Method for modifying fibroblast and use thereof

By constructing MRC-5 fibroblasts overexpressing VCAM1, CXCL13, and TNFSF13B and co-culturing them with B cells, the problem of insufficient B cell activation in the tumor microenvironment was solved, and the chemotaxis, adhesion, and antibody secretion capabilities of B cells were enhanced, thereby strengthening the anti-tumor immune response.

WO2025251337A1PCT designated stage Publication Date: 2025-12-11SUN YAT SEN UNIVERSITY CANCER CENTER (CANCER HOSPITAL AFFILIATED TO SUN YAT SEN UNIVERSITY CANCER RESEARCH INSTITUTE OF SUN YAT SEN UNIVERSITY)
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2024/099192
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-06-03
Filing Date
2024-06-14
Publication Date
2025-12-11

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively stimulate B cell activation in the tumor microenvironment to enhance anti-tumor immune responses, and methods for modifying fibroblasts need to be developed.

Method used

MRC-5 fibroblasts overexpressing VCAM1, CXCL13, and TNFSF13B were constructed and co-cultured with B cells to promote B cell chemotaxis, adhesion, and antibody secretion. The specific steps included cell isolation, lentiviral infection, and co-culture experiments.

Benefits of technology

It significantly enhanced the chemotaxis and adhesion ability of B cells to fibroblasts and promoted the secretion of B cell antibodies, thus having a potential effect on enhancing anti-tumor immune responses.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2024099192_11122025_PF_FP_ABST
    Figure CN2024099192_11122025_PF_FP_ABST
Patent Text Reader

Abstract

Disclosed is a method for modifying a fibroblast. The method comprises the following steps: collecting peripheral blood from a healthy person, extracting peripheral blood mononuclear cells from the peripheral blood in vitro by using a lymphocyte separation medium, and sorting and purifying B cells by using immunomagnetic beads; and constructing human CXCL13, TNFSF13B and VCAM1 overexpression plasmids by using molecular cloning technology, and infecting MRC-5 with a lentivirus to obtain an MRC-5 fibroblast simultaneously overexpressing CXCL13, TNFSF13B and VCAM1. Further provided is a modified fibroblast obtained on the basis of the method. Further provided is the use of the modified fibroblast in terms of inducing B-cell chemotaxis, inducing B-cell adhesion and promoting antibody secretion in B cells. The modified fibroblast can be used in the chemotaxis and adhesion of B cells, promotes antibody secretion in B cells, and has good clinical application value.
Need to check novelty before this filing date? Find Prior Art

Description

Method for transforming fibroblasts and application thereof TECHNICAL FIELD

[0001] The present application belongs to the field of biological medicine, and particularly relates to a method for transforming fibroblasts and application thereof. BACKGROUND

[0002] Fibroblasts are a kind of multifunctional cells, which play an important role in the normal physiological process of tissues and organs, especially in immunological diseases and tumor microenvironment. Fibroblasts regulate immune response, growth, invasion and metastasis of tumor cells by secreting immunomodulatory factors and extracellular matrix components. Especially in tumor-associated fibroblasts (CAFs), they play a key role in supporting tumor stroma, regulating tumor immunity and angiogenesis. Studies have shown that tertiary lymphoid structures (TLS) are important areas for the aggregation of immune cells in tumors, which can recognize tumor antigens presented by antigen-presenting cells (APCs), produce effector T cells, memory B cells and plasma cells. These cells promote tumor cell apoptosis through antibody-dependent cellular cytotoxicity (ADCC) and antibody-dependent cellular phagocytosis (ADCP) mechanisms, thereby reducing tumor burden. Effective induction of B cell activation to plasma cells in TLS in tumor tissue is of great significance to enhance anti-tumor immune response.

[0003] Studies have shown that tumor-associated fibroblasts and B cells exist in the tertiary lymphoid structure region, and the two are closely related in spatial distribution. Utilizing or transforming fibroblasts to stimulate B cell activation and enhance its antibody secretion function, and obtaining related antibodies for tumor treatment, will have important significance to promote anti-tumor immune response and improve patient survival rate. This strategy is expected to not only enhance tumor immune response, but also provide new methods and ideas for tumor treatment.

[0004] SUMMARY

[0005] An object of the present application is to provide a method for transforming fibroblasts to solve the above technical problems.

