NADC30-GFP is 5 μM. When 1-P and DHM are combined, 1-P is 1 μM and DHM is 1 μM, which has an inhibitory effect on NADC30-GFP, and the fractional antiviral index is 0.45.

[0073] Calculated from Table 2, the minimum concentration of 1-P against PRRSV WUH3 is 5 μM, and the minimum concentration of DHM against PRRSV WUH3 is 7 μM. When 1-P and DHM are combined, 1-P is 0.5 μM and DHM is 2 μM, which has an inhibitory effect on PRRSV, and the fractional antiviral index is 0.386.

[0074] FICI calculation formula: FICI = MIC of drug A in combination / MIC of drug A alone + MIC of drug B in combination / MIC of drug B alone. For synergistic antiviral effect, FICI ≤ 0.5; for additive effect, 0.5 < FICI ≤ 1; for irrelevant effect, 1 < FICI ≤ 2; for antagonistic effect, FICI > 2.

[0075] Table 3. Minimum antiviral concentration and fractional antiviral concentration index of 1-P and DHM against PRRSV

[0076]

[0077] Example 2:

[0078] Effects of combined 1-P and DHM therapy on PRRSV infection in pigs

[0079] 1. Preparation of animal facilities and laboratory animals

[0080] Preparation of the laboratory animal facility:

[0081] Five to seven days before the start of animal experiments, the experimental animal room should be thoroughly cleaned, including the walls and floors, as well as the feeding pens. Then, a closed fumigation disinfection should be carried out again, and the room should be ready for use after disinfection.

[0082] Preparation of laboratory animals:

[0083] One week before the experiment, the selected experimental animals were tested for common pathogens to ensure that the experimental pigs were healthy piglets. Two days before the experiment, the experimental piglets were transported to a general animal room and PRRSV serological tests were performed to ensure that the experimental animals were PRRSV negative pigs. Ten PRRSV negative piglets around 35 days old were randomly grouped and transferred to a specific PRRSV experimental animal room for feeding for 2-3 days. The piglets' feeding status was observed to ensure that each piglet could eat and drink normally.

[0084] 2. Animal Experiment Design

[0085] Ten PRRSV-negative piglets (35-day-old weaned piglets) were randomly divided into two groups: a control group and an experimental group, with five piglets in each group. The control group piglets were numbered 61, 62, 63, 64, and 65; the experimental group piglets were numbered 66, 67, 68, 69, and 70. All animals were housed in an animal facility conforming to GMP animal testing standards. The experimental group was administered sterile water containing the corresponding dose of the compound via gavage, and each pig was ensured to receive 5 mg / kg of 1-P and 20 mg / kg of DHM compound daily. The control group was administered the same amount of sterile water without the compound daily via gavage. After 10 days of feeding, 10 piglets were infected by nasal administration. 3.5 The highly pathogenic PRRSV strain WUH3 with TCID50 is shown in Table 4 for experimental grouping.

[0086] Table 4. Grouping of animal experiments using 1-P in combination with DHM to combat PRRSV infection

[0087]

[0088] 3. Effects of combined 1-P and DHM on clinical morbidity in PRRSV-infected pigs

[0089] Starting from day 0 of PRRSV infection, the body temperature (rectal temperature) and weight of infected pigs were regularly monitored and recorded. Simultaneously, the clinical symptoms of the infected pigs were observed and recorded, including feed intake, mental state, body surface condition, respiratory symptoms, and neurological symptoms. Clinical symptoms were scored according to the clinical symptom assessment criteria shown in Table 5. For fatal cases, the score was calculated as: total clinical score + 5 points = 20 points. Results are shown in Table 5 and... Figure 8 As shown, the clinical incidence of infection in the control group was significantly higher than that in the experimental group.

[0090] Table 5. Assessment criteria for overall clinical symptoms in PRRSV-infected piglets

[0091]

[0092] Table 6. Clinical symptom scores of PRRSV-infected piglets

[0093]

[0094] 4. Effects of combined 1-P and DHM on mortality in PRRSV-infected pigs

[0095] After PRRSV infection, the health status of the pigs should be observed and recorded daily, and the results should be as follows: Figure 9 As shown: In the control group, 2 animals died on day 14 and 1 animal died on day 18, with a survival rate of 40%; no animals died in the experimental group that was administered 1-P and DHM compounds, with a survival rate of 100%.

[0096] 5. Effects of combined 1-P and DHM on body temperature in PRRSV-infected pigs

[0097] From the onset of PRRSV infection, the body temperature changes of infected pigs were measured and recorded on days 0, 2, 4, 6 and up to day 22 of infection.

[0098] The results are shown in Table 7 and Figure 10 As shown, in the control group, the body temperature of all pigs reached above 40°C starting from the 4th day of infection. The body temperature of pigs No. 61, No. 62 and No. 64 all reached 41°C and remained high fever. Among them, pigs No. 61 and No. 64 died on the 14th day of infection, and pig No. 62 died on the 18th day of infection. In the experimental group, the pigs briefly experienced a high temperature of 41°C, which quickly dropped below 41°C, and no deaths occurred during this period.

[0099] Table 7.1 - Effects of combined P and DHM on body temperature in PRRSV-infected pigs

[0100]

[0101] 6. Effects of combined 1-P and DHM on body weight in PRRSV-infected pigs

[0102] Starting from day 0 of PRRSV infection, the weight changes of infected pigs were measured and recorded on days 0, 2, 4, 6 and up to day 22 of infection.

