Bacterial strain composition for preventing and treating red weevil and application of bacterial strain composition
By combining Serratia marcescens ZZLG-12 and Penicillium fungus ZZAF-7, the problem of unstable effect of single pathogen in controlling red palm weevil was solved, efficient and environmentally friendly prevention and control effects were achieved, and the use of chemical pesticides was reduced.
Patent Information
- Application Number
- CN202511288272.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-10
- Publication Date
- 2025-10-28
AI Technical Summary
Existing technologies for controlling red palm weevils with single pathogens are unstable and easily lead to environmental pollution and drug resistance. Chemical control methods are effective but cause serious environmental pollution, while physical control methods are difficult to control large-scale infections.
A composite strain combination of Serratia marcescens ZZLG-12 and Penicillium ZZAF-7 was used with a concentration of 1.0×109 CFU/mL and a volume ratio of 1:1 to prepare a biological agent for controlling red palm weevils.
It improves the field pest control efficiency of pathogens, reduces dependence on chemical pesticides, reduces environmental pollution, and provides theoretical and technical support for new green pesticides.
Smart Images

Figure CN120843376A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biological control technology for the red brown weevil, and in particular to a combination of strains for controlling the red brown weevil and its application. Background Technology
[0002] The red palm weevil (Rhynchophorus ferrugineus Oliver) belongs to the order Coleoptera, family Curculionidae, subfamily Rhynchophorinae, and genus Rhynchophorus. In 2003, it was listed as a major invasive species seriously damaging palm plants. Currently, this insect has been found to infest more than 30 species of palms. Adult red palm weevils lay their eggs inside plant tissues. The larvae bore into the stems and soft tissues of the growing points, damaging the plant's vascular system and affecting water and nutrient transport. Severe infestations can lead to hollow stems and even death. Therefore, once the insect has bored into the host's stem, early symptoms are difficult to detect, and by the time they are discovered, the stem is almost completely hollowed out. Various methods exist for controlling the red palm weevil, including plant quarantine, physical control, chemical control, and biological control, with chemical control being the most widely used. However, while this method is effective, it causes environmental pollution and pesticide residues, and easily leads to drug resistance in the red palm weevil, significantly reducing its control efficacy. Physical control is simple and easy to implement, and does not pollute the environment, but it is more difficult to control large-scale infestations. Currently, there are many reports both domestically and internationally on the use of insect pathogens to control the red palm weevil. For example, reports have disclosed the successful isolation of five bacterial strains from naturally infected and dead red palm weevil larvae, with *Serratia marcescens* exhibiting the highest insecticidal activity. However, the control effect of a single pathogen is unstable and not significant. To improve the pathogenicity of a single pathogen, it is considered to combine pathogenic fungi with bacteria. Currently, there is little research on the control of pathogenic mixtures. Some studies have shown that mixing *Serratia marcescens* with *Metarhizium anisopliae* can improve the pathogenicity of a single strain against the German cockroach (*Blattella germanica*). Summary of the Invention
[0003] The purpose of this invention is to provide a combination of strains for controlling the red palm weevil and its application, in order to solve the problems existing in the prior art. The combination of Serratia marcescens ZZLG-12 and Penicillium fungus ZZAF-7 has a good control effect on the red palm weevil and has a toxicity synergistic effect, providing theoretical and technical support for the development of new green pesticides.
[0004] To achieve the above object, the present invention provides the following solutions:
[0005] This invention provides a strain combination for controlling the red brown weevil, the strain combination comprising Serratia marcescens ZZLG-12 and Penicillium cuddlyae ZZAF-7;
[0006] The *Serratia marcescens* ZZLG-12 strain was deposited on July 21, 2025, at the Guangdong Provincial Center for Microbial Culture Collection (GDMCC No.: 66718), located at Institute of Microbiology, Guangdong Academy of Sciences, No. 100 Xianlie Middle Road, Yuexiu District, Guangzhou, Guangdong Province.
[0007] The Penicillium fungus ZZAF-7 was deposited on July 21, 2025, at the Guangdong Provincial Center for Microbial Culture Collection (GDMCC No.: 66717), located at Institute of Microbiology, Guangdong Academy of Sciences, No. 100 Xianlie Middle Road, Yuexiu District, Guangzhou, Guangdong Province.
[0008] Optionally, the *Serratia marcescens* ZZLG-12 and the *Penicillium* fungus ZZAF-7 are mixed in the form of a bacterial solution;
[0009] The viable cell concentration of the strain combination was 1.0 × 10⁻⁶. 9 CFU / mL.
[0010] Optionally, the volume ratio of the *Serratia marcescens* ZZLG-12 bacterial solution to the *Penicillium* ZZAF-7 bacterial solution is 1:1.
[0011] The present invention also provides the application of the aforementioned strain combination in the control of the red brown weevil.
[0012] The present invention also provides a biological agent for controlling the red brown weevil, the active ingredient of which is the aforementioned strain combination.
[0013] Optionally, the *Serratia marcescens* ZZLG-12 and the *Penicillium* fungus ZZAF-7 are mixed in the form of a bacterial solution;
[0014] The concentration of the strain combination was 1.0 × 10⁻⁶. 9 CFU / mL.
[0015] Optionally, the volume ratio of the *Serratia marcescens* ZZLG-12 bacterial solution to the *Penicillium* ZZAF-7 bacterial solution is 1:1.