[0006] Another object of the present application is to provide fibroblasts obtained by the method.

[0007] Still another object of the present application is to provide the application of the fibroblasts.

[0008] In order to achieve the object of the present application, the present application provides a method for transforming fibroblasts, which comprises the following steps:

[0009] Step 1: Collecting peripheral blood of healthy people, extracting peripheral blood mononuclear cells (PBMCs) in vitro with lymphocyte separation medium, and purifying B cells by immunomagnetic bead sorting;

[0010] Step 2: Construct human CXCL13, TNFSF13B and VCAM1 overexpression plasmid by molecular cloning technology, and infect MRC-5 with lentivirus to obtain MRC-5 fibroblasts overexpressing CXCL13, TNFSF13B and VCAM1 simultaneously.

[0011] Preferably, the method of the present application further comprises: after obtaining MRC-5 fibroblasts overexpressing CXCL13, TNFSF13B and VCAM1 simultaneously, detecting the overexpression efficiency of VCAM1, CXCL13 and TNFSF13B by real-time quantitative PCR.

[0012] Preferably, the method of the present application further comprises Step 3: inducing B cells by VCAM1 + CXCL13 + TNFSF13B + MRC-5 induces B cell chemotaxis, collects the supernatant of MRC-5 after 48 hours of culture, and co-cultures the supernatant with B cells through a transwell chamber for 2 hours, and then calculates the percentage of B cell migration by cell counting method.

[0013] More preferably, in the step 3, the first condition medium for inducing B cells is RPMI 1640 medium containing 10% fetal bovine serum, 1 μg / ml CpG and 1 μg / ml anti-IgM.

[0014] More preferably, in the step 3, the VCAM1 + CXCL13 + TNFSF13B + MRC-5 or VCAM1 - CXCL13 - TNFSF13B - The cell number of MRC-5 is 1.4 x 10 5 cells / well, and the cell number of B cells is 1 x 10 6 cells / well, and the size of the culture plate is a 24-well plate.

[0015] More preferably, in the step 3, the content of CXCL13 neutralizing antibody is 4 μg / ml, which is added to the supernatant of MRC-5 for incubation 1 hour before co-culturing with B cells.

[0016] More preferably, in the step 3, the percentage of B cell migration is equal to the number of B cells migrated into the lower chamber divided by the total number of B cells.

[0017] Preferably, the method of the present application further comprises Step 4: inducing B cells by VCAM1 + CXCL13 + TNFSF13B+ MRC-5 induces B cell adhesion, after co-culturing MRC-5 with B cells for 30 min, remove the non-adherent B cells, detect the OD value at 450 nm by CCK8 experiment, and calculate the OD value produced by B cells.

[0018] More preferably, in the step 4, the number of MRC-5 cells is 1 x 10 4 cells / well, the number of B cells is 6 x 10 4 cells / well, and the size of the culture plate is a 96-well plate.

[0019] More preferably, in the step 4, the content of VCAM1 neutralizing antibody is 30 μg / ml, which is added to the culture medium of MRC-5 one hour before co-culturing with B cells, so as to neutralize the VCAM1 protein on MRC-5.

[0020] More preferably, in the step 4, the OD value produced by B cells is equal to the OD value of the well in which MRC-5 is co-cultured with B cells minus the OD value of the well in which MRC-5 is cultured alone.

[0021] Preferably, the method of the present application further comprises step 5: detecting the content of VCAM1 + CXCL13 + TNFSF13B + MRC-5 induces B cell antibody secretion, after co-culturing MRC-5 with B cells in the second condition medium with or without TNFSF13B neutralizing antibody for 6 days, collect the cell supernatant, and detect the content of IgG in the supernatant by ELISA experiment.

[0022] More preferably, in the step 5, the content of VCAM1 + CXCL13 + TNFSF13B + MRC-5 or VCAM1 - CXCL13 - TNFSF13B - The number of MRC-5 cells is 3000 cells / well, the number of B cells is 6 x 10 4 cells / well, and the size of the culture plate is a 96-well plate.

[0023] More preferably, in the step 5, the second condition medium is RPMI 1640 medium containing 10% fetal bovine serum and 1 μg / ml CpG.

[0024] More preferably, in the step 5, the content of TNFSF13B neutralizing antibody is 20 μg / ml.

