Neutralizing nucleic acid aptamer specifically combined with human APRIL and application of neutralizing nucleic acid aptamer in inhibition of antibody secretion

Abstract

The invention discloses a neutralizing nucleic acid aptamer capable of being specifically combined with human APRIL and application of the neutralizing nucleic acid aptamer in inhibition of antibody secretion. The neutralizing aptamer disclosed by the invention can efficiently neutralize extracellular APRIL molecules in vivo and in vitro so as to block the combination of the APRIL molecules with human calcium regulatory cyclophilin ligand interaction molecules (TACI) and B cell maturation antigen (BCMA) on a B cell membrane and finally inhibit the generation and secretion of an antibody. Compared with the existing biological agent tetrobercept for targeted neutralization of APRIL, the APRIL neutralization aptamer provided by the invention has the advantages of strong specificity, high affinity, low immunogenicity, low cost and the like, is a novel nucleic acid medicinal preparation for inhibiting antibody secretion, and has a relatively great clinical application prospect.

Description

Technical Field

[0001] This invention belongs to the field of screening and application technology of neutralizing nucleic acid aptamers, specifically relating to neutralizing nucleic acid aptamers that specifically bind to human APRIL and their application in inhibiting antibody secretion. Background Technology

[0002] Apriloin proliferation-inducing ligand (APRIL) acts on the human calmotropic cyclin ligand-interacting molecule (TACI) and B cell maturation antigen (BCMA) on the B cell membrane, promoting antibody production and secretion, thereby exacerbating autoimmune diseases such as systemic lupus erythematosus (SLE). Therefore, targeting and neutralizing APRIL can inhibit antibody production and secretion to some extent, ultimately alleviating autoimmune diseases such as SLE. In recent years, the biologic agent telitacicept, which targets and neutralizes APRIL, has shown some efficacy against autoimmune diseases such as SLE, but its inhibitory efficiency is limited, the therapeutic effect is unsatisfactory, and the cost is high. Therefore, there is an urgent need to develop new, highly effective, safe, and low-cost agents that target and neutralize APRIL.

[0003] Nucleic acid aptamers are single-stranded nucleic acids obtained in vitro through SELEX technology. Their biological functions are similar to antibodies, and they possess advantages such as high specificity, high affinity, low immunogenicity, and low cost, making them promising candidates for application in the biomedical field. Neutralizing nucleic acid aptamers that competitively bind to target molecules can inhibit the binding of target molecules to their specific ligands, thereby blocking the biological function of the target molecule and playing a therapeutic role. Based on this, this invention aims to provide a neutralizing nucleic acid aptamer capable of efficiently neutralizing APRIL, blocking the binding of APRIL to TACI and BCMA on the B cell membrane, thereby inhibiting antibody production and secretion. This has significant clinical and scientific value for further developing new targeted therapies for autoimmune diseases such as SLE. Summary of the Invention

[0004] Purpose of the invention: The technical problem to be solved by the present invention is to provide a neutralizing nucleic acid aptamer that can effectively neutralize APRIL molecules, which play an important role in the maturation and differentiation of B cells. It can effectively block the binding of APRIL to TACI and BCMA on the B cell membrane, thereby inhibiting antibody production and secretion. It has the advantages of high specificity, high affinity, few side effects and low cost.

[0005] Another technical problem to be solved by the present invention is to provide the application of the described neutralizing nucleic acid aptamer in the preparation of drugs that block the binding of APRIL to ligands.

[0006] The final technical problem to be solved by this invention is to provide the application of the described neutralizing nucleic acid aptamer in inhibiting antibody secretion.

[0007] Technical solution: In order to solve the above technical problems, the present invention provides a neutralizing nucleic acid aptamer that specifically binds to human APRIL, wherein the nucleotide sequence of the neutralizing nucleic acid aptamer is any one of those shown in SEQ ID NO.1 to SEQ ID NO.5.

[0008] The neutralizing nucleic acid aptamer further includes any position shown in SEQ ID NO.1 to SEQ ID NO.5 that is modified or conjugated with any chemical group, fluorescent molecule, isotope or drug.

