Preparation method and application of smart silencer mixture capable of inhibiting proliferation of lung squamous carcinoma cells

By designing Smart Silencer to regulate MLT1L activity and utilizing a combination of double-stranded RNA and antisense oligonucleotides, the problem of lacking effective drug targets in the treatment of squamous cell carcinoma of the lung was solved, achieving effective inhibition and diagnosis of squamous cell carcinoma of the lung with high specificity and low side effects.

CN120837644APending Publication Date: 2025-10-28ACADEMY OF MILITARY MEDICAL SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410512717.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-04-26
Publication Date
2025-10-28

AI Technical Summary

Technical Problem

There is a lack of effective drug targets for the treatment of squamous cell carcinoma of the lung in the current technology, and traditional treatment methods have problems such as insufficient specificity, large side effects, and easy development of drug resistance.

Method used

Using a combination of double-stranded RNA molecules and antisense oligonucleotides, designed as a Smart Silencer, the activity or content of MLT1L is regulated to inhibit its expression, thus preparing inhibitors or therapeutic drugs for lung squamous cell carcinoma.

Benefits of technology

It significantly inhibits the proliferation, migration, and invasion of lung squamous cell carcinoma cells, reduces their activity, and provides a potential means for early diagnosis and treatment of lung squamous cell carcinoma, with high specificity and low side effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004812445760000081
    Figure BDA0004812445760000081
  • Figure BDA0004812445760000091
    Figure BDA0004812445760000091
  • Figure BDA0004812445760000092
    Figure BDA0004812445760000092
Patent Text Reader

Abstract

The invention discloses a preparation method and application of a smart silencer mixture capable of inhibiting proliferation of lung squamous carcinoma cells. The invention belongs to the field of biological medicine, and particularly relates to a preparation method and application of a smart silencer mixture capable of inhibiting proliferation of lung squamous carcinoma cells. The invention provides application of MLT1L or / and a substance for regulating and controlling activity or content of MLT1L in preparation of a product for treating or improving lung squamous cell carcinoma or preparation of a lung squamous cell carcinoma inhibitor. Wherein the MLT1L is an lncRNA (long non-coding ribonucleic acid) of which the nucleotide sequence is SEQ ID No. 10. The Smart Silencer composition of the specific target non-coding RNA MLT1L provided by the invention has a good inhibition effect, and the activity, the proliferation, the migration and the invasion ability of SK-MES-1 cells can be obviously inhibited after the MLT1L is interfered by the Smart Silencer composition of the specific target non-coding RNA MLT1L.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, specifically relating to a method for preparing a smartsilencer mixture that can inhibit the proliferation of lung squamous cell carcinoma cells and its application. Background Technology

[0002] Long non-coding RNAs (lncRNAs) are non-coding RNAs longer than 200 nt, primarily transcribed from intergenic, exon, or distal protein-coding regions of the genome by RNA polymerase II. lncRNAs may participate in regulating gene expression at the epigenetic, transcriptional, and post-transcriptional levels. They regulate pathological and physiological processes through mechanisms such as dose compensation, epigenetic regulation, histone modification, chromatin remodeling, transcriptional activation, transcriptional interference, nuclear transport, cell differentiation regulation, and cell cycle regulation. Many lncRNAs are abnormally expressed in different disease types, especially in refractory tumors with unclear pathogenesis. Studies have found that abnormal lncRNA expression or function is closely related to the occurrence of human diseases, including cancer and degenerative neurological diseases, which seriously endanger human health. These abnormalities manifest as abnormalities in lncRNA sequence and spatial structure, abnormal expression levels, and abnormal interactions with binding proteins. Furthermore, lncRNAs possess high tissue specificity, high efficiency, and high stability, making them promising potential therapeutic targets and biomarkers for diagnosis and prognosis.

[0003] Lung cancer, a malignant tumor originating from the bronchus and originating from epithelial tissue, is the second most common cancer worldwide and the leading cause of cancer death globally and in China. According to the latest global cancer burden data released by the International Agency for Research on Cancer in 2020, there were 2.2 million new cases of lung cancer globally, accounting for 11.4% of all new cancer cases. During the same period, 1.8 million people died from lung cancer globally, accounting for 18% of all cancer deaths. Early-stage lung cancer often presents with no obvious symptoms, and most patients are already in an advanced stage when they seek medical attention. The overall 5-year survival rate for patients with advanced lung cancer is around 20%. Currently, approximately 80%-85% of diagnosed lung cancer patients have non-small cell lung cancer (NSCLC), with squamous-cell lung cancer (SCLC) accounting for about 30%-40% of NSCLC, making it a common pathological type of lung cancer. Improving the early diagnosis rate and treatment effectiveness of lung cancer is crucial. Discovering effective lung cancer biomarkers and applying them clinically is one of the important means to achieve this. A growing body of research has found abnormal expression of human endogenous retroviruses (HERVs) during the development and progression of lung cancer, suggesting that they may play an important role in the development of lung cancer.

[0004] Molecular targeted therapy for tumors, as a novel cancer treatment method, is gradually becoming an important means of clinical cancer treatment. This therapy targets specific tumor-driving genes or key genes in signal transduction pathways, intervening in the process of cell carcinogenesis to interfere with the tumor cell cycle, inhibit tumor cell proliferation and metastasis, or induce apoptosis, thereby achieving the goal of treating tumors. Compared with traditional treatments, it has better specificity and precision, selectively killing tumor cells with less or no damage to normal tissues or cells, fewer side effects, and is less likely to induce drug resistance. Currently, only a limited range of drugs are approved for treating cancers associated with specific gene mutations. This is mainly because the clinical relevance of many mutations to cancer is still unclear, and known specific targets are scarce; therefore, there is an urgent need to find new and effective drug targets.

[0005] lncRNAs can not only serve as new markers for the early diagnosis and progression of squamous cell carcinoma of the lung, but also hold promise for treating diseases such as squamous cell carcinoma of the lung by altering the expression of lncRNAs or their target genes. The search and identification of lncRNAs and their target genes associated with the occurrence of squamous cell carcinoma of the lung can provide evidence for the clinical treatment of squamous cell carcinoma of the lung. Summary of the Invention

[0006] The technical problem to be solved by this invention is to find new and effective drug targets to treat or improve squamous cell carcinoma of the lung.