[0025] Preferably, the fibroblast is a tumor-associated fibroblast, but not limited thereto, and the fibroblast can include any one or more of a tissue-specific fibroblast, a disease-specific fibroblast, an inflammation-associated fibroblast, a myofibroblast, or an antigen-presenting associated fibroblast, in addition to the tumor-associated fibroblast.

[0026] In another aspect, the present application also provides the engineered fibroblast obtained according to the method.

[0027] In another aspect, the present application also provides the use of the engineered fibroblast in inducing B cell chemotaxis.

[0028] In another aspect, the present application also provides the use of the engineered fibroblast in inducing B cell adhesion.

[0029] In another aspect, the present application also provides the use of the engineered fibroblast in promoting B cell antibody secretion.

[0030] The method of engineering the fibroblast of the present application induces the engineered fibroblast to be applicable to chemotaxis and adhesion of B cells, and to promote B cell antibody secretion, wherein simultaneous overexpression of VCAM1, CXCL13 and TNFSF13B in the fibroblast is involved, and the engineered fibroblast is obtained by the method of the present application. + CXCL13 + TNFSF13B + fibroblast. VCAM1 + CXCL13 + TNFSF13B + fibroblast is co-cultured with B cells, and the use of the engineered fibroblast in chemotaxis and adhesion of B cells and in promoting B cell antibody secretion. By the system, promotion of B cell chemotaxis and adhesion to the fibroblast, and then promotion of B cell antibody secretion by the fibroblast can be achieved, which has good clinical application value. BRIEF DESCRIPTION OF DRAWINGS

[0031] FIG. 1 shows the normalized average expression of cluster markers, complement, adhesion molecules and chemokines (rows) for each CAF cluster (columns). The fill color from blue to red indicates the proportional expression level from low to high.

[0032] FIG. 2 shows the expression of CXCL13 in VCAM1 - CXCL13 - TNFSF13B - MRC-5 cells (control group) and VCAM1 + CXCL13 + TNFSF13B +Relative mRNA levels in MRC-5 cells (overexpression group) (left panel; n=3). Bar graphs show the migration ability of B cells with MRC-5 under different co-culture conditions (right panel; n=8). B cells with VCAM1 - CXCL13 - TNFSF13B - MRC-5, VCAM1 + CXCL13 + TNFSF13B + MRC-5 or VCAM1 + CXCL13 + TNFSF13B + Fibroblast co-culture of MRC-5 combined with CXCL13-specific neutralizing antibody.

[0033] Figure 3 shows the schematic diagram of B cell adhesion experiment (left panel). The middle bar graph shows the VCAM1 expression in VCAM1 - CXCL13-TNFSF13B-MRC-5 cells (control group) and VCAM1 + CXCL13 + TNFSF13B + Relative mRNA levels in MRC-5 cells (overexpression group) (middle panel; n=3). The right bar graph shows the adhesion ability of B cells to MRC-5 (right panel; n=3). B cells with VCAM1 - CXCL13 - TNFSF13B - MRC-5, VCAM1 + CXCL13 + TNFSF13B + MRC-5 or VCAM1 + CXCL13 + TNFSF13B + MRC-5 combined with VCAM1 neutralizing antibody co-culture. CCK8 method was used to quantitatively determine the relative number of B cells combined with MRC-5 (OD value).

[0034] Figure 4 shows the schematic diagram of B cell co-culture experiment (left panel). The middle bar graph shows the TNFSF13B expression in VCAM1 - CXCL13 - TNFSF13B - MRC-5 cells (control group) and VCAM1 + CXCL13 + TNFSF13B + Relative mRNA levels in MRC-5 cells (overexpression group) (middle panel; n=3). The right bar graph shows the adhesion ability of B cells to MRC-5 (right panel; n=3). B cells with VCAM1- CXCL13 - TNFSF13B - MRC-5, VCAM1 + CXCL13 + TNFSF13B + MRC-5 or VCAM1 + CXCL13 + TNFSF13B + IgG produced by co-culture of MRC-5 with TNFSF13B specific neutralizing antibodies (right panel; n=3). Supernatant IgG levels were detected by ELISA. DETAILED DESCRIPTION

[0035] In order to more clearly understand the above-mentioned purposes, features and advantages of the present application, the following further describes the present application in conjunction with the drawings and specific embodiments. It should be apparent to those skilled in the art that the embodiments are only to assist in understanding the present application and should not be considered as specific limitations of the present application; the sequencing and analysis methods used in the following embodiments are conventional methods unless otherwise specified.