[0009] Preferably, the sequence of the neutralizing nucleic acid aptamer of the present invention is shown in SEQ ID NO. 2 or SEQ ID NO. 5.

[0010] Preferably, the sequence of the neutralizing nucleic acid aptamer of the present invention includes any position in sequence SEQ ID NO. 2 or SEQ ID NO. 5 modified and conjugated by any chemical group, fluorescent molecule, isotope or drug.

[0011] Preferably, the sequence of the neutralizing nucleic acid aptamer includes all nucleic acid sequences that have a sequence similarity greater than 80% to SEQ ID NO. 2 or SEQ ID NO. 5.

[0012] The present invention also includes the application of the aforementioned neutralizing nucleic acid aptamer in the preparation of drugs that block the binding of APRIL to ligands.

[0013] The ligand includes one or both of TACI protein or BCMA protein.

[0014] The concentration of the neutralizing nucleic acid aptamer is 10~1000nM.

[0015] The present invention also includes the application of the aforementioned neutralizing nucleic acid aptamer in inhibiting antibody secretion.

[0016] The antibody is derived from human PBMC cells.

[0017] The antibody is derived from the secretion of human PBMC cells stimulated by R848.

[0018] The antibodies include one or more of IgM, IgG1, IgG2 and IgG3 antibodies.

[0019] The concentration of the neutralizing nucleic acid aptamer is 0.5~4µM.

[0020] Beneficial Effects: The neutralizing nucleic acid aptamer of this invention can efficiently neutralize extracellular APRIL molecules in vitro and in vivo, thereby blocking their binding to human calmotropic cyclin ligand-interacting molecule (TACI) and B cell maturation antigen (BCMA) on the B cell membrane, ultimately inhibiting antibody production and secretion. Compared with existing APRIL-targeting biologics such as telitacicept, the APRIL-neutralizing nucleic acid aptamer of this invention has advantages such as high specificity, high affinity, low immunogenicity, and low cost. It is a novel nucleic acid drug formulation for inhibiting antibody secretion and has great clinical application prospects. Compared with the prior art, this invention has the following advantages: (1) The neutralizing nucleic acid aptamers described in this invention are obtained by screening in vitro using SELEX technology. Compared with biological agents, they have the advantages of short screening cycle, easy synthesis, no batch-to-batch differences, strong specificity, low immunogenicity, and low cost. (2) The neutralizing nucleic acid aptamers constructed by the present invention through precise design and modification have stronger neutralizing ability and inhibitory effect, as well as nucleic acid aptamer targeted preparations with intelligent diagnosis and treatment functions; (3) The neutralizing nucleic acid aptamer described in this invention can be loaded with a variety of chemical drugs or coupled with drugs to achieve efficient and precise combined or synergistic treatment, thereby improving the efficiency of targeted therapy. Attached Figure Description

[0021] Figure 1 This is a diagram showing the predicted secondary structure of the candidate APRIL neutralizing aptamer.

[0022] Figure 2 The figure shows the results of the binding ability analysis and specificity identification of nucleic acid aptamers in APRIL.

[0023] Figure 3 The graph shows the results of truncation, optimization, and affinity assays of APRIL neutralizing aptamers. Figure 3 In the diagram, A represents the secondary structure of AP-2. Figure 3 B in the diagram represents the truncated and optimized secondary structure of AP-2a. Figure 3 The figure showing C represents the affinity results for the nucleic acid aptamer AP-2. Figure 3 The figure shows the affinity results for nucleic acid aptamer AP-2a, where D represents the affinity of the aptamer.

[0024] Figure 4 A simulation diagram of the tertiary structure of the APRIL neutralizing aptamer AP-2a; Figure 4 Figure A in the diagram shows the secondary structure of the neutralizing aptamer AP-2a. Figure 4 B in the diagram represents the tertiary structure of the neutralizing aptamer AP-2a.

[0025] Figure 5 3D complex conformation of the neutralizing nucleic acid aptamer AP-2a molecular docking.