[0103] The results are shown in Table 8 and Figure 11 As shown, the control group experienced stagnant or negative weight gain after infection, with pigs No. 62 and No. 64 showing the most significant negative weight gain. Pigs No. 62 and No. 64 died on days 16 and 14 of infection, respectively, while pig No. 61 died on day 14 of infection. In the experimental group, infected pigs showed a slight decrease in weight followed by a slow increase, with the overall weight showing a slow growth trend, and no deaths occurred during this period.

[0104] Table 8.1 - Effects of combined P and DHM treatment on body weight in PRRSV-infected pigs

[0105]

[0106] 7.1 Determination of serum viral load in PRRSV-infected pigs by combined administration of 1-P and DHM

[0107] Starting from day 0 of PRRSV infection, blood samples were collected from the anterior vena cava on days 0, 7, 14, and 21 of infection to measure the viral load in the serum.

[0108] The results are shown in Table 9 and Figure 12 As shown, the serum CT values ​​of pigs in the control group were all below 20 and the viral load was high starting from day 7 of infection; the serum CT values ​​of pigs in the experimental group remained above 20 and continued to increase throughout the entire infection cycle.

[0109] Table 9.1 - Effect of combined P and DHM treatment on viral load in PRRSV-infected swine serum

[0110]

[0111] 8. Effect of combined 1-P and DHM on viral load in PRRSV-infected porcine anal swabs

[0112] Starting from day 0 of PRRSV infection, anal swabs were collected from infected pigs on days 0, 2, 4, 6 and up to day 22 of infection. The PRRS viral load in the anal swabs was detected using the real-time quantitative PCR method recommended in the National Standard of the People's Republic of China for the Detection of Porcine Reproductive and Respiratory Syndrome (GB / T18090-2023).

[0113] The results are shown in Table 10 and Figure 13 As shown, the control group pigs began to show positive anal swabs on the 2nd day after infection, while the experimental group began to show positive anal swabs on the 8th day after infection. The viral load in the anal swabs of the control group was slightly higher than that of the experimental group.

[0114] Table 10.1 - Effect of combined P and DHM therapy on viral load in PRRSV-infected pig anal swabs

[0115]

[0116] 9. Effect of combined 1-P and DHM on viral load in PRRSV-infected swine pharyngeal swabs

[0117] Starting from day 0 of PRRSV infection, pharyngeal swabs were collected from infected pigs on days 0, 2, 4, 6 and up to day 22 of infection. The PRRS viral load in the pharyngeal swabs was detected using the real-time quantitative PCR method recommended in the National Standard of the People's Republic of China for the Detection of Porcine Reproductive and Respiratory Syndrome (GB / T18090-2023).

[0118] The results are shown in Table 11 and Figure 14 As shown, the viral load in the throat swabs of the control group was significantly higher than that of the experimental group.

[0119] Table 11.1 - Effect of combined P and DHM therapy on viral load in PRRSV-infected swabs from pig throats.

[0120]

[0121] Effect of combined 10.1-P and DHM on viral load in PRRSV-infected swabs from pigs

[0122] Starting from day 0 of PRRSV infection, nasal swabs were collected from infected pigs on days 0, 2, 4, 6 and up to day 22 of infection. The PRRS viral load in the nasal swabs was detected using the real-time quantitative PCR method recommended in the National Standard of the People's Republic of China for the Detection of Porcine Reproductive and Respiratory Syndrome (GB / T18090-2023).

[0123] The results are shown in Table 12 and Figure 15 As shown, the viral load in nasal swabs of pigs in the experimental group was significantly lower than that in the control group, and pigs No. 41 and No. 42 in the experimental group showed negative nasal swabs from day 28 after infection.

[0124] Table 12.1 - Effect of combined P and DHM therapy on viral load in PRRSV-infected swabs from pigs

[0125]

[0126] 11. Effects of combined 1-P and DHM on lung tissue lesions in PRRSV-infected pigs

[0127] In the control group, pigs that died after PRRSV infection were immediately necropsed. Pigs in the experimental group, which were administered 1-P and DHM compounds, were necropsed on day 22 post-infection, along with uninfected PRRSV-positive pigs of the same age. Lung lesions were observed in each group. Figure 16 As shown, the lungs of pigs in the PRRSV-infected control group had obvious solid lesions and hemorrhages, while the lungs of the experimental group and the normal PRRSV-negative control pigs administered 1-P and DHM compounds showed no obvious abnormalities; no obvious lesions were found in other organs. In conclusion, administration of 1-P and DHM compounds can significantly reduce tissue and organ damage caused by PRRSV.

Claims

1. The use of a composition containing lysophosphatidylcholine and dihydromyricetin in the preparation of a medicament for the treatment or prevention of porcine reproductive and respiratory syndrome, wherein the lysophosphatidylcholine has the CAS number 17364-16-8 and the dihydromyricetin has the CAS number 27200-12-0.

2. The use of a composition containing lysophosphatidylcholine and dihydromyricetin in the preparation of a medicament for the treatment or prevention of porcine reproductive and respiratory syndrome virus infection, wherein the lysophosphatidylcholine has the CAS number 17364-16-8 and the dihydromyricetin has the CAS number 27200-12-0.

3. The application according to claim 1 or 2, characterized in that, The lysophosphatidylcholine and dihydromyricetin are among the main active ingredients in the composition.

4. The application according to claim 1 or 2, characterized in that, The molar ratio of lysophosphatidylcholine to dihydromyricetin is 0.5-1:1-2.

5. The application according to claim 2, characterized in that, When the porcine reproductive and respiratory syndrome virus is PRRSVNADC30-like, the molar ratio of lysophosphatidylcholine to dihydromyricetin is 0.5:

2.

6. The application according to claim 2, characterized in that, When the porcine reproductive and respiratory syndrome virus is PRRSVWUH3, the molar ratio of lysophosphatidylcholine to dihydromyricetin is 1:1.

Images