[0016] The present invention also provides a method for controlling the red brown weevil, including the step of treating the red brown weevil with the aforementioned strain combination.
[0017] The present invention discloses the following technical effects:
[0018] This invention isolated six pathogenic fungi and four pathogenic bacteria from suspected diseased red palm weevils and identified the isolated strains. Since the control effect of a single pathogen is unstable and insignificant, this invention sought to enhance the virulence of individual strains by combining fungi and bacteria to co-infect red palm weevil larvae. Finally, it was found that the combination of *Serratia marcescens* ZZLG-12 and *Penicillium* ZZAF-7 showed good control effect against red palm weevils, exhibiting a virulence synergistic effect. *Serratia marcescens* ZZLG-12 was deposited at the Guangdong Provincial Microbial Culture Collection Center on July 21, 2025, with accession number GDMCC No: 66718; *Penicillium* ZZAF-7 was also deposited at the same center on July 21, 2025, with accession number GDMCC No: 66717. This invention can improve the field control efficacy of pathogens, provide theoretical and technical support for the development of new green pesticides, thereby reducing dependence on chemical pesticides and mitigating environmental pollution. Attached Figure Description
[0019] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0020] Figure 1 The images show red-brown weevil larvae suspected of being infected with pathogenic bacteria; A: ZZLG-1; B: ZZLG-2; C: ZZLG-3; D: ZZLG-4; E: ZZLG-5; F: ZZLG-6; G: ZZLG-7; H: ZZLG-8; I: ZZLG-9; J: ZZLG-10; K: ZZLG-11; L: ZZLG-12; M: ZZLG-13; N: ZZLG-14; O: ZZLG-15;
[0021] Figure 2 The images are adult red-brown weevils suspected of being infected with pathogenic fungi; A: ZZAF-1; B: ZZAF-2; C: ZZAF-3; D: ZZAF-4; E: ZZAF-5; F: ZZAF-6; G: ZZAF-7; H: ZZAF-8; I: ZZAF-9;
[0022] Figure 3 The following are suspected red-brown weevil larvae infected with pathogenic fungi: A: ZZLF-1; B: ZZLF-2; C: ZZLF-3; D: ZZLF-4;
[0023] Figure 4Isolation and culture of pathogenic bacteria for the red-brown weevil; A: ZZLG-1; B: ZZLG-2; C: ZZLG-3; D: ZZLG-4; E: ZZLG-5; F: ZZLG-6; G: ZZLG-7; H: ZZLG-8; I: ZZLG-9; J: ZZLG-10; K: ZZLG-11; L: ZZLG-12; M: ZZLG-13; N: ZZLG-14; O: ZZLG-15;
[0024] Figure 5 Isolation and culture of pathogenic fungi of the red brown weevil; A: ZZAF-1; B: ZZAF-2; C: ZZAF-3; D: ZZAF-4; E: ZZAF-5; F: ZZAF-6; G: ZZAF-7; H: ZZAF-8; I: ZZAF-9; J: ZZLF-1; K: ZZLF-2-1; L: ZZLF-2-2; M: ZZLF-3-1; N: ZZLF-3-2; O: ZZLF-4;
[0025] Figure 6 For the initial screening of the pathogenicity of the isolated strain to the red-brown weevil; A: Initial screening of bacterial pathogenicity; B: Initial screening of fungal pathogenicity;
[0026] Figure 7 Symptoms of infection with pathogenic fungus strain ZZAF-7; A: 2 days after inoculation with ZZAF-7; B: 2 days after transfer to a humid environment;
[0027] Figure 8 Agarose gel electrophoresis image of PCR products of bacterial 16S rDNA; M: DL2000 DNA Marker; 1: ZZLG-1; 2: ZZLG-12; 3: ZZLG-13; 4: ZZLG-15;
[0028] Figure 9 Phylogenetic tree of bacterial isolates from the red-brown weevil;
[0029] Figure 10 Microscopic observation of spores isolated from the pathogenic fungus *Zygophyllum erythropterum*; A: ZZAF-2; B: ZZAF-4; C: ZZAF-7; D: ZZAF-9; E: ZZLF-1; F: ZZLF-2-1;
[0030] Figure 11 Microscopic observation of the hyphae of the pathogenic fungus isolate of the red-brown weevil; A: ZZAF-2; B: ZZAF-4; C: ZZAF-7; D: ZZAF-9; E: ZZLF-1; F: ZZLF-2-1;
[0031] Figure 12Agarose gel electrophoresis image of PCR products of fungal rDNA-ITS; M: DL2000 DNA Marker; 1: ZZAF-2; 2: ZZAF-4; 3: ZZAF-7; 4: ZZAF-9; 5: ZZLF-1; 6: ZZLF-2-1;
[0032] Figure 13 Phylogenetic tree of fungal isolates from the red-brown weevil;
[0033] Figure 14 The differences in lethality of single pathogens and strains in combination with red palm weevil larvae are shown in the following: A: Effect of combination of ZZLG-12 and ZZAF-7; B: Effect of combination of ZZLG-12 and ZZAF-4; C: Effect of combination of ZZLG-13 and ZZLF-2-1.