[0036] In order to make the technical means, creative features, purposes and effects of the present application easy to understand, the present application is further described in conjunction with specific embodiments.

[0037] Example 1

[0038] Differential gene expression analysis

[0039] The inventors conducted research by using single-cell mRNA sequencing technology, grouped CAFs according to the expression characteristics of tumor-associated fibroblasts (CAFs), and found that nasopharyngeal carcinoma contains five cell subpopulations. Further, through systematic bioinformatics calculation, the inventors mined the specific highly expressed genes of each subpopulation and found that in the five cell subpopulations, subpopulation 3—CXCL13 fibroblasts expressed higher subpopulation markers (PTGDS, TNFSF13B, CYP1B1 and PDPN), complement component-related genes (C2 and C3), cell adhesion molecules (VCAM1 and ICAM1) and chemotactic factors (CXCL13, CCL19, CCL21, etc.), indicating that they have the effects of promoting B cell antibody secretion, chemotaxis and adhesion. FIG. 1 shows the normalized average expression of cluster markers, complement, adhesion molecules and chemotactic factors (rows) of each CAF cluster (columns). The fill color from blue to red represents the proportion of expression level from low to high.

[0040] Example 2

[0041] The specific steps for obtaining peripheral blood mononuclear cells (PBMCs) are as follows:

[0042] (1) Add appropriate amount of PBS, mix well the anticoagulated blood;

[0043] (2) Add the same volume of lymphocyte separation medium as the blood sample in a 15ml centrifuge tube, carefully add the anticoagulated blood to the upper layer, centrifuge at 750g for 20min, and the speed is 1;

[0044] (3) Take another clean 15ml centrifuge tube, add 5ml PBS;

[0045] (4) Carefully pipette the middle white cell layer into the centrifuge tube of (3), and add PBS to 10ml, centrifuge at 550g at 4°C for 5min, and the speed is 5;

[0046] (5) Discard the supernatant, add 2ml lysing solution, lyse at room temperature for 10min, then add appropriate volume of PBS, centrifuge at 550g at 4°C for 5min;

[0047] (6) Discard the supernatant, resuspend the cell pellet, and blow it apart, and PBMC can be obtained.

[0048] The specific steps of immunomagnetic bead sorting and purifying B cells are as follows:

[0049] (1) Filter the resuspended PBMC cells with a 70μm cell filter, centrifuge at 300xg for 5min, resuspend the cells, count and adjust the cell concentration to 1x10 7 cells / 100ul, and add the cell suspension to a flow tube;

[0050] (2) Add 10ul Antibody Cocktail to the 1x10 7 cell suspension, mix well, and incubate on ice for 15min;

[0051] (3) After mixing the magnetic beads, add 10ul Streptavidin Nanobeads to the 1x10 7 cell suspension, mix well, and incubate on ice for 15min;

[0052] (4) Add 2.5mL buffer, gently blow it up, and place it in a magnetic stand for 5min;

[0053] (5) Pour out and collect the liquid in a new centrifuge tube, and add 2.5mL buffer to the flow tube again, gently blow it up, and place it in a magnetic stand for 5min, and collect the cells obtained by secondary collection.

[0054] Example 3

[0055] The specific steps of constructing human overexpression VCAM1, CXCL13 and TNFSF13B MRC-5 cells are as follows:

[0056] (1) Design primers, the primer sequences are as follows:

[0057] CXCL13-F: CTAGCTAGCATGAAGTTCATCTCGACATCTCTGCTT,

[0058] CXCL13-R: CGCGGATCCTCAGGGAATCTTTCTCTTAAACACTGGAACT;

[0059] VCAM1-F: CTAGCTAGCATGCCTGGGAAGATGGTCGTGAT,

[0060] VCAM1-R: ATTTGCGGCCGCCTACACTTTTGACTTCTGTGCTTCTAC;

[0061] TNFSF13B-F: CTAGCTAGCATGGATGACTCCACAGAAAGGG,

[0062] TNFSF13B-R: CGCGGATCCTCACAGCAGTTTCAATGCACC;