[0007] To address the aforementioned technical problems, the present invention provides an application in which MLT1L or / and substances that regulate the activity or content of MLT1L are used in the preparation of products for treating or improving squamous cell carcinoma of the lung or in the preparation of inhibitors for squamous cell carcinoma of the lung; wherein MLT1L is a lncRNA with the nucleotide sequence SEQ ID No. 10.

[0008] In the above applications, regulating the activity or content of MLT1L means downregulating, inhibiting, or reducing the activity or content of MLT1L.

[0009] In the above applications, the substance that regulates the activity or content of MLT1L is a composition containing double-stranded RNA molecules and / or antisense oligonucleotides.

[0010] The double-stranded RNA molecule is as follows:

[0011] g1) A double-stranded RNA molecule composed of nucleotide sequences SEQ ID No. 1 and SEQ ID No. 2 in the sequence listing; wherein A, G, C, and U are ribonucleotides, and T is a deoxyribonucleotide;

[0012] g2) A double-stranded RNA molecule composed of nucleotide sequences SEQ ID No. 3 and SEQ ID No. 4 in the sequence listing; wherein A, G, C, and U are ribonucleotides, and T is a deoxyribonucleotide;

[0013] g3) A double-stranded RNA molecule composed of nucleotide sequences SEQ ID No. 5 and SEQ ID No. 6 in the sequence listing; wherein A, G, C, and U are ribonucleotides, and T is a deoxyribonucleotide;

[0014] The antisense oligonucleotide molecule is as follows:

[0015] f1) The nucleotide sequence is the single-stranded RNA & DNA hybrid of SEQ ID No. 7 in the sequence listing; where A, G, C, and U are ribonucleotides and T is a deoxyribonucleotide;

[0016] f2) The nucleotide sequence is the single-stranded RNA & DNA hybrid of SEQ ID No. 8 in the sequence listing; where A, G, C, and U are ribonucleotides and T is a deoxyribonucleotide;

[0017] f3) The nucleotide sequence is the single-stranded RNA & DNA hybrid of SEQ ID No. 9 in the sequence listing; where A, G, C, and U are ribonucleotides and T is a deoxyribonucleotide.

[0018] The regulation may involve interfering with the expression of MLT1L.

[0019] In the above applications, the treatment or improvement of lung squamous cell carcinoma refers to inhibiting the proliferation of lung squamous cell carcinoma cells and / or tissues.

[0020] In the above applications, the inhibition of lung squamous cell carcinoma cell proliferation can be any of the following:

[0021] B1) Reduced invasiveness of lung squamous cell carcinoma cells;

[0022] B2) Decreased activity of lung squamous cell carcinoma cells;

[0023] B3) Reduced migration ability of lung squamous cell carcinoma cells;

[0024] B4) Reduced colony-forming ability of lung squamous cell carcinoma cells.

[0025] The double-stranded RNA molecules and / or the antisense oligonucleotides described above are also within the scope of protection claimed in this invention.

[0026] The compositions described in the foregoing applications are also within the scope of this invention. Specifically, the compositions are compositions containing double-stranded RNA molecules and / or antisense oligonucleotides; wherein the double-stranded RNA molecules may be as follows:

[0027] g1) A double-stranded RNA molecule composed of nucleotide sequences SEQ ID No. 1 and SEQ ID No. 2 in the sequence listing; wherein A, G, C, and U are ribonucleotides, and T is a deoxyribonucleotide;

[0028] g2) A double-stranded RNA molecule composed of nucleotide sequences SEQ ID No. 3 and SEQ ID No. 4 in the sequence listing; wherein A, G, C, and U are ribonucleotides, and T is a deoxyribonucleotide;

[0029] g3) A double-stranded RNA molecule composed of nucleotide sequences SEQ ID No. 5 and SEQ ID No. 6 in the sequence listing; wherein A, G, C, and U are ribonucleotides, and T is a deoxyribonucleotide;

[0030] The antisense oligonucleotide molecule may be as follows:

[0031] f1) The nucleotide sequence is the single-stranded RNA & DNA hybrid of SEQ ID No. 7 in the sequence listing; where A, G, C, and U are ribonucleotides and T is a deoxyribonucleotide;

[0032] f2) The nucleotide sequence is the single-stranded RNA & DNA hybrid of SEQ ID No. 8 in the sequence listing; where A, G, C, and U are ribonucleotides and T is a deoxyribonucleotide;

[0033] f3) The nucleotide sequence is the single-stranded RNA & DNA hybrid of SEQ ID No. 9 in the sequence listing; where A, G, C, and U are ribonucleotides and T is a deoxyribonucleotide.

[0034] The above-mentioned double-stranded RNA molecules and / or antisense oligonucleotides are mixed in equimolar proportions to obtain a composition.

[0035] The composition is Smart Silencer.

[0036] The present invention also provides lung squamous cell carcinoma inhibitors and / or medicaments for treating or improving lung squamous cell carcinoma, said lung squamous cell carcinoma inhibitors and / or medicaments for treating or improving lung squamous cell carcinoma comprising the aforementioned double-stranded RNA molecule and / or antisense oligonucleotide composition.

[0037] The medicament for treating or improving squamous cell carcinoma of the lung provided by the present invention contains the double-stranded RNA molecule, its modifications, or a pharmaceutically acceptable salt thereof.

[0038] The dosage forms of the above-mentioned lung squamous cell carcinoma inhibitors or drugs may be tablets, capsules, drops, pills, powders, solutions, suspensions, emulsions, granules, liposomes, transdermal preparations, lozenges, suppositories, or lyophilized powder injections.

[0039] In the foregoing, the active ingredient of the lung squamous cell carcinoma inhibitor and / or the drug for treating or improving lung squamous cell carcinoma may be the double-stranded RNA molecule, its modifications, or a pharmaceutically acceptable salt thereof. The active ingredient of the lung squamous cell carcinoma inhibitor and / or the drug for treating or improving lung squamous cell carcinoma may also contain other substances, which can be determined by those skilled in the art based on the efficacy of the lung squamous cell carcinoma inhibitor and / or the drug for treating or improving lung squamous cell carcinoma.