[0034] Figure 15 The cumulative mortality rate of strains ZZLG-12 and ZZAF-7 and their combination effects. Detailed Implementation
[0035] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0036] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0037] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0038] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0039] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0040] Example 1: Isolation, Identification and Preservation of Strains
[0041] 1. Materials and Methods
[0042] 1.1 Collection and rearing of test insects
[0043] Adult red palm weevils were attracted to six-layer funnel traps using aggregation pheromones. They were then collected and brought back to the laboratory for rearing and breeding. Adults were paired male to female and reared in 240mL breathable culture bottles. Fresh sugarcane was provided every 7 days to supplement the adults' nutrition and provide a place for the females to lay eggs. Eggs were picked up with a brush and placed in 90mm diameter petri dishes. Hatched larvae were transferred to 60mm diameter petri dishes and reared individually with a semi-artificial diet for red palm weevils (Hou Youming, Guo Weiyi, Li You, et al. A semi-artificial diet for red palm weevils and its preparation method [P]. 2014, ZL201310331218.0.). Once they reached the fourth instar, they were used for experimental purposes. Rearing conditions were 28℃ and 75% relative humidity. Except for the adult rearing, which used a 12L:12D light cycle, all other stages were reared in complete darkness. Meanwhile, during the rearing process, red-brown weevils that died due to suspected pathogen infection were collected, and the surface of the dead insects was specifically observed for hyphae and conidia or for bacterial pus discharge.
[0044] 1.2 Isolation and purification of pathogenic strains of the red-brown weevil
[0045] 1.2.1 Isolation and purification of pathogenic bacteria
[0046] The carcasses of red brown weevils that died from bacterial infection under natural conditions were collected as experimental samples. The insect bodies were pretreated according to the method of Pu Yuchen (Pu Yuchen. In vitro immunogenicity of red brown weevils and its physiological regulation of immune trade-off with in vivo [D]. Fujian Fuzhou: Doctoral Dissertation of Fujian Agriculture and Forestry University. 2020.). First, debris and fragments attached to the insect body surface were removed with a brush. Then, the sample surface was disinfected with 75% ethanol for 2 seconds, followed by treatment with 0.1% mercuric chloride solution for 2.5 minutes, and finally rinsed three times with sterile water. Then, bacterial pus from the infected area of the insect body was collected using an inoculation loop and inoculated onto nutrient agar (NA) medium using a streak plate method. The plates were inverted and incubated in a (28±2)℃ biochemical incubator for 12 hours. Next, single colonies appearing on the plate were picked up with an inoculation loop and re-streaked. After more than three isolation and purification processes, pure cultures of the isolated strains were obtained. The isolated strains were numbered, named, and stored at 4℃ for later use.
[0047] 1.2.2 Isolation and purification of pathogenic fungi
[0048] Red palm weevils that died from fungal infection under natural conditions were collected as test samples. One to five pieces of the infected tissue on the surface of the insect were cut with a scalpel and placed on potato dextrose agar (PDA) medium. The plates were then inverted and cultured at 25°C for 7 days. Following the method of Xue Rui et al. (Xue Rui, Chen Jie, Fu Yufei, et al. Isolation, identification and virulence of a strain of Beauveria bassiana infecting palm weevil larvae [J]. Plant Protection, 2023, 49(4):131-139.), a small amount of spores or hyphae were picked and inoculated onto new PDA medium plates for purification and culture. After more than three purification cycles, pure cultures of the isolated strains were obtained. All isolated strains were numbered and named, and then stored at 4°C for short-term use.
[0049] 1.3 Initial screening of pathogenic bacteria and fungal strains of the red-brown weevil
[0050] In a clean bench, pure bacterial cultures were inoculated onto fresh NA medium using an inoculation loop. Once colonies had covered the entire plate, healthy fourth-instar larvae of the red brown weevil of similar size were selected as test insects. The larvae were placed in the plates, and after bacteria adhered to their surfaces, they were transferred to 9cm glass petri dishes and individually reared with a semi-artificial diet, one larva per dish, repeated three times. The number and time of death of the three larvae were recorded. To rule out other causes of death, the dead larvae were transferred to a sterile environment and cultured for 2–3 days to observe for bacterial ooze, thus preliminarily screening for pathogenic bacterial strains.
[0051] In a clean bench, pure cultures of fungi were inoculated onto fresh PDA medium using an inoculation loop. Once colonies had covered the entire plate, healthy fourth-instar larvae of the red brown weevil of similar size were selected as test insects. The larvae were placed in the plates, and after mycelia or spores adhered to their surfaces, they were transferred to 9cm glass petri dishes and individually reared with a semi-artificial diet, one larva per dish, repeated three times. The number and time of death of the three larvae were recorded. To rule out other causes of death, the dead larvae were transferred to a sterile environment and cultured for 2–3 days to observe whether characteristic mycelia or spores grew on their bodies, thus preliminarily screening for pathogenic fungal strains.
[0052] 1.4 Identification of pathogenic strains of the red-brown weevil
[0053] The pathogenic strains were identified based on morphological characteristics, molecular biological evolutionary relationships, and physiological and biochemical properties.
[0054] 1.4.1 Bacterial Species Identification
[0055] Pure cultured bacterial strains were inoculated onto NA medium, and the characteristics of the colonies formed by each pure culture strain were observed and recorded.