[0026] Figure 6 3D interaction diagram of the neutralizing nucleic acid aptamer AP-2a molecular docking.

[0027] Figure 7 The graph shows the detection results of the neutralizing target molecules ability of APRIL neutralizing nucleic acid aptamers.

[0028] Figure 8 The figure shows the results of the detection of the proliferation ability and toxicity of APRIL neutralizing nucleic acid aptamers on PBMC cells.

[0029] Figure 9 The figure shows the results of detecting the ability of APRIL neutralizing nucleic acid aptamers to inhibit antibody secretion in PBMC cells. Detailed Implementation

[0030] To better illustrate the present invention, it will be described and explained in detail below with reference to the accompanying drawings and specific embodiments. However, the preferred embodiments described below are not intended to limit the scope of protection of the present invention.

[0031] The experimental methods, reagents, and equipment used in the following examples are all conventional experimental methods, reagents, and equipment in this technical field.

[0032] The main reagents and materials used included: Ficoll solution (Cytiva, catalog number 17-1440-03), DPBS (10×) buffer (Gibco, catalog number 14200075), recombinant human APRIL protein (Genscript Biotech, catalog number Z05041), human serum albumin HSA (MedChemExpress, catalog number HY-P1956), human IgG (Sangon Biotech (Shanghai) Co., Ltd., catalog number D110501), carboxyl magnetic beads MNPs-COOH (Sangon Biotech (Shanghai) Co., Ltd., catalog number D149007), streptavidin magnetic beads SA-MNPs (Sangon Biotech (Shanghai) Co., Ltd., catalog number D112005), EDC (Sangon Biotech (Shanghai) Co., Ltd., catalog number C600433), and Sulfo-NHS (Shanghai Yuanye Biotechnology Co., Ltd., catalog number S3). 0615), Carboxy magnetic bead activation buffer (Sangon Biotech (Shanghai) Co., Ltd., catalog number D601030), Carboxy magnetic bead coupling buffer (Sangon Biotech, catalog number D601031), HRP-labeled streptavidin SA-HRP (Sangon Biotech (Shanghai) Co., Ltd., catalog number D111054), Bovine serum albumin BSA (Sangon Biotech (Shanghai) Co., Ltd., catalog number A600332), Salmon sperm DNA (Solepro, D8030), Human TACI (nearshore protein, C07R), Human BMCA (nearshore protein, CS79), Human APRIL ELISA kit (Proteintech, KE00645), R848 (MedChemExpress, catalog number HY-13740), 1640 medium (KGI Biotech, catalog number KGL1501), CCK8 kit (Beyotime, catalog number C0038), etc.

[0033] The single-stranded DNA random library, primer sequences, and subsequent nucleic acid aptamer sequences and biotin modifications in the following examples were all synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0034] SEQ ID NO.1 AGCAGAGTTCACGACCCGATAAGCACGCAGTGGCGAGAGGAGAGAAGAGATAGTTAGGAGAGAGTTACATACCAATCGTCGCAG SEQ ID NO.2 AGCAGAGTTCACGACCCGATAAGGACTTCCTCGTACCTAGGAGACTCACATTGACCCTTCGAGTTACATACCAATCGTCGCAG SEQ ID NO.3 AGCAGAGTCACGACCCGATAAGTATCCGCCTCGTCCGCTCTGCGTAGTTACCATTTACCAGAGAGTTACATACCAATCGTCGCAG SEQ ID NO.4 AGCAGAGTTCACGACCCGATAAGCACAGTCCAGTCACCGCAAATAAAGTA AGACCCCAAGCCAGAGTTACATACCAATCGTCGCAG SEQ ID NO.5 GACTTCCTCGTACCTAGGAGACTCACATTGACCCTTCGAGTTACATAC SEQ ID NO.6 AGCAGAGTTCACGACCCGATAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGTTACATACCAATCGTCGCAG SEQ ID NO.7 AGCAGAGTTCACGACCCGATAAG SEQ ID NO.8 CTGCGACGATTGGTATGTAACTC