[0063] PCR amplification extracts human VCAM1, CXCL13 and TNFSF13B gene fragments from human cDNA library;

[0064] (2) Select pcDNA3.1 lentivirus vector, according to the sequence of VCAM1 gene, select NheI and NotI sites for double enzyme digestion; select pCDH-puro lentivirus vector, according to the sequence of CXCL13 gene, select NheI and BamHI sites for double enzyme digestion; select pCDH-Hygro lentivirus vector, according to the sequence of TNFSF13B gene, select NheI and BamHI sites for double enzyme digestion;

[0065] (3) Use T4 DNA ligase to respectively connect the enzyme-digested pcDNA3.1 vector and VCAM1, pCDH-puro vector and CXCL13, pCDH-Hygro vector and TNFSF13B;

[0066] (4) Transform the plasmid and perform plasmid sequence sequencing;

[0067] (5) Through 293T cells to package lentivirus to produce lentivirus;

[0068] (6) Lentivirus infection of MRC-5, overexpression of VCAM1 selected by G418 for positive cell screening, overexpression of CXCL13 selected by puromycin for positive cell screening, overexpression of TNFSF13B selected by hygromycin for positive cell screening.

[0069] Example 4

[0070] VCAM1 + CXCL13 + TNFSF13B + The specific steps of MRC-5 inducing B cell chemotaxis are as follows:

[0071] (1) The B cells obtained in Example 2 were washed once with RPMI 1640 medium containing 10% fetal bovine serum, and cultured with a conditioned medium of RPMI 1640 containing 10% fetal bovine serum, CpG (1 μg / ml), and anti-IgM (1 μg / ml) to activate the B cells, and a B cell chemotaxis experiment was performed 48 hours later;

[0072] (2) The MRC-5 cells obtained in Example 3 were resuspended in RPMI 1640 medium containing 10% fetal bovine serum at a density of 2×10 5 cells / ml;

[0073] (3) 700 μl of the MRC-5 cell suspension was added to a 24-well plate, and after 24 hours of culture, the cell supernatant was collected and centrifuged, and 600 μl of the supernatant was added to the lower chamber of a transwell chamber;

[0074] (4) One hour before the chemotaxis experiment, neutralizing antibodies containing or not containing 4 μg / ml of anti-human CXCL13 were added to the medium in the lower chamber;

[0075] (5) The activated B cells described above for 48 hours were collected, resuspended in RPMI 1640 medium containing 10% fetal bovine serum at a density of 1×10 7 cells / ml, and 100 μl of the cell suspension was added to the upper chamber of a transwell chamber;

[0076] (6) After 2 hours of culture at 37°C in a cell culture incubator containing 5% CO2, the B cells that migrated to the lower chamber of the transwell chamber were counted, and the total number of B cells was divided to calculate the percentage of B cell migration.

[0077] Figure 2 shows that CXCL13 in VCAM1 - CXCL13 - TNFSF13B - MRC-5 cells (control group) and VCAM1 + CXCL13+ TNFSF13B + Relative mRNA levels in MRC-5 cells (overexpression group) (left panel; n=3). Histograms showing the migration ability of B cells with MRC-5 under different co-culture conditions (right panel; n=8). B cells with VCAM1 - CXCL13 - TNFSF13B - MRC-5, VCAM1 + CXCL13 + TNFSF13B + MRC-5 or VCAM1 + CXCL13 + TNFSF13B + Fibroblast co-culture of MRC-5 combined with CXCL13 specific neutralizing antibody.

[0078] As shown in Figure 2, VCAM1 + CXCL13 + TNFSF13B + MRC-5 (overexpression group) significantly enhanced the ability of B cells to migrate towards MRC-5, while the use of CXCL13 neutralizing antibody weakened the effect of VCAM1 + CXCL13 + TNFSF13B + The enhancement of B cell migration ability by MRC-5 indicates that VCAM1 + CXCL13 + TNFSF13B + MRC-5 has the effect of promoting B cells to migrate towards fibroblasts MRC-5.