[0040] In the above description, the lung squamous cell carcinoma inhibitor and / or drug for treating or improving lung squamous cell carcinoma may contain, in addition to the double-stranded RNA molecule, its modifications, or a pharmaceutically acceptable salt thereof, a suitable carrier or excipient. The carrier materials here include, but are not limited to, water-soluble carrier materials (such as polyethylene glycol, polyvinylpyrrolidone, organic acids, etc.), poorly soluble carrier materials (such as ethyl cellulose, cholesterol stearate, etc.), and enteric-coated carrier materials (such as cellulose acetate phthalate and carboxymethyl ethyl cellulose, etc.). Water-soluble carrier materials are preferred. Various dosage forms can be formulated using these materials, including but not limited to tablets, capsules, pellets, aerosols, pills, powders, solutions, suspensions, emulsions, granules, liposomes, transdermal preparations, lozenges, suppositories, lyophilized powder injections, etc. These can be conventional formulations, sustained-release formulations, controlled-release formulations, and various microparticle delivery systems. Various carriers known in the art can be widely used to formulate unit-dose dosage forms into tablets. Examples of carriers include diluents and absorbents such as starch, dextrin, calcium sulfate, lactose, mannitol, sucrose, sodium chloride, glucose, urea, calcium carbonate, kaolin, microcrystalline cellulose, and aluminum silicate; humectants and binders such as water, glycerin, polyethylene glycol, ethanol, propanol, starch paste, dextrin, syrup, honey, glucose solution, gum arabic paste, gelatin paste, sodium carboxymethyl cellulose, shellac, methyl cellulose, potassium phosphate, and polyvinylpyrrolidone; and disintegrants. Examples of carriers include dried starch, alginate, agar powder, brown algae starch, sodium bicarbonate and citric acid, calcium carbonate, polyoxyethylene, sorbitol fatty acid esters, sodium dodecyl sulfate, methylcellulose, and ethylcellulose; disintegration inhibitors include sucrose, tristearate, cocoa butter, and hydrogenated oil; absorption enhancers include quaternary ammonium salts and sodium dodecyl sulfate; and lubricants include talc, silica, corn starch, stearates, boric acid, liquid paraffin, and polyethylene glycol. Tablets can also be further formulated into coated tablets, such as sugar-coated tablets, film-coated tablets, enteric-coated tablets, or bilayer and multilayer tablets. Various carriers known in the art can be widely used to formulate unit-dose dosage forms into pills. Examples of carriers include diluents and absorbents such as glucose, lactose, starch, cocoa butter, hydrogenated vegetable oil, polyvinylpyrrolidone, gelucire, kaolin, and talc; binders such as gum arabic, tragacanth, gelatin, ethanol, honey, liquid sugar, rice paste, or flour paste; and disintegrants such as agar powder, dried starch, alginate, sodium dodecyl sulfate, methylcellulose, and ethylcellulose. Various carriers known in the art can be widely used to formulate unit dosage forms into suppositories. Examples of carriers include polyethylene glycol, lecithin, cocoa butter, higher alcohols, esters of higher alcohols, gelatin, and semi-synthetic glycerides.To formulate unit-dose dosage forms for injection, such as solutions, emulsions, lyophilized powders for injection, and suspensions, all diluents commonly used in the art can be used, such as water, ethanol, polyethylene glycol, 1,3-propanediol, ethoxylated isostearyl alcohol, polyoxyethylene isostearyl alcohol, polyoxyethylene sorbitan fatty acid esters, etc. Additionally, to prepare isotonic injections, appropriate amounts of sodium chloride, glucose, or glycerol can be added to the injection formulation. Furthermore, conventional solubilizers, buffers, pH adjusters, etc., can also be added. Furthermore, if necessary, colorants, preservatives, flavorings, tasters, sweeteners, or other materials can be added to the pharmaceutical formulation. The above dosage forms can be administered via injection, including subcutaneous, intravenous, intramuscular, and intracavitary injections; via cavities, such as rectal and vaginal; via the respiratory tract, such as nasal; and via mucosal administration. Injection is the preferred route of administration.

[0041] The present invention also provides MLT1L in the applications described above.

[0042] The present invention also provides the use of the aforementioned MLT1L as a biomarker in the preparation of products for the production of lung squamous cell carcinoma inhibitors and / or medicaments for the treatment or improvement of lung squamous cell carcinoma.

[0043] The product may be a reagent or kit for detecting the activity or content of MLT1L.

[0044] This invention reveals that MLT1L is expressed at low levels in normal lung cells but is significantly highly expressed in lung squamous cell carcinoma cells. Detecting MLT1L expression levels in lung squamous cell carcinoma can provide a reference for the clinical diagnosis of this disease. This invention designs and synthesizes Smart Silencer by targeting MLT1L, which can reduce MLT1L expression levels and significantly inhibit the viability, proliferation, migration, and invasion of lung squamous cell carcinoma cells. This is of great significance for the development of novel anti-lung squamous cell carcinoma gene drugs, and has broad application prospects and significant economic value. Attached Figure Description

[0045] Figure 1 To identify HERV-derived lncRNAs associated with lung squamous cell carcinoma using RNA-seq. A represents HERV-derived lncRNAs highly expressed in SK-MES-1 lung squamous cell carcinoma cells; B represents the expression of MLT1L in proximal, distal adjacent normal tissues, and lung squamous cell carcinoma tissues; C represents the chromosomal location of MLT1L and the distribution of MLT1L reads in cells (Beas-2B, SK-MES-1) and tissues (proximal, distal adjacent normal tissues, and lung squamous cell carcinoma tissues).

[0046] Figure 2To detect the expression of MLT1L in lung squamous cell carcinoma cells and lung squamous cell carcinoma tissues using RT-qPCR. In this study, A represents the expression of MLT1L in normal lung cells Beas-2B and squamous cell carcinoma cell line SK-MES-1; B represents the expression of MLT1L in proximal, distal adjacent normal cells and lung squamous cell carcinoma tissues.

[0047] Figure 3 To detect the inhibitory level of Smart Silencer on MLT1L using RT-qPCR.

[0048] Figure 4 To interfere with MLT1L-induced reduction in the viability of lung squamous cell carcinoma cells.

[0049] Figure 5 To interfere with the reduction in the proliferative capacity of lung squamous cell carcinoma cells caused by MLT1L.