[0035] Example 1 (1) The random library and primer sequences designed in this embodiment are as follows: Randomized library ssDNA: AGCAGAGTTCACGACCCGATAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGTTACATACCAATCGTCGCAG Upstream primer: AGCAGAGTTTCACGACCCGATAAG Downstream primer: Biotin-CTGCGACGATTGGTATGTAACTC (2) Preparation of 2× binding solution: Dilute 10×DPBS buffer to 2× with sterile water, and then add MgCl2 to a final concentration of 10 mM, salmon sperm DNA to a final concentration of 0.2 mg / mL and bovine serum albumin (BSA) to a final concentration of 2 mg / mL. (3) Preparation of washing solution: Add 5 mM MgCl2 to 1× DPBS buffer; (4) Recombinant human APRIL protein, human IgG, and human HSA were modified onto magnetic nanoparticles (MNPs) using an amidation reaction to prepare APRIL-MNPs, IgG-MNPs, and HSA-MNPs, respectively. Taking the preparation of APRIL-MNPs as an example, the specific operation is as follows: Take 5 mg of MNPs-COOH, wash three times with pre-chilled carboxyl magnetic bead activation buffer, add 1 mL of carboxyl magnetic bead activation buffer containing 2.5 mg EDC and 2.5 mg Sulfo-NHS, and incubate at room temperature (20–30 °C) by rotation for 20 min. Discard the supernatant after magnetic separation, add 1 mL of carboxyl magnetic bead coupling buffer containing 250 µg human APRIL protein, 2.5 mg EDC, and 2.5 mg Sulfo-NHS to the activated MNPs-COOH, and incubate at 4 °C by rotation for 12 h. Discard the supernatant after magnetic separation, add 0.5 mL of freshly prepared 2× binding buffer, and store at 4 °C for later use. Prepare IgG-MNPs and HSA-MNPs using the same preparation steps.

[0036] (5) Take 10 nmols of the newly synthesized single-stranded DNA (ssDNA) random library and dissolve it in 500 µL of sterile water. After denaturing at 95°C for 10 min and immediately placing it on an ice bath for 10 min, add it to an equal volume of APRIL-MNPs (2 mg) solution prepared in step (4) and dispersed in 2× binding solution. Incubate at 37°C with gentle shaking for 60 min. After magnetic separation, wash 3 times with washing solution and boil in a boiling water bath for 10 min. Magnetic separation is then performed to obtain the ssDNA sequence bound to APRIL-MNPs.

[0037] (6) Preparation of secondary libraries: Using the ssDNA sequence bound to APRIL-MNPs obtained in step (5) as a template, PCR was performed with the unlabeled upstream primer AGCAGAGGTTCACGACCCGATAAG and the biotin-labeled downstream primer Biotin-CTGCGACGATTGGTATGTAACTC to amplify the obtained DNA sequence. Specific PCR amplification conditions are shown in Table 1. Table 1 PCR amplification conditions

[0038] Amplification conditions: 95 °C: 5 min, 95 °C: 30 s, 64 °C: 30 s, 72 °C: 30 s, 72 °C: 5 min, store at 12 °C.

[0039] Then, the ssDNA secondary library was separated using alkaline denaturation: 5 mg of streptavidin magnetic beads (SA-MNPs) were washed three times with PBS buffer (0.01 M, pH 7.4). Subsequently, 1 mL of biotin-labeled double-stranded DNA obtained from the above PCR amplification was added to the washed SA-MNPs, and the mixture was incubated at room temperature for 60 min by rotation. After washing three times with PBS, 50 μL of 0.2 M NaOH solution was added, and the mixture was incubated at room temperature for 5 min. The supernatant was magnetically separated and transferred to a new centrifuge tube. An appropriate amount of 0.2 M HCl solution was added to adjust the pH to 7.0. After desalting using a desalting column, the resulting material was used as the secondary library for the next round of screening.