[0056] Use an inoculation loop to pick a single colony of the bacterial strain growing on the NA plate and inoculate it into a 100 mL Erlenmeyer flask containing 50 mL of nutrient broth (NB). Place the Erlenmeyer flask in a shaker at 37°C and incubate overnight at 200 rpm for 12 h to obtain the bacterial culture. Total DNA was extracted from the bacterial strain using a bacterial genomic DNA extraction kit. Using the total DNA as a template, the full-length 16S rDNA sequence of the bacteria was amplified by polymerase chain reaction (PCR) using two universal primers synthesized by Shanghai Sangon Biotech Co., Ltd.: upstream primer 27F (5′-AGAGTTTGATCCTGGCTCAG-3′, SEQ ID NO.1) and downstream primer 1492R (5′-GGTTACCTTGTTACGACTT-3′, SEQ ID NO.2). Each PCR reaction system consisted of the following: 4 μL DNA template, 2 μL each of 10 μM primers 27F and 1492R, 25 μL 2×Taq PCR MasterMix, and 17 μL ddH2O, for a total volume of 50 μL. The PCR reaction conditions were as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 1 min, for a total of 35 cycles; and a final extension at 72℃ for 10 min. After the PCR amplification reaction, 5 μL of the reaction product was subjected to 1% agarose gel electrophoresis. After electrophoresis, the electrophoresis apparatus was turned off, the gel was removed, and placed on an automated gel imaging analyzer. The DNA bands were observed and photographed under UV light to detect the bands and size of the target fragment. PCR products corresponding to samples with prominent target bands after agarose gel electrophoresis were sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. Sequence alignment and homology analysis were then performed to construct a phylogenetic tree.
[0057] However, molecular biology has certain limitations in bacterial identification. Therefore, it is necessary to refer to the "Commonly Used Identification Methods for General Bacteria" and combine them with the physiological and biochemical reactions of the strains for further classification and identification. First, Gram staining kits were used to Gram stain all bacterial isolates to determine their taxa. Then, based on the molecular identification results, bacterial biochemical coding identification tubes were selected for the detection of physiological and biochemical indicators.
[0058] 1.4.2 Fungal Species Identification
[0059] Pure cultures of fungal strains were inoculated onto PDA medium, and the characteristics of the colonies formed by each pure culture strain were observed and recorded.
[0060] To preliminarily identify the taxonomic position of fungi from a morphological perspective, microscopic morphological observation was performed on the isolated fungi. A drop of water was placed in the center of a clean glass slide. A small amount of mycelium and conidia from a well-developed colony of a strain cultured for 7 days was picked up with an inoculation needle and smeared onto the water. A coverslip was then placed on top to prepare a temporary slide. The slide was then placed under a 40x objective lens optical microscope to observe the morphological characteristics of the strain.
[0061] Following the method of Pu Yuchen (Pu Yuchen. In vitro immunogenicity of red palm weevil and its physiological regulation of immune balance with in vivo [D]. Fujian Fuzhou: Doctoral dissertation of Fujian Agriculture and Forestry University. 2020.), based on the grinding of fungi with liquid nitrogen, total DNA of the strain was extracted using a fungal genomic DNA extraction kit, and the sequence of the internal transcribed spacer (ITS) region of fungal ribosomal gene, i.e., the rDNA-ITS region, was amplified using PCR reaction technology. Primer sequences were designed according to the method of Xue Rui et al. (Xue Rui, Chen Jie, Fu Yufei, et al. Isolation, identification and virulence of a Beauveria bassiana strain infecting palm weevil larvae [J]. Plant Protection, 2023, 49(4):131-139.). Using the genomic DNA of the strain as a template, two universal primers, ITS1 (5′-TCCGTAG-GTGAACCTGCGG-3′, SEQ ID NO.3) and ITS4 (5′-TCCTCCGCT-TATTGATATGC-3′, SEQ ID NO.4), synthesized by Shanghai Sangon Biotech Co., Ltd., were used. Each PCR reaction system was as follows: 2 μL DNA template, 2 μL each of 10 μM primers ITS1 and ITS4, 25 μL 2×Taq PCR MasterMix and 19 μL ddH2O, for a total system of 50 μL. The PCR reaction conditions were as follows: 94℃ pre-denaturation for 10 min; 94℃ denaturation for 1 min, 55℃ annealing for 1 min, 72℃ extension for 2 min, for a total of 25 cycles; and a final extension at 72℃ for 10 min. After the PCR amplification reaction, 5 μL of the reaction product was subjected to 1% agarose gel electrophoresis to detect the bands and size of the target fragment. The PCR products corresponding to samples with prominent target bands after agarose gel electrophoresis were sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. Sequence alignment and homology analysis were then performed to construct a phylogenetic tree.
[0062] 1.5 Affinity assessment among tested strains
[0063] The affinity between bacteria and fungi was evaluated using the bacterial cake method (Sachura, Tao Jinshan, Su Shaofeng, et al. Optimization of microbial antagonism detection method and its application in straw fermentation strains [J]. Animal Husbandry and Feed Science, 2020, 41(5):19-26.).
[0064] The preparation method of indicator bacteria culture dishes is as follows: Pathogenic bacteria are inoculated into NB liquid medium and cultured with shaking for 48 hours. The culture solution is then filtered through a sterile filter membrane with a pore size of 0.22 μm to obtain the bacterial fermentation broth. 100 μL of the bacterial fermentation broth is spread onto a PDA medium plate.