[0079] Example 5

[0080] VCAM1 + CXCL13 + TNFSF13B + The technique of MRC-5 inducing B cell adhesion is as follows:

[0081] (1) One day in advance, MRC-5 cells obtained in Example 3 were respectively plated in 96-well plates at 1 x 10 4 cells / well, and the medium containing or not containing 30 μg / ml neutralizing antibody against VCAM1 was replaced 1 hour before the adhesion experiment;

[0082] (2) B cells obtained in Example 2 were resuspended in RPMI 1640 medium containing 10% fetal bovine serum at a density of 6 x 10 4 cells / 100 μl;

[0083] (3) Aspirate the MRC-5 cell culture medium, add 100 μl of B cell suspension, and incubate for half an hour in a 37°C, 5% CO2 incubator.

[0084] (4) Take out the cells, pat the cell culture plate twice, then aspirate the culture medium and unadherent B cells, add 100 μl of diluted CCK8 solution to each well, and incubate for 2 hours in a 37°C, 5% CO2 incubator. Then, detect the OD value at 450 nm. In order to eliminate the difference in OD value caused by the difference in the number of MRC-5 cells, the OD value produced by B cells is equal to the OD value of co-culture of MRC-5 and B cells minus the OD value of MRC-5 cultured alone.

[0085] Figure 3 is a schematic diagram of the B cell adhesion experiment (left). The middle column chart is the VCAM1 expression level in VCAM1 - CXCL13 - TNFSF13B - MRC-5 cells (control group) and VCAM1 + CXCL13 + TNFSF13B + MRC-5 cells (overexpression group) (middle chart; n = 3), and the right column chart shows the adhesion ability of B cells to MRC-5 (right chart; n = 3). B cells were respectively co-cultured with VCAM1 - CXCL13 - TNFSF13B - MRC-5, VCAM1 + CXCL13 + TNFSF13B + MRC-5 or VCAM1 + CXCL13 + TNFSF13B + MRC-5 combined with VCAM1 neutralizing antibody co-culture. The relative number of B cells combined with MRC-5 (OD value) was quantitatively determined by CCK8 method.

[0086] As shown in Figure 3, compared with the control group, VCAM1 + CXCL13 + TNFSF13B + MRC-5 (overexpression group) can bind more B cells, and after using the neutralizing antibody of VCAM1 + CXCL13 + TNFSF13B + MRC-5 combined with B cells, indicating that VCAM1 + CXCL13 + TNFSF13B +MRC-5 can enhance the ability of B cells to adhere to fibroblast MRC-5.

[0087] Example 6

[0088] VCAM1 + CXCL13 + TNFSF13B + The specific steps of MRC-5 stimulating B cells to secrete IgG are as follows:

[0089] (1) One day in advance, MRC-5 obtained in Example 3 was plated in a 96-well plate at a density of 3000 cells / well, and the adhesion was completed.

[0090] (2) The B cells obtained in Example 2 were washed once with RPMI 1640 medium containing 10% fetal bovine serum; the B cells were resuspended in RPMI 1640 conditioned medium containing 10% fetal bovine serum, CpG (1 μg / ml) at a density of 3×10 5 4 cells / ml; in order to neutralize TNFSF13B, 20 μg / ml of anti-human TNFSF13B neutralizing antibody was added to the medium, and 200 μl of B cell suspension was added to the above fibroblast MRC-5 for co-culture;

[0091] (3) On the 3rd day of co-culture, 100 μl of cell supernatant was carefully collected without touching the cells, and 100 μl of RPMI 1640 conditioned medium containing 10% fetal bovine serum, CpG (1 μg / ml) was added for culture, and 20 μg / ml of anti-human TNFSF13B neutralizing antibody was still added in the neutralization group;

[0092] (4) On the 6th day, the cell supernatant was collected, centrifuged at 500g at room temperature for 10 min, and the speed was reduced to 4.

[0093] (5) The supernatant was taken and IgG was detected by ELISA.

[0094] Figure 4 shows a schematic diagram of the B cell co-culture experiment (left). The middle column chart is the relative mRNA level of TNFSF13B in VCAM1 - CXCL13 - TNFSF13B - MRC-5 cells (control group) and VCAM1 + CXCL13 + TNFSF13B + MRC-5 cells (overexpression group) (middle graph; n=3). The right column chart shows the relative mRNA level of B cells co-cultured with VCAM1 - CXCL13 - TNFSF13B -MRC-5, VCAM1 + CXCL13 + TNFSF13B + MRC-5 or VCAM1 + CXCL13 + TNFSF13B + IgG produced by co-culture of MRC-5 and TNFSF13B specific neutralizing antibody (right panel; n = 3). IgG levels in supernatant were detected by ELISA.