[0040] (7) Reverse screening and multiple rounds of screening: Repeat steps (5) and (6) twice to obtain a sufficient number of ssDNA sequences that bind tightly to APRIL-MNPs. Starting from round 4, a reverse screening procedure is added to remove ssDNA sequences that do not specifically bind to APRIL. First, the secondary library obtained in the previous round of screening is incubated with 500 μg of HSA-MNPs and IgG-MNPs respectively at 37 °C with gentle shaking for 30 min. After magnetic separation, the supernatant is added to 2 mg of APRIL-MNPs and incubated for 60 min. After magnetic separation, the supernatant is discarded, and 200 μL of sterile water is added to APRIL-MNPs and boiled in a boiling water bath for 10 min. After magnetic separation, the supernatant is collected. Repeat step (6) to prepare a new secondary library for use in the next round of screening.

[0041] (8) Ligand competition screening: Starting from the 10th round of screening, ligand competition for binding to APRIL is added. Repeat step (7), adding 5 µg of ligand protein (human TACI and human BCMA) to the solution during the final reaction with APRIL-MNPs. Magnetic separation is performed, and APRIL-MNPs are taken, washed 6 times with washing buffer, and boiled in a boiling water bath for 10 min with 200 μL of sterile water. After magnetic separation, the supernatant is collected. Repeat step (6) to prepare a new secondary library for the next round of screening.

[0042] (9) During the screening process, to improve the affinity and specificity of nucleic acid aptamers, the screening pressure was gradually increased, including reducing the secondary library (from 10 nmoles to 100 pmoles), the amount of target (2 mg to 200 μg), the amount of IgG-MNPs and HSA-MNPs (from 0.5 mg to 2 mg), shortening the positive screening time (from 60 min to 15 min), increasing the reverse screening time (from 30 min to 90 min), and increasing the number of washing cycles (from 3 to 6). After 15 rounds of screening, the enrichment of the secondary library reached a plateau. The products from the last round of screening were selected, amplified by PCR, and then cloned and sequenced for analysis.

[0043] (10) Using DNAMAN software for sequence alignment and analysis, four nucleic acid aptamer sequences capable of binding to APRIL were identified (named AP-1 (SEQ ID NO.1), AP-2 (SEQ ID NO.2), AP-3 (SEQ ID NO.3), and AP-4 (SEQ ID NO.4), respectively). The secondary structures of these four nucleic acid aptamers were further simulated and predicted. The results are as follows: Figure 1 As shown, these four candidate nucleic acid aptamers all have typical stem-loop structures, which participate in the formation of the higher-order structure of nucleic acid aptamers and affect the specificity, affinity, and neutralizing ability of nucleic acid aptamers.

[0044] (11) Identification of nucleic acid aptamers: Four candidate neutralizing nucleic acid aptamers obtained in step (10) were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and dissolved in 1× binding buffer to a concentration of 100 nM. 100 μL of each aptamer was added to a 96-well plate coated with human APRIL, human HSA, and human IgG. The plates were incubated at 37°C for 60 min, washed three times with washing buffer, and then incubated for another 60 min with 100 μL of SA-HRP working solution. The plates were washed six times with washing buffer, and 100 µL of TMB colorimetric solution was added to each well. The plates were then incubated at 37°C for 10 min. Finally, 50 µL of stop solution was added, and the absorbance of each well was immediately measured at 450 nm using a microplate reader. The results are as follows: Figure 2 As shown, all four candidate aptamer sequences can bind to human APRIL, with AP-2 exhibiting relatively strong binding affinity and the best specificity. Therefore, aptamer AP-2 was selected as the representative for further research.