[0065] The preparation method of the test bacterial cake is as follows: pathogenic fungi are inoculated onto PDA medium. After the fungi have grown to cover the entire medium, bacterial cakes are made using a punch (Φ=5mm) and placed in the center of the indicator plate. PDA plates without bacterial fermentation broth are used as the control group.
[0066] After culturing the above plates in a biochemical incubator at 25℃ for 3 days, the diameter of the pathogenic bacterial colonies was determined using the cross-hatching method, and the inhibition rate was calculated. Finally, the combined strains with low inhibition rates were screened out. The formula for calculating the inhibition rate is as follows: Mycelial inhibition rate (%) = (Coronary diameter of control group - Colony diameter of experimental group) / Colony diameter of control group × 100.
[0067] 2 Results and Analysis
[0068] 2.1 Symptoms of infection with pathogenic bacteria in red-brown weevils
[0069] Figure 1 The following are the red-brown weevil larvae suspected of being infected with pathogenic bacteria, represented by the following numbers: A: ZZLG-1; B: ZZLG-2; C: ZZLG-3; D: ZZLG-4; E: ZZLG-5; F: ZZLG-6; G: ZZLG-7; H: ZZLG-8; I: ZZLG-9; J: ZZLG-10; K: ZZLG-11; L: ZZLG-12; M: ZZLG-13; N: ZZLG-14; O: ZZLG-15.
[0070] Figure 2 The following are the adult red-brown weevils suspected of being infected with pathogenic fungi, as indicated by their respective numbers: A: ZZAF-1; B: ZZAF-2; C: ZZAF-3; D: ZZAF-4; E: ZZAF-5; F: ZZAF-6; G: ZZAF-7; H: ZZAF-8; I: ZZAF-9.
[0071] Figure 3 The following are the red-brown weevil larvae suspected of being infected with pathogenic fungi, as indicated by the numbers: A: ZZLF-1; B: ZZLF-2; C: ZZLF-3; D: ZZLF-4.
[0072] Depend on Figure 1 It is evident that the symptoms of the 15 red-brown weevil larvae suspected of being infected with pathogenic bacteria varied significantly, but all generally exhibited a certain degree of erosion on their carcasses. Most notably, the larvae of ZZLG-12 and ZZLG-13 had reddish bacterial pus oozing from their surfaces.
[0073] Depend on Figure 2 and Figure 3 It is evident that the symptoms of the nine adult red brown weevils and four larvae suspected of being infected with the pathogenic fungus showed significant differences, but all exhibited overall stiffness of the insect body. The surface of the stiffened insects not only grew characteristic hyphae but also germinated to produce spores. Specifically, the stiffened insects of ZZAF-1, ZZAF-2, ZZAF-7, and ZZLF-1 initially grew green hyphae in the crevices of the intersegmental membranes on the thorax and abdomen, which germinated into green conidia over time; while the remaining stiffened insects developed white hyphae and conidia on their surface.
[0074] 2.2 Isolation, purification, and initial virulence screening of the pathogenic bacterium of the red-brown weevil
[0075] Figure 4 The pathogenic bacteria isolated and purified are numbered as follows: A: ZZLG-1; B: ZZLG-2; C: ZZLG-3; D: ZZLG-4; E: ZZLG-5; F: ZZLG-6; G: ZZLG-7; H: ZZLG-8; I: ZZLG-9; J: ZZLG-10; K: ZZLG-11; L: ZZLG-12; M: ZZLG-13; N: ZZLG-14; O: ZZLG-15.
[0076] Figure 5 The pathogenic fungi isolated and purified are numbered as follows: A: ZZAF-1; B: ZZAF-2; C: ZZAF-3; D: ZZAF-4; E: ZZAF-5; F: ZZAF-6; G: ZZAF-7; H: ZZAF-8; I: ZZAF-9; J: ZZLF-1; K: ZZLF-2-1; L: ZZLF-2-2; M: ZZLF-3-1; N: ZZLF-3-2; O: ZZLF-4.
[0077] Depend on Figure 4It was found that all 15 bacterial isolates formed smooth colonies on NA medium, exhibiting four different colors: red, milky white, golden yellow, and pale yellow. Golden yellow isolates were the most numerous, accounting for half of the total strains. Five isolates (ZZLG-2, ZZLG-3, ZZLG-4, ZZLG-6, and ZZLG-9) formed translucent colonies, while the other strains formed opaque colonies. Furthermore, when picking up colonies of ZZLG-12 with an inoculation loop, they easily formed filaments, which is a crucial characteristic distinguishing this strain from the other isolates.
[0078] Fifteen isolated single colonies were selected from PDA plates for further purification and culture. Two fungal strains were isolated from each of the ZZLF-2 and ZZLF-3 larvae, and were respectively named ZZLF-2-1, ZZLF-2-2 and ZZLF-3-1, ZZLF-3-2. Figure 5 It was observed that all 15 fungal isolates formed different colonies on PDA medium, exhibiting five different colors: white, gray, green, brown, and purple, with green isolates being the most numerous. This invention particularly noted that in the early stages of culture, the colonies of strain ZZAF-7 were pale yellow, fluffy, or cottony; during sporulation, the center of the colony gradually turned olive green with a milky white edge; as the colony further expanded and spread, the edge became pale yellow to dark green; and the reverse side of the colony remained pale yellow. Except for ZZLF-2-1, which formed flat colonies, the colonies of the other isolates were all raised.