[0050] Figure 6 Interfering with MLT1L leads to a decrease in the migration ability of lung squamous cell carcinoma cells.

[0051] Figure 7 Interference with MLT1L leads to a weakening of the invasive ability of lung squamous cell carcinoma cells. Detailed Implementation

[0052] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0053] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0054] Unless otherwise specified, all quantitative experiments in the following examples are performed in triplicate.

[0055] The following examples use GraphPad Prism 8 statistical software to process the data. The experimental results are expressed as mean ± standard deviation. t tests were used, with P < 0.05 (*) indicating a significant difference, P < 0.01 (**) indicating a highly significant difference, P < 0.001 (***) indicating a highly significant difference, and P < 0.001 (****) indicating a highly significant difference.

[0056] Example 1: Screening of lncRNAs associated with lung squamous cell carcinoma

[0057] 1. Sample collection

[0058] Normal human lung cells (Beas-2B) and lung squamous cell carcinoma cells (SK-MES-1) were purchased from Wuhan Pronosei Life Science Technology Co., Ltd., with catalog numbers CL-0496 and CL-0213, respectively.

[0059] Seven clinically diagnosed squamous cell carcinoma of the lung, along with paired proximal and distal adjacent tissue specimens, were collected. These samples were surgical resection specimens from patients with squamous cell carcinoma of the lung, and all samples were obtained from Peking University Cancer Hospital. The acquisition of all specimens was approved by the Ethics Committee of Peking University Cancer Hospital. Clinical data from the tissue samples included tumor size, TNM stage, metastasis, histopathological grade, postoperative disease-free survival time, and overall survival.

[0060] 2. Strand-specific transcriptome sequencing

[0061] Normal human lung cells (Beas-2B) and lung squamous cell carcinoma cells (SK-MES-1), along with samples of lung squamous cell carcinoma and proximal and distal adjacent normal tissues, were sent to Beijing Liuhe BGI Genomics Co., Ltd. for strand-specific transcriptome sequencing.

[0062] 3. Data Analysis

[0063] Using two mainstream RNA-seq differential analysis algorithms, DESeq2 and edgeR, genes with FDR < 0.05 and changes of 2-fold or more were considered to have significant differences, and new lncRNAs from HERVs were screened out.

[0064] The results are as follows Figure 1 As shown, by analyzing strand-specific transcriptome sequencing data, lncRNAs derived from HERVs that are highly expressed in lung squamous cell carcinoma cells were screened. Figure 1 Among them, MLT1L was the lncRNA with the most significant fold-wise expression. Similarly, compared with proximal and distal adjacent normal tissues, MLT1L was highly expressed in lung squamous cell carcinoma tissues. Figure 1 (B and C in the middle).

[0065] The nucleotide sequence of MLT1L is SEQ ID No. 10 in the sequence listing.

[0066] Example 2: Expression of MLT1L in lung squamous cell carcinoma cell lines and lung squamous cell carcinoma tissues

[0067] 1. Cell Culture

[0068] Beas-2B cell line (Pronosa, CL-0496) was routinely cultured in MEM medium (Gibco, 11095-080) containing 10% inactivated fetal bovine serum (Gibco, 10099-141) and 1% penicillin-streptomycin (Gibco, 15140-122); SK-MES-1 cell line (Pronosa, CL-0213) was routinely cultured in DMEM high-glucose medium (Gibco, 11995065) containing 10% inactivated fetal bovine serum (Gibco, 10099-141) and 1% penicillin-streptomycin (Gibco, 15140-122); and cultured statically in a CO2 incubator (Thermo, 320) at 37°C, 5% CO2, and saturated humidity. When the cells reach approximately 80% confluence in the culture flask, passage them, aspirate the original culture medium, and wash the cells with 1×PBS (Gibco, C10010500CP). Add an appropriate amount of 0.25% trypsin-EDTA (Gibco, 25200056) to digest the cells. Observe the cell status under an inverted microscope (OLYMPUS, CKX53). When the cells become round (cytoplasmic retraction), aspirate the 0.25% trypsin-EDTA, add 10 ml of DMEM high-glucose complete medium to stop digestion, repeatedly pipette to disperse the cells, and seed them in DMEM high-glucose complete medium at a 1:2 ratio. Incubate in a CO2 incubator for further culture.

[0069] 2. Total RNA extraction from cells

[0070] Reagent: TaKaRa MiniBEST Universal RNA Extra (TAKARA, 9767)

[0071] (1) Cell treatment: Remove Beas-2B and SK-MES-1 cells from the CO2 incubator, remove the original culture medium, and wash the cells with 1X PBS. Add an appropriate amount of 0.25% trypsin-EDTA to the cell culture flask, digest the cells for 1 min, discard the 0.25% trypsin-EDTA, add 1 mL of complete culture medium, pipette the cells to detach them, transfer the cells to 1.5 mL Eppendorf tubes (Thermo, 3448 PK), centrifuge at 1500 rpm for 3 min using a microcentrifuge (Eppendorf, Centrifuge 5425), and wash the cells once with 1X PBS.

[0072] (2) Lysis: Add 350 μL of lysis buffer RL to the collected cells (please ensure that 50×DTT Solution has been added before use). Use a pipette to repeatedly pipette until there is no obvious precipitate in the lysis buffer. Let the lysis buffer stand at room temperature for 2 min.

[0073] (3) Genomic DNA removal: Place the gDNA Eraser Spin Column onto a 2 mL Collection Tube. Transfer the lysis buffer to the gDNA Eraser Spin Column. Centrifuge at 12,000 rpm for 1 min using a benchtop high-speed centrifuge (SCILOGEX, D3024). Discard the gDNA Eraser Spin Column and retain the filtrate in the 2 mL Tube.

[0074] (4) Add an equal volume of 70% ethanol to the solution from step (3) above, and mix thoroughly using a pipette. Immediately transfer the entire mixture (including the precipitate) to the RNA Spin Column (containing 2 mL of Collection Tube). Centrifuge at 12,000 rpm for 1 min and discard the filtrate. Place the RNA Spin Column back into the 2 mL Collection Tube.