[0045] Example 2: Truncating, Optimizing, and Determining the Secondary Structure and Affinity of Neutralizing Nucleic Acid Aptamers According to the secondary structure of AP-2 ( Figure 3 A) in the sequence is truncated and optimized to obtain a shorter and more affinity neutralizing aptamer ( Figure 3(B) Further determination of AP-2 affinity before and after optimization: Different concentrations of biotin-modified neutralizing aptamers (0 nM, 1 nM, 5 nM, 30 nM, 50 nM, 100 nM, 200 nM, 300 nM, 400 nM, 500 nM) were added to 96-well plates coated with human APRIL (the amount of human APRIL coated in each well was the same). Subsequent operations were the same as step (11) in Example 1. Then, the difference between the average absorbance of each group and the absorbance of the blank control was used as the ordinate, and the concentration of neutralizing aptamers was used as the abscissa. Curve fitting was performed according to the formula for calculating aptamer affinity Y = Bmax X / (Kd + X) (Y: relative average absorbance value; Bmax: maximum absorbance value; X: concentration of neutralizing aptamer; Kd: dissociation constant). The smaller the Kd value, the greater the affinity, and vice versa. The results are as follows. Figure 3 As shown in C and D, after structural modification, the sequence length of the neutralizing aptamer was shortened from 83 bp to 48 bp, and its Kd value was reduced from 79.4 ± 27.6 nM in the original sequence. Figure 3 The C content decreased to 10.27 ± 6.9 nM. Figure 3 (D in the middle).

[0046] Example 3: Tertiary Structure Simulation and Molecular Docking of Neutralizing Nucleic Acid Aptamers Based on the optimized sequence as shown in SEQ ID NO.5, the secondary structure of the neutralizing nucleic acid aptamer ( Figure 4 The A in the text uses 3dRNA / DNA software to simulate its tertiary structure. Figure 4 The A chain of the APRIL protein (PDB ID: 4zch) was downloaded from the RCSB PDB Database. The protein structure was preprocessed using PyMOL to remove heteroatoms (solvent molecules, small molecules, etc.) and repaired, retaining the A chain as the docking protein structure. Finally, molecular docking was performed using the HDOCK program. The results are shown in Figure 1. Figure 5 and Figure 6 As shown, the neutralizing aptamer can form salt bridges, electrostatic interactions, hydrogen bonds, C-H bonds, Pi-H bonds, and hydrophobic interactions (Pi-Sigma, Pi alkylation) with the APRIL protein. Its docking index reached -379.14 at a confidence level of 0.990, indicating that this neutralizing aptamer has a strong binding affinity to APRIL.

[0047] Example 4: Determination of the neutralizing capacity of APRIL aptamers The neutralizing ability of the neutralizing aptamers shown in SEQ ID NO. 5 was detected using a human APRIL ELISA kit (Proteintech, KE00645). First, 100 µL of neutralizing aptamers (shown in SEQ ID NO. 5) at different concentrations (0 nM, 10 nM, 100 nM, 500 nM, 1 µM) were mixed thoroughly with 100 ng / mL of human APRIL protein and added to 96-well microplates coated with human TACI or human BCMA protein (each well had the same amount of human TACI or human BCMA protein coating), with 6 replicates per group. The plates were incubated at 37°C for 60 min. After washing three times with washing buffer, 100 µL of biotin-conjugated APRIL antibody from the kit was added to each well, and the plates were incubated at 37°C for another 60 min. After washing three times with washing buffer, 100 µL of SA-HRP solution was added to each well, and the plates were incubated at 37°C for another 60 min. After washing six times with washing buffer, 100 µL of TMB chromogenic solution was added to each well, and the reaction was incubated at 37°C for 10 min. The reaction was then stopped by adding 50 µL of stop solution to each well. Finally, the absorbance of each well at 450 nm was measured using a microplate reader. Results are as follows: Figure 7 As shown, the absorbance values ​​of each well gradually decreased with increasing concentration of the neutralizing aptamer. When the concentration of the aptamer reached 1 µM, the absorbance value no longer decreased, indicating that a concentration of 1 µM of the neutralizing aptamer could effectively block the binding of APRIL to its ligand.