[0079] The pathogenicity of the isolated bacteria was initially screened, and four dominant strains with certain pathogenicity were identified: ZZLG-1, ZZLG-12, ZZLG-13, and ZZLG-15. Larvae inoculated with these strains all showed mortality, with the number of deaths within 6 days being 1, 2, 1, and 1 respectively. Figure 6 (A) After transferring the dead worms to a sterile environment for 2-3 days of culture, the worms still showed the same symptoms. Figure 1 Consistent bacterial pus.
[0080] The pathogenicity of the isolated fungi was initially screened, and six dominant strains with certain pathogenicity were identified: ZZAF-2, ZZAF-4, ZZAF-7, ZZAF-9, ZZLF-1, and ZZLF-2-1. Larvae inoculated with these strains all showed mortality, with the mortality numbers within 6 days being 1, 2, 2, 1, 1, and 2 respectively. Figure 6 (B) After transferring the dead worms to a sterile environment for 2-3 days of culture, the worms still showed the same symptoms. Figure 2 and Figure 3 Consistent characteristic hyphae and spores ( Figure 7 ).
[0081] 2.3 Species identification of pathogenic bacteria of the red-brown weevil
[0082] 2.3.1 Morphological characteristics of pathogenic bacterial isolates
[0083] After initial pathogenicity screening, bacterial isolates with some virulence to the red-brown weevil all formed smooth colonies on NA medium, exhibiting three different colors: red, golden yellow, and pale yellow. Except for ZZLG-12 and ZZLG-15, which formed flat colonies, the colonies of the other isolates were all raised. Four isolates formed opaque colonies, and the edges of ZZLG-1 colonies were irregular, while the other strains formed colonies with regular edges (Table 1).
[0084] Table 1. Colony morphology characteristics of bacterial isolates from the pathogenic bacteria of the red-brown weevil.
[0085]
[0086] 2.3.2 16S rDNA sequence analysis of pathogenic bacterial isolates
[0087] The results of agarose gel electrophoresis showed that the target fragments amplified by PCR from the DNA of the four bacterial strains were all around 1400 bp in size. Figure 8 ).
[0088] Phylogenetic trees constructed from the 16S rDNA sequences of four bacterial isolates and several reference strains with high homology showed that isolate ZZLG-1 formed a cluster with *Enterobacter*; isolate ZZLG-12 clustered with *Serratia marcescens* in the same branch; isolate ZZLG-13 was most closely related to *Klebsiella pneumoniae*; and isolate ZZLG-15 showed the highest homology with *Alcaligenes faecalis*. Figure 9 Therefore, they can be identified as belonging to the genera *Enterobacter*, *Serratia*, *Klebsiella*, and *Alcaligenes*, respectively.
[0089] 2.3.3 Physiological and biochemical characteristics of pathogenic bacterial isolates
[0090] The Gram-negative isolates ZZLG-1, ZZLG-12, and ZZLG-13, which are pathogenic bacteria of the red-brown weevil, are facultatively aerobic, consistent with the characteristics of Enterobacteriaceae. Table 2 further shows that isolates ZZLG-1 and ZZLG-12 are negative for urease, and both ZZLG-1 and ZZLG-13 can produce acid in media containing xylose. Except for ZZLG-12, both ZZLG-1 and ZZLG-13 can produce acid in media containing sorbitol. Table 3 shows that isolate ZZLG-15 is Gram-negative, cannot ferment sugars, and is positive for oxidase and catalase reactions. It is negative for indole, MR, VP, gelatin liquefaction, and amylase tests, and can utilize nitrates but not nitrites.
[0091] Table 2. Physiological and biochemical characteristics of Enterobacteriaceae isolated from the pathogenic bacteria of the red-brown weevil.
[0092]
[0093]
[0094] Note: "+" indicates a positive result, and "-" indicates a negative result.
[0095] Table 3. Physiological and biochemical characteristics of Alcaligenes ZZLG-15 from the pathogenic bacterial isolate of the red-brown weevil.
[0096]
[0097] Note: "+" indicates a positive result, and "-" indicates a negative result.
[0098] Based on the molecular phylogenetic relationships of bacterial strains ( Figure 9 Based on the colony culture morphology (Table 1) and physiological and biochemical reactions (Tables 2 and 3), ZZLG-1 was identified as Enterobacter asburiae, ZZLG-12 as Serratia marcescens, ZZLG-13 as Klebsiella pneumoniae, and ZZLG-15 as Alcaligenes faecalis.
[0099] 2.3.4 Morphological characteristics of pathogenic fungal isolates
[0100] Figure 10 and Figure 11The microscopic observations of spores or hyphae of the pathogenic fungus *C. chinensis* are numbered as follows: A: ZZAF-2; B: ZZAF-4; C: ZZAF-7; D: ZZAF-9; E: ZZLF-1; F: ZZLF-2-1.
[0101] The morphological characteristics of the colonies and microscopic cells of the fungal isolates that showed some toxicity to the red-brown weevil after initial pathogenicity screening are shown in Table 4.