[0075] (5) Washing the RNA Spin Column: Add 500 μL of Buffer RWB to the RNA Spin Column, centrifuge at 12,000 rpm for 30 s, and discard the filtrate. Add 600 μL of Buffer RWB to the RNA Spin Column, centrifuge at 12,000 rpm for 30 s, and discard the filtrate (repeat this step). Place the RNA Spin Column back onto a 2 mL Collection Tube and centrifuge at 12,000 rpm for 5 min.

[0076] (6) Incubation: Place the RNA Spin Column on a 1.5 mL RNase-Free Collection Tube, open the lid and let it stand at room temperature for 5 min to allow residual ethanol to evaporate. Add 100 μL of RNase-Free dH2O to the center of the RNA Spin Column membrane and let it stand at room temperature for 5 min.

[0077] (7) RNA elution: Elute RNA by centrifuging at 12,000 rpm for 2 min.

[0078] (8) Storage: Label the RNase-free collection tube, measure the concentration of eluted RNA using an ultra-micro UV-Vis spectrophotometer, and store the RNA at -20°C.

[0079] 3. Extraction of total RNA from lung squamous cell carcinoma and adjacent tissues of paired lung squamous cell carcinoma

[0080] (1) Take 100mg of frozen squamous cell carcinoma of the lung and adjacent tissues of the proximal and distal ends and grind them quickly and thoroughly in liquid nitrogen, and add 300μL DNAElution Buffer and 3μL RNase A.

[0081] (2) Incubate at 37℃ for 30 minutes to digest, shaking occasionally to mix.

[0082] (3) Add 5 μL of Proteinease K to each tube and mix thoroughly. Incubate at 55°C for 1 hour, shaking occasionally to mix.

[0083] (4) Add 300 μL of phenol-chloroform-isoamyl alcohol mixture (25:24:1), mix thoroughly by inverting, centrifuge at 13000g for 10 min at room temperature, and take the supernatant.

[0084] (5) Add 600 μL of anhydrous ethanol, 1 μL of Glycogen, and 30 μL of 3M NaAc. Mix thoroughly by inverting and then precipitate at -20℃ for 16 hours.

[0085] (6) Centrifuge at 16100g for 30 minutes at 4℃ and remove the supernatant.

[0086] (7) Wash once with pre-cooled 75% ethanol, centrifuge at 4°C and 16000g for 30 min, and remove the supernatant.

[0087] (8) Let the precipitate stand at room temperature for 10 minutes.

[0088] (9) Add 50 μL of RNase-free water, incubate at 37°C for 10 min to dissolve, place the centrifuge tube on ice, and determine its concentration. Store the sample at -20°C for later use. Agarose gel electrophoresis is used to evaluate the total RNA quality; a 28S:18S ratio ≥ 2 is considered to indicate good total RNA quality.

[0089] 4. cDNA synthesis

[0090] PrimeScript TM RT reagent Kit with gDNA Eraser (TAKARA, RR047A)

[0091] (1) Removal of genomic DNA

[0092] The RNA samples were thawed on ice as shown in the table below. The reaction premix was prepared on ice. The reaction premix can be prepared by adding 2 to the number of samples to ensure that there is enough reaction premix. Then, it was aliquoted into each reaction tube. Finally, each RNA sample was added to each reaction tube.

[0093] Table 1. Reaction system for removing genomic DNA

[0094] Reagents Added volume (μL) 5×gDNA Eraser Buffer 2.0 gDNA Eraser 1.0 Total RNA —— <![CDATA[RNase Free dH2O]]> Make up to 10 μL

[0095] Genomic DNA removal reaction conditions: 42℃, 2 min; after the reaction, the sample was immediately placed on ice.

[0096] (2) Reverse transcription reaction

[0097] The reaction system is shown in Table 2. Prepare the reaction premix on ice. The premix can be prepared by adding 2 to the number of samples to ensure sufficient premix. Then, aliquot 10 μL into each reaction tube from step (1). After gentle mixing, briefly incubate and place in a PCR amplification instrument (BIO-RAD, T100 Thermal Cycler) for reverse transcription. After the reaction, the synthesized cDNA is temporarily stored at 4°C and stored long-term at -20°C.

[0098] Table 2. Reverse transcription reaction system

[0099]

[0100]

[0101] Table 3. Reverse transcription reaction time

[0102] Temperature (℃) time 37 15min 85 5s 4 ∞

[0103] 5. qPCR

[0104] Using the SYBR-Green Real-Time Quantitative Reagent Kit (TaKaRa, TB) Premix Ex Taq™ (Code No. RR420A) was used for two-step real-time quantitative PCR (LightCycler 480 System, Roche).

[0105] 1. Prepare the PCR reaction solution according to the components in Table 4 below (prepare the reaction solution on ice). The reaction conditions are shown in Table 5. Real-time quantitative PCR primer information is shown in Table 6.

[0106] Table 4. Real-time quantitative PCR reaction system

[0107] Reagents Dosage (μL) TB Green Premix Ex Taq(Tli RNaseH Plus)(2×) 10.0 PCR Forward Primer (10μm) 0.4 PCR Reverse Primer (10μm) 0.4 cDNA template (<100ng) 2.0 Sterilized water 7.2 Total 20.0

[0108] Table 5. Real-time quantitative PCR reaction conditions

[0109]

[0110]

[0111] Table 6. Primers for Real-Time Quantitative PCR

[0112] name Upstream primer (5'-3') Downstream primer (5'-3') β-actin CCACGAAACTACGTTCAACTCC GTGATCTCCTTCTGCATCCTGT MLT1L-1 AGCCTGAGGACGACATCAATAC CCATAACAAGAAGTCCAGAGGG MLT1L-2 CTGAGGACGACATCAATACA ATAACAAGAAGTCCAGAGGG

[0113] 6. Data Processing

[0114] Each group had 3 replicates, with 3 independent assays performed. β-actin was used as an internal reference gene, and the ΔCT was calculated using the formula ΔCT = CT. 实验组 / 对照组 -CT β-actin The standardized data for each group were analyzed using GraphPad Prism 8.0 via one-way ANOVA and plotted. A p-value < 0.05 was considered statistically significant.

[0115] The results are as follows Figure 2 As shown in Figures A and B, compared with normal lung cells Beas-2B, the expression of MLT1L in the squamous cell carcinoma line SK-MES-1 was significantly increased (P<0.05); compared with proximal and distal adjacent normal tissues, the expression of MLT1L in lung squamous cell carcinoma was significantly upregulated.