[0048] Example 5: Toxicity assay of APRIL neutralizing aptamers on human PBMCs The following steps were taken to isolate peripheral blood mononuclear cells (PBMCs) from healthy individuals: 1 mL of 2.5 U / mL heparin sodium solution was mixed with 12.5 mL of whole blood from a healthy individual and 11.5 mL of PBS. Then, 7.5 mL of Ficoll solution was slowly added along the tube wall. The mixture was centrifuged at 18°C, 600 g for 30 min, and the intermediate layer (PBMCs) was carefully aspirated. The PBMCs were washed once with 15 mL of PBS solution, and finally centrifuged at 4°C, 500 g for 10 min. The precipitate was collected, resuspended in freshly prepared 1640 complete culture medium, and the cells were counted. Subsequently, the cells were transferred to 96-well plates for culture, with 5 × 10⁶ cells per well. 5Cells were stimulated with 1 μg / mL R848 and cultured at 37°C and 5% CO2 for 24 h. Then, 0 µM, 0.1 µM, 0.5 µM, 1 µM, 2 µM, and 4 µM of the neutralizing aptamer shown in SEQ ID NO. 5 were added to each experimental group, and the cells were cultured at 37°C and 5% CO2 for 24 h. Subsequently, 10 μL of CCK8 reagent was added to each well, and the cells were cultured for another 4 h. The absorbance at 450 nm was measured using a microplate reader. The results are as follows: Figure 8 As shown, the cell viability of the experimental group and the control group was comparable, with no significant difference, indicating that the neutralizing nucleic acid aptamer has low toxicity and good biosafety to PBMC cells.

[0049] Example 6: Determination of the ability of APRIL neutralizing aptamers to inhibit the secretion of human PBMC antibodies Isolate healthy human PBMCs (procedure as in Example 5) and add them to a 24-well plate, 2 × 10⁶ per well. 6 Cells were cultured in triplicate, with R848 added to a final concentration of 1 μg / mL for stimulation. Then, 0 µM, 0.5 µM, 1 µM, 2 µM, and 4 µM of the neutralizing aptamer shown in SEQ ID NO. 5 were added to each experimental group, and the cells were incubated at 37°C and 5% CO2. Cells were cultured for 5 days under specific conditions, and the supernatant was collected. The secretion of various antibody types was detected using ELISA. Results are as follows: Figure 9 As shown, the secretion of IgM, IgG1, IgG2, and IgG3 all gradually decreased with increasing neutralizing aptamer concentration. When the neutralizing aptamer concentration reached 2 µM, the secretion of IgM and IgG1 was significantly different from the control group. When the concentration reached 4 µM, the secretion of IgG2 and IgG3 was significantly different from the control group, respectively. These results indicate that when the neutralizing aptamer reaches a certain concentration, it can significantly inhibit the secretion of IgM, IgG1, IgG2, and IgG3 antibodies by R848-stimulated human PBMCs, demonstrating great potential and clinical translational prospects for treating autoimmune diseases caused by excessive autoantibody secretion.

Claims

1. A neutralizing nucleic acid aptamer that specifically binds to human APRIL, characterized in that, The nucleotide sequence of the neutralizing nucleic acid aptamer is any one of those shown in SEQ ID NO.1 to SEQ ID NO.

5.

2. The neutralizing nucleic acid aptamer according to claim 1, characterized in that, The neutralizing nucleic acid aptamer also includes any position shown in SEQ ID NO.1 to SEQ ID NO.5 that has been modified or conjugated by any chemical group, fluorescent molecule, isotope or drug.

3. The use of the neutralizing nucleic acid aptamer according to claim 1 or 2 in the preparation of a drug that blocks the binding of APRIL to the ligand.

4. The application according to claim 3, characterized in that, The ligand includes one or both of TACI protein or BCMA protein.

5. The application according to claim 3, characterized in that, The concentration of the neutralizing nucleic acid aptamer is 10~1000nM.

6. The use of the neutralizing nucleic acid aptamer according to claim 1 or 2 in inhibiting antibody secretion.

7. The application according to claim 6, characterized in that, The antibody is derived from human PBMC cells.

8. The application according to claim 6, characterized in that, The antibody was obtained by stimulating human PBMC cells with R848 for secretion.

9. The application according to claim 6, characterized in that, The antibody includes one or more of IgM, IgG1, IgG2 and IgG3 antibodies.

10. The application according to claim 6, characterized in that, The concentration of the neutralizing nucleic acid aptamer is 0.5 ~ 4 µM.

Images