[0102] Table 4. Morphological characteristics of isolates of the pathogenic fungus of the red-brown weevil.
[0103]
[0104] 2.3.5 rDNA-ITS sequence analysis of pathogenic fungal isolates
[0105] The results of agarose gel electrophoresis showed that the target fragments amplified by PCR from the DNA of the six fungal strains were approximately 600 bp in size. Figure 12 ).
[0106] Homology alignment and phylogenetic analysis of fungal rDNA-ITS sequences showed that ZZAF-2, ZZAF-4, and ZZAF-9 belong to the genus *Talaromyces*, and are most closely related to *T. variabilis*; isolate ZZAF-7 forms a cluster with *Penicillium cuddlyae*; ZZLF-1 shows the highest homology with *P. concentricum*; and isolate ZZLF-2-1 clusters with *Aspergillus spiperis* in the same clade. Figure 13 Based on this, combined with colony culture characteristics and microscopic cell morphology ( Figure 5 , Figure 10 and Figure 11 ZZAF-2, ZZAF-4, and ZZAF-9 were identified as *T. variabilis*, ZZLF-7 as *P. concentricum*, ZZAF-7 as *P. cuddlyae*, and ZZLF-2-1 as *A. piperis*.
[0107] 2.4 Affinity assessment between fungi and bacteria
[0108] Table 5 shows that the inhibition rates of ZZAF-9 with the four bacteria were +26.42%, +22.01%, +16.98%, and +16.35%, respectively, while the inhibition rates of ZZLF-2-1 with the four bacteria were +13.84%, +24.53%, +15.09%, and +22.64%, respectively. This indicates that ZZAF-9 and ZZLF-2-1 may have antagonistic effects with the four bacteria, while the other strains showed high affinity and can be considered as candidate strain combinations for subsequent toxicology experiments.
[0109] Table 5 Antibacterial rates between fungi and bacteria
[0110]
[0111] Note: "+" indicates low affinity between strains, and "-" indicates high affinity between strains.
[0112] The selection of ZZLG-12 and ZZAF-7 for combination testing of the pathogenicity of the strains against the red-brown weevil was based on the following scientific evidence and experimental results: First, the two strains showed good compatibility in affinity tests (inhibition rate of -8.18%), significantly better than other potential combinations; second, ZZLG-12 has unique red ooze characteristics and strong pathogenicity (Table 1), while ZZAF-7 showed rapid sporulation and hyphal penetration ability (…). Figure 10 C, Figure 11 The synergistic mechanism between the two strains (C and C) is theoretically feasible; in addition, the physiological characteristics of the two strains (such as culture conditions and growth rate) are similar, which facilitates formulation preparation and field application. These characteristics make them the combination with the greatest development potential.
[0113] The 16S rDNA nucleotide sequence of ZZLG-12 is (SEQ ID NO.5):
[0114]
[0115] The rDNA-ITS nucleotide sequence of ZZAF-7 is (SEQ ID NO.6):
[0116] TAGACGGGGGGGACTCTGGGTCCAACCTCCCACCCGTGTATACCGTACCTTGTTGCTTCGGCGGGCCCGCCAGTCTGGCCGCCGGGGGGCACCTGCCCCCGGGCCCGCGCCCGCCGGAGACATCATTGAA CGCTGTCTGAAGATTGCAGTCTGAGCGATAAGCACAAATTAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAG TGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCGCCGTCCCCCGGGGACGGGCCCGAAA GGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTCTGTCACCCGCTCTGCAGGCCCGGCCGGCGCCAGCCGACCCCCTCAACCCTTTTTTTTTTTTCAGGTTGACCTCGGATCAGGTACGA.
[0117] The aforementioned ZZLG-12 was identified as Serratia marcescens and was deposited on July 21, 2025, at the Guangdong Provincial Center for Microbial Culture Collection, located at Institute of Microbiology, Guangdong Academy of Sciences, No. 100 Xianlie Middle Road, Yuexiu District, Guangzhou, Guangdong Province, with accession number GDMCC No: 66718.
[0118] The aforementioned ZZAF-7 was identified as a fungus of the genus Penicillium cuddlyae. It was deposited on July 21, 2025, at the Guangdong Provincial Center for Microbial Culture Collection, located at Institute of Microbiology, Guangdong Academy of Sciences, No. 100 Xianlie Middle Road, Yuexiu District, Guangzhou, Guangdong Province, with accession number GDMCC No: 66717.
[0119] Example 2: Pathogenicity determination of the pathogen of the red-brown weevil
[0120] Fourth-instar larvae of the red-brown weevil, of similar weight and size and in good health, were selected as test insects. Three strain combinations were prepared: ZZLG-12 and ZZAF-7, ZZLG-12 and ZZAF-4, and ZZLG-13 and ZZAF-2-1, with a concentration of 1.0 × 10⁻⁶. 9 A fungal spore suspension of 1.0 × 10⁶ conidia / mL, 9 CFU / mL bacterial suspension and 1.0×10 9 A mixed bacterial suspension (cFU / mL, with fungal and bacterial suspensions mixed at a 1:1 volume ratio) was prepared for each treatment group. Fourth-instar larvae of the red-brown weevil were immersed in the suspension for 15 seconds, then removed, their bodies dried with sterile filter paper, and transferred individually to petri dishes lined with moistened filter paper. Artificial feed was provided daily. Each treatment had three replicates, with 10 larvae per replicate, and sterile water served as a blank control. The number of larvae that died within 7 days was recorded for each group.