[0116] Example 3: Effect of Smart Silencer's inhibition of MLT1L expression on SK-MES-1 function in squamous cell carcinoma cells.

[0117] 1. Cell culture of squamous cell carcinoma SK-MES-1 was the same as in Example 1.

[0118] 2. Design and synthesis of Smart Silencer sequences targeting MLT1L

[0119] Chain-specific transcriptome sequencing was performed on squamous cell carcinoma of the lung and proximal and distal adjacent normal tissues. After analyzing the sequencing data, the MLT1L gene from HERVs was screened and obtained. Based on the secondary structure of MLT1L, Smart silencer (Raybot Biotech, Inc3CM001) and NC (Raybot Biotech, Inc3N0000001-1-5) were designed and synthesized.

[0120] The aforementioned Smart silencer was prepared by mixing three siRNAs and three ASOs in a molar ratio of 1:1:1:1:1:1, dissolving them in RNase-free H2O, and then preparing a 20 μM stock solution.

[0121] The Smart Silencer composition consists of three ASOs and three siRNAs, with specific target sequence information shown in Table 8.

[0122] Table 8. Detailed information on ASO and siRNA

[0123]

[0124]

[0125] siRNA-1 is obtained by annealing the following two sequences:

[0126] 5'-GAGUCACUGUGGAUAAAGAdTdT-3' (SEQ ID No. 1), 5'-UCUUUAUCCACAGUGACUCdTdT-3' (SEQ ID No. 2).

[0127] siRNA-2 is obtained by annealing the following two sequences:

[0128] 5'-GCCUGUACUCUAAUCCAAAdTdT-3' (SEQ ID No. 3), 5'-UUUGGAUUAGAGUACAGGCdTdT-3' (SEQ ID No. 4).

[0129] siRNA-3 is obtained by annealing the following two sequences:

[0130] 5'-GGAUGACACCCAGAGUUUAdTdT-3' (SEQ ID No. 5), 5'-UAAACUCUGGGGUCAUCCdTdT-3' (SEQ ID No. 6).

[0131] ASO is a chemically modified short-chain nucleic acid of 20 nucleotides, with the entire chain linked by phosphate thiophosphate modification. In the nucleotide sequence of ASO, positions 6-15 are unmodified deoxyribonucleotides, and positions 1-5 and 16-20 are 5 ribonucleotides modified with 2'OMe, which triggers ribonuclease H1 to cleave the RNA chain.

[0132] The ASO-1 sequence is: UGACACCCAGAGTTTACCCU (SEQ ID No. 7).

[0133] The ASO-2 sequence is: UGGAUAAAGAGTTGTGACCC (SEQ ID No. 8).

[0134] The ASO-3 sequence is: AUUGUCCCATTGCAAGGUGA (SEQ ID No. 9).

[0135] 3. SK-MES-1 cell transfection

[0136] (1) Smart Silencer and Smart Silencer NC are packaged and stored separately to avoid repeated freeze-thaw cycles.

[0137] (2) SK-MES-1 cell transfection

[0138] 1) One day before transfection, remove SK-MES-1 cells from the CO2 incubator, aspirate the original culture medium, and wash the cells with 1×PBS. Add 3 mL of 0.25% trypsin-EDTA, digest the cells for 1 min, discard the 0.25% trypsin-EDTA, add 10 mL of DMEM, and pipette to detach the cells. Count the SK-MES-1 cells and adjust the medium to 2.0 × 10⁶ cells / mL using DMEM high-glucose complete medium containing 10% fetal bovine serum and free of antibiotics. 5 The cells were seeded into 12-well cell culture plates (Thermo, 150628), with 1 mL of culture medium per well. The cell culture plates were shaken to spread the medium evenly across the bottom of the wells. The plates were then placed on a workbench and left to stand for a while. The cells were then observed under an inverted microscope to check the uniformity of the cell distribution. Finally, the plates were placed in a CO2 incubator for cell culture.

[0139] 2) Culture the cells for 24 hours to achieve a confluence of 40% at the time of transfection.

[0140] 3) Preparation of Lipofectamine 3000 dilution: Dilute 3 μL of Lipofectamine 3000 with 50 μL of serum-free Opti-MEM I serum-reduced medium (Gibco, 31985-070) in each well and mix gently to obtain Lipofectamine 3000 dilution.

[0141] 4) Experimental group (Smart Silencer): First, 4 μL of Smart Silencer (40 pmol) (Ribobio, lnc3CM001) was diluted with serum-free Opti-MEM I serum-reduced medium and incubated at room temperature for 5 min. Then, Lipofectamine 3000 dilution solution was added, gently mixed, and incubated at room temperature for 15 min.

[0142] 5) Control group (Smart Silencer NC): First, 4 μL of Smart Silencer NC (Ribobio, lnc3N0000001-1-5) was diluted with serum-free Opti-MEM I serum-reduced medium and incubated at room temperature for 5 min. Then, Lipofectamine 3000 dilution was added, gently mixed, and incubated at room temperature for 15 min.

[0143] 6) Pipette 100 μL of Smart Silencer and Smart Silencer NC into each well containing cell culture medium. Gently mix by shaking the plate back and forth.

[0144] 7) After culturing cells for 6 hours, remove the culture medium containing the transfection complex and replace it with DMEM high-glucose complete culture medium.

[0145] 8) After incubating the cells at 37°C for 48 hours in a CO2 constant temperature incubator, subsequent experiments were carried out.

[0146] 9) After transfection, cells were collected and the interference efficiency of Smart Silencer against MLT1L was detected by qRT-PCR.

[0147] 4. ATPase activity

[0148] (1) Cell plating

[0149] One day before transfection, SK-MES-1 cells were removed from the CO2 incubator, the DMEM complete medium was aspirated, and the cells were washed with 1×PBS. 3 mL of 0.25% trypsin-EDTA was added to a T75 cell culture flask, and the cells were digested for 1 min. The 0.25% trypsin-EDTA was discarded, and 10 mL of DMEM was added. The cells were detached by pipetting. SK-MES-1 cells were counted, and the medium was adjusted to 6.0 × 10⁶ cells / mL using DMEM complete medium containing 10% fetal bovine serum and free of antibiotics. 4 The cells were seeded into 96-well cell culture plates (Thermo, 150628), with 100 μL of culture medium per well. The cell culture plates were shaken to spread the cells evenly across the bottom of the wells. The plates were then placed on a workbench and left to stand for a while. The cells were then observed under an inverted microscope to check the uniformity of the cell distribution. Finally, the plates were placed in a CO2 incubator for cell culture.