[0095] As shown in Figure 4, compared with the control group, VCAM1 + CXCL13 + TNFSF13B + MRC-5 (overexpression group) significantly promoted B cells to secrete IgG antibodies, while the use of TNFSF13B neutralizing antibody weakened VCAM1 + CXCL13 + TNFSF13B + The promotion of B cell IgG secretion by MRC-5 indicates that VCAM1 + CXCL13 + TNFSF13B + MRC-5 has the ability to promote B cells to secrete antibodies.

[0096] In summary, by overexpressing VCAM1, CXCL13 and TNFSF13B in fibroblasts, the ability of fibroblasts to chemotaxis, adhesion and antibody secretion of B cells can be significantly enhanced, thereby achieving the effect of anti-tumor, and ultimately improving the prognosis of patients.

[0097] The above describes the present application in detail in combination with examples, but the present application is not limited to the above examples, and various changes can be made within the knowledge of those skilled in the art without departing from the purpose of the present application. In addition, the embodiments of the present application and the features in the embodiments can be combined with each other without conflict.

Claims

1. A method of reprogramming a fibroblast cell, comprising The method comprises the following steps: Step 1: collecting peripheral blood of a healthy person, extracting peripheral blood mononuclear cells from the peripheral blood by using a lymphocyte separation medium, and purifying B cells by using immunomagnetic beads; Step 2: constructing human CXCL13, TNFSF13B and VCAM1 overexpression plasmids by using a molecular cloning technique, and infecting MRC-5 by using a lentivirus to obtain MRC-5 fibroblasts overexpressing CXCL13, TNFSF13B and VCAM1 simultaneously.

2. The method of claim 1, wherein, The method further comprises the following step: after obtaining the MRC-5 fibroblasts overexpressing CXCL13, TNFSF13B and VCAM1 simultaneously, detecting overexpression efficiency of VCAM1, CXCL13 and TNFSF13B by using real-time quantitative PCR.

3. The method of claim 1, wherein, The method further comprises step 3: inducing B cells to migrate by VCAM1 + CXCL13 + TNFSF13B + MRC-5 induced B cell chemotaxis, the supernatant of MRC-5 after 48 hours of culture was collected, and the supernatant was co-cultured with B cells through a transwell chamber for 2 hours, and then the percentage of B cell migration was calculated by cell counting.

4. The method of claim 1, wherein, The method further comprises step 4: inducing B cell adhesion by VCAM1 + CXCL13 + TNFSF13B + MRC-5 induces B cell adhesion, after co-culturing MRC-5 with B cells for 30 min, remove the non-adherent B cells, detect the OD value at 450 nm by CCK8 experiment, and calculate the OD value produced by B cells.

5. The method of claim 1, wherein, The method further comprises step 5: detecting the content of IgG in the supernatant by ELISA experiment through VCAM1 + CXCL13 + TNFSF13B + MRC-5 induces B cell antibody secretion, after co-culturing MRC-5 and B cells in the second condition medium containing or not containing TNFSF13B neutralizing antibody for 6 days, collecting the cell supernatant, and detecting the content of IgG in the supernatant by ELISA experiment.

6. The engineered fibroblast cell obtained by the method according to any one of claims 1 to 5.

7. The use of the engineered fibroblast cell according to claim 6 in inducing B cell chemotaxis.

8. The use of the engineered fibroblast cell according to claim 6 in inducing B cell adhesion.

9. The use of the engineered fibroblast cell according to claim 6 in promoting B cell antibody secretion.

Citation Information

Patent Citations

  • Method for producing fibroblast, and g-CSF-positive fibroblast mass

    CN112639082A

  • Lymphovessel neogenesis promoting factor-expressing fibroblast and pharmaceutical composition containing same

    CN117120063A

  • Treatment of autoimmunity and transplant rejection through establishment and / or promotion of tolerogenic processes by fibroblast-mediated reprogramming of antigen presenting cells

    WO2021076525A1

  • Fibroblast-containing pharmaceutical composition for treating kidney disease

    WO2023037868A1