[0121] In the pathogenicity assay, the corrected mortality rate of the pathogen at each concentration against the larvae of the red-brown weevil was first calculated using the Abbott formula: Corrected mortality rate (%) = (treatment mortality rate - control mortality rate) / (100 - control mortality rate) × 100. Then, the chi-square test was applied. 2 The chi-square test was used to analyze and compare the differences in mortality rates among different strains at the same concentration. The Probit model was used to estimate the half-lethal time, which involved converting mortality data into Probit values and fitting a linear relationship between time and Probit values.
[0122] Fatality (%) = Number of deaths / Total number of deaths × 100%.
[0123] result
[0124] Figure 14 The results in Figure A show that the combination of ZZLG-12 and ZZAF-7 resulted in a significantly higher mortality rate of fourth-instar larvae of the red brown weevil compared to single strains, with average mortality rates of 66.67% (ZZAF-7 + ZZLG-12), 6.67% (ZZLG-12), and 26.67% (ZZAF-7), respectively. These results indicate that the combination of *Serratia marcescens* ZZLG-12 and *Penicillium cuddlyae* ZZAF-7 provides good control of the red brown weevil and exhibits a synergistic effect in virulence. Figure 14 China B and Figure 14The results showed that the combination of ZZLG-12 with ZZAF-4 and the combination of ZZLG-13 with ZZAF-2-1 did not significantly increase the mortality rate of fourth-instar larvae of the red brown weevil, indicating that these two combinations did not have a virulence-enhancing effect. The cumulative mortality rate of fourth-instar larvae was subsequently calculated using the combinations of strains ZZLG-12 and ZZAF-7.
[0125] The combination of strains ZZLG-12 and ZZAF-7 exhibits strong infectivity against the red-brown weevil. Figure 15 The concentration of the mixed bacterial solution was 1.0 × 10⁻⁶. 9 On day 3 after inoculation with CFU / mL suspension, the cumulative mortality rate of fourth-instar larvae was significantly higher than that of the control group; on day 7, the cumulative corrected mortality rate of fourth-instar larvae from the combined strains ZZLG-12 and ZZAF-7 reached 66.67%. The Probit regression equation was y = 0.218x - 1.433 (R²). 2 =0.973), LT 50 The value is 5.10d, and its 95% confidence interval is 4.449-5.974d.
[0126] Based on the above results, this invention isolated six pathogenic fungi and four pathogenic bacteria from suspected diseased red-brown weevils, and identified the isolated strains. The four bacteria were identified as *Enterobacter sburiae*, *Serratia marcescens*, *Klebsiella pneumoniae*, and *Alcaligenes faecalis*; the six fungi were identified as *Talaromyces variabilis*, *Penicillium cuddlyae*, *Penicillium concentricum*, and *Aspergillus piperis*. However, the control effect of a single pathogen is unstable and not significant. To improve the virulence of a single strain, a method was devised to combine fungi and bacteria to co-infect red-brown weevil larvae. Verification has shown that the combination of Serratia marcescens ZZLG-12 and Penicillium cuddlyae ZZAF-7 strains exhibits a synergistic virulence effect when co-infecting fourth-instar larvae of the red brown weevil. This invention provides theoretical and technical support for the development of novel green pesticides.
[0127] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A combination of bacterial strains for controlling the red palm weevil, characterized in that, The strain combination includes Serratia marcescens ZZLG-12 and Penicillium cuddlyae ZZAF-7; The *Serratia marcescens* ZZLG-12 strain was deposited at the Guangdong Provincial Center for Microbial Culture Collection on July 21, 2025, with accession number GDMCC No: 66718. The Penicillium fungus ZZAF-7 was deposited at the Guangdong Provincial Center for Microbial Culture Collection on July 21, 2025, with accession number GDMCC No: 66717.
2. The strain combination as described in claim 1, characterized in that, The *Serratia marcescens* ZZLG-12 and the *Penicillium* fungus ZZAF-7 were mixed in the form of a bacterial solution; The viable cell concentration of the strain combination was 1.0 × 10⁻⁶. 9 CFU / mL.
3. The strain combination as described in claim 2, characterized in that, The volume ratio of the *Serratia marcescens* ZZLG-12 bacterial solution to the *Penicillium* ZZAF-7 bacterial solution is 1:
1.
4. The application of the strain combination as described in claim 1 in the control of the red palm weevil.
5. A biological agent for controlling the red palm weevil, characterized in that, Its active ingredient is the strain combination described in claim 1.
6. The biological agent as described in claim 5, characterized in that, The *Serratia marcescens* ZZLG-12 and the *Penicillium* fungus ZZAF-7 were mixed in the form of a bacterial solution; The concentration of the strain combination was 1.0 × 10⁻⁶. 9 CFU / mL.
7. The biological agent as described in claim 6, characterized in that, The volume ratio of the *Serratia marcescens* ZZLG-12 bacterial solution to the *Penicillium* ZZAF-7 bacterial solution is 1:
1.
8. A method for controlling the red-brown weevil, characterized in that, The procedure includes the step of treating the red-brown weevil with the strain combination described in claim 1.