[0150] (2) Cell transfection

[0151] 1) Culture the cells for 24 hours to achieve a confluence of 30% at the time of transfection.

[0152] 2) For each well, dilute 0.4 μL SmartSilencer and 0.4 μL Smart Silencer NC with 5 μL of serum-free Opti-MEM I serum-depleted medium and mix gently.

[0153] 3) Gently mix Lipofectamine 3000 with 50 μL of Opti-MEM I serum-reduced medium to dilute 0.3 μL of Lipofectamine 3000.

[0154] 4) Incubate steps 2) and 3) above at room temperature for 5 minutes.

[0155] 5) After incubation for 5 minutes, mix diluted Smart Silencer and diluted Lipofectamine 3000 separately; mix diluted Smart Silencer NC and diluted Lipofectamine 3000. Gently mix and incubate at room temperature for 15 minutes.

[0156] 6) Pipette 10 μL of the Smart Silencer-Lipofectamine 3000 complex and the Smart SilencerNC-Lipofectamine 3000 complex into each well containing cell culture medium. Gently mix by shaking the plate back and forth.

[0157] 7) After culturing cells for 6 hours, remove the culture medium containing the transfection complex and replace it with DMEM containing 10% FBS + 10% penicillin antibody.

[0158] 8) Cells were cultured at 37°C in a CO2 constant temperature incubator, and the ATPase activity of the cells was detected at 0h, 24h, 48h and 72h.

[0159] (3) ATPase activity detection

[0160] 1) Thaw the frozen luminescence detection reagent and equilibrate to room temperature.

[0161] 2) Remove the cell culture plate and allow it to equilibrate at room temperature for 10 minutes.

[0162] 3) Prepare the test solution. Add 15 μL of test reagent to each sample: mix the culture medium and test reagent first.

[0163] 4) Take the cell culture medium from the 96-well plate and add 100 μL of detection reagent.

[0164] 5) Shake at room temperature for 2 minutes to promote cell lysis.

[0165] 6) Let it sit at room temperature for 10 minutes to allow the luminescence signal to stabilize.

[0166] 7) Use a multi-functional microplate reader for chemiluminescence detection at a wavelength of 450 nm.

[0167] 8) Calculate the relative viability of cells based on chemiluminescence readings.

[0168] 5. Colony Formation Experiment

[0169] (1) SK-MES-1 cells were transfected according to step 2 of Example 2 using the Smart Silencer transfection method. After 48 hours of transfection, the SK-MES-1 cells were removed from the CO2 incubator, the culture medium in the 12-well cell culture plate was aspirated, and the cells were washed with 1X PBS. 200 μL of 0.25% trypsin-EDTA was added to the cell culture plate, the cells were digested for 1 min, the 0.25% trypsin-EDTA was discarded, and the cells were resuspended in serum-free DMEM medium containing antibiotics.

[0170] (2) Cell plate counting: Inoculate 2 ml of cell suspension into each well of a 6-well plate at a concentration of 2000 cells per well. Gently shake the cell culture plate in a cross direction to disperse the cells evenly.

[0171] (3) Place in a CO2 constant temperature incubator for 1 to 2 weeks, and replace with fresh culture medium as needed according to the pH change of the culture medium.

[0172] (4) When visible clones appear in the culture dish, stop the culture, discard the culture medium, carefully wash twice with PBS, and air dry. Fix with 4% paraformaldehyde for 25 min, discard the 4% paraformaldehyde, carefully wash twice with PBS, and air dry. Stain with crystal violet for 10 min, slowly wash away the stain with running water, and air dry.

[0173] (5) Take pictures using a microscope.

[0174] 6. Scratch test

[0175] (1) Cell plate marking lines: Before seeding cells into the culture plate, use a marker pen to draw horizontal lines on the back of the culture plate (to facilitate positioning the same field of view).

[0176] (2) Transfect SK-MES-1 cells according to step 2 of Example 2 using the Smart Silencer transfection method. After 48 hours of transfection, remove the SK-MES-1 cells from the CO2 incubator, aspirate the culture medium from the 12-well cell culture plate, and wash the cells with 1X PBS. Add 200 μL of 0.25% trypsin-EDTA to the cell culture plate, digest the cells for 1 min, discard the 0.25% trypsin-EDTA, and resuspend the cells in serum-free DMEM medium containing antibiotics.

[0177] (3) Cell plate counting, based on 2.5 x 10⁻⁶ cells per well. 5 The cells were seeded at different concentrations, with 1 ml of cell suspension injected into each well of a 12-well plate. The culture dish was then gently shaken in a cross-shaped motion to disperse the cells evenly.

[0178] (4) The culture plate was placed in a CO2 constant temperature incubator at 37℃ and incubated for 24 hours.

[0179] (5) Creating scratches: After culturing for 24 hours, use a ruler as a guide and a 100μL pipette to create cell scratches (the tip of the pipette should be perpendicular to the culture plate and the cell layer should be scratched. It is best to maintain a consistent pressure and try to complete the scratch in one go to ensure that the width of each scratch is the same). The direction of the scratches should be perpendicular to the marking line.

[0180] (6) Remove the culture medium, wash gently with PBS 3 times to remove cell debris caused by the scratch, and add serum-free culture medium.

[0181] (7) Take pictures using a microscope as a 0h control.

[0182] (8) Place the culture plate in an incubator and take pictures at 24h and 48h respectively.

[0183] (9) Analyze the experimental results based on the collected images and quantify the experimental results.

[0184] 7. Transwell experiment

[0185] (1) Before the experiment, the pre-packaged Matrigel (Gibco, A1413301) was placed in a 4°C refrigerator overnight from -80°C. The Matrigel melted from a solid state to a liquid state.

[0186] (2) Coating the basement membrane: Dilute Matrigel at a ratio of 1:99 using DMEM / F12 medium (Gibco, 11320-032) and coat the upper surface of the bottom membrane of the Transwell chamber (the whole process should be carried out on ice, otherwise Matrigel will solidify at 10°C). Place the chamber in a CO2 constant temperature incubator and incubate the cells at 37°C for 3 hours.

[0187] (3) Hydrate the basement membrane: Aspirate the residual liquid in the chamber, add 50 μL of FBS-free and antibiotic-free culture medium to each well, and incubate at 37°C for 30 min.

[0188] (4) Transfect SK-MES-1 cells according to step 2 of Example 2 using the Smart Silencer transfection method. After 48 hours of transfection, remove the SK-MES-1 cells from the CO2 incubator, aspirate the culture medium from the 12-well cell culture plate, and wash the cells with 1X PBS. Add 200 μL of 0.25% trypsin-EDTA to the cell culture plate, digest the cells for 1 min, discard the 0.25% trypsin-EDTA, resuspend the cells in serum-free, antibiotic-free DMEM medium, count the cells using a cell counting chamber, and dilute the cell concentration to 1×10⁻⁶ cells with serum-free, antibiotic-free DMEM medium. 5 / mL, for later use.

[0189] (5) Add 200 μL of diluted cell suspension to the upper chamber of the Transwell chamber, and add 700 μL of medium containing 10% FBS (containing antibiotics) to the lower chamber of the 24-well culture plate. Note that air bubbles should not be generated between the lower culture medium and the chamber.

[0190] (6) The culture plates were placed in a CO2 incubator at 37℃ and incubated for 24 and 48 hours.

[0191] (7) Remove the chamber, rinse twice with PBS, fix in 4% paraformaldehyde for 20 min in a 24-well plate, rinse twice with PBS, stain with crystal violet solution for 15 min, and carefully wipe away the cells in the upper layer of the microporous membrane of the chamber with a cotton swab.

[0192] (8) Take pictures under an inverted microscope, randomly count 10 fields of view for each sample, take the average value, and perform statistical analysis.

[0193] turn out:

[0194] 1) In the interference experiment, compared with the negative control group (Smart Silencer-NC), Smart Silencer significantly inhibited the expression of MLT1L. Figure 3 ).

[0195] 2) In the ATPase activity assay, compared with the negative control group (Smart Silencer-NC), the cell viability of the MLT1L-interfered experimental group was reduced. Figure 4 ).

[0196] 3) In the colony formation assay, compared with the negative control group (Smart Silencer-NC), the cell proliferation capacity of the MLT1L-interfered experimental group was weakened. Figure 5 ).

[0197] 4) In migration experiments, compared with the negative control group (Smart Silencer-NC), the cell migration ability of the MLT1L-interference experimental group was significantly reduced. Figure 6 ).

[0198] 5) In the invasion assay, compared with the negative control group (Smart Silencer-NC), the number of cells that crossed the basement membrane of the transwell chamber, which had been coated with matrix gel, was significantly reduced in the MLT1L-interfered experimental group. Figure 7 ).

[0199] The above experimental results demonstrate that the Smart Silencer specifically targeting the non-coding RNA MLT1L provided by this invention exhibits excellent inhibitory effects, and interference with MLT1L significantly inhibits the viability, proliferation, migration, and invasion of SK-MES-1 cells. The Smart Silencer targeting the long non-coding RNA MLT1L can be used to develop novel anti-lung squamous cell carcinoma gene drugs and to prepare lung squamous cell carcinoma detection kits, possessing significant importance, broad application prospects, and substantial economic value.

[0200] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. An application characterized in that, The application is the use of MLT1L or / and substances that regulate the activity or content of MLT1L in the preparation of products for treating or improving squamous cell carcinoma of the lung or in the preparation of inhibitors for squamous cell carcinoma of the lung; the MLT1L is a lncRNA with the nucleotide sequence SEQ ID No.

10.

2. The application according to claim 1, characterized in that, The regulation of MLT1L activity or content refers to downregulating, inhibiting, or reducing MLT1L activity or content.

3. The application according to claim 1 or 2, characterized in that, The substance that regulates the activity or content of MLT1L is a composition containing double-stranded RNA molecules and / or antisense oligonucleotides. The double-stranded RNA molecule is as follows: g1) A double-stranded RNA molecule consisting of nucleotide sequences SEQ ID No. 1 and SEQ ID No. 2 from the sequence listing; g2) A double-stranded RNA molecule composed of nucleotide sequences SEQ ID No. 3 and SEQ ID No. 4 from the sequence listing; g3) A double-stranded RNA molecule composed of nucleotide sequences SEQ ID No. 5 and SEQ ID No. 6 from the sequence listing; The antisense oligonucleotide molecule is as follows: f1) The nucleotide sequence is a single-stranded RNA & DNA hybrid of SEQ ID No. 7 in the sequence listing; f2) The nucleotide sequence is a single-stranded RNA & DNA hybrid of SEQ ID No. 8 in the sequence listing; f3) The nucleotide sequence is the single-stranded RNA & DNA hybrid of SEQ ID No. 9 in the sequence listing.

4. The application according to any one of claims 1-3, characterized in that, The treatment or improvement of lung squamous cell carcinoma is to inhibit the proliferation of lung squamous cell carcinoma cells and / or tissues.

5. The application according to any one of claims 1-4, characterized in that, The inhibition of lung squamous cell carcinoma cell proliferation is manifested in any of the following: B1) Reduced invasiveness of lung squamous cell carcinoma cells; B2) Decreased activity of lung squamous cell carcinoma cells; B3) Reduced migration ability of lung squamous cell carcinoma cells.

6. The double-stranded RNA molecule and / or the antisense oligonucleotide as described in claim 3.

7. A lung squamous cell carcinoma inhibitor and / or a medicament for treating or improving lung squamous cell carcinoma, wherein the lung squamous cell carcinoma inhibitor and / or the medicament for treating or improving lung squamous cell carcinoma comprises a composition of the double-stranded RNA molecule and / or antisense oligonucleotide as described in claim 3.

8. The composition used in the application of claim 3.

9. MLT1L in any of the applications described in claims 1-5.

10. The use of MLT1L as a biomarker as described in claim 9 in products for the preparation of lung squamous cell carcinoma inhibitors and / or medicaments for the treatment or improvement of lung squamous cell carcinoma.