Method for constructing mouse model with Cep295 gene knocked out in cerebral cortex area, targeting vector and kit
By constructing a mouse model with Cep295 gene knockout specifically in the cerebral cortex, the problem of unclear function of Cep295 gene in existing technologies has been solved, and a conditional knockout mouse model has been provided for studying therapeutic targets and drug screening for brain and neurodevelopmental diseases.
Patent Information
- Application Number
- CN202511038365.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-28
- Publication Date
- 2025-10-28
AI Technical Summary
There are currently no animal models of Cep295 gene mutation or knockout, which makes its role in brain and neural development unclear, and there is a lack of effective therapeutic targets and treatment methods.
A mouse model with Cep295 gene knockout specifically in the cerebral cortex was constructed. By designing a specific targeting vector and using liposome transfection technology to achieve gene knockout in mouse embryonic stem cells, combined with resistance drug screening and genotype identification, a conditional knockout mouse model was obtained.
It avoids embryonic lethality caused by systemic Cep295 knockout, provides a gene knockout model in a specific brain region, reduces interference from other tissues, has higher research persuasiveness, and provides a potential means for screening and treating brain and neurodevelopmental diseases.
Smart Images
Figure CN120843597A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, and in particular relates to a method for constructing a mouse model by knocking out the Cep295 gene in the cerebral cortex, as well as a targeting vector and reagent kit. Background Technology
[0002] CEP295 Gene, also known as KIAA1731 Located on human chromosome 11q21, CEP295 contains 31 exons and a coding region of 7806 bp, encoding centrosomal protein 295, which is composed of 2601 amino acids. CEP295 belongs to the centrosomal protein family and is predominantly expressed in brain tissue. Previous studies have found that CEP295 is an important factor in centriole assembly and stability, and mediates the conversion of centrioles to centrosomes. The applicant team previously discovered… CEP295 Biallelic mutations can cause centrosome developmental defects and G1 phase cell cycle arrest triggered by excessive activation of p53 / p21 signaling, leading to syndromic microcephaly. The findings were published in EBioMedicine (EBioMedicine.2024:99:104940. doi: 10.1016 / j.ebiom.2023.104940.). However, CEP295 The role of genes in brain and neural development is not yet fully understood, and the neuropathological features and pathological developmental mechanisms of microcephaly caused by gene mutations are still unclear. In addition, existing clinical research is mainly focused on genotype-phenotype associations, and the identification of therapeutic targets and the development of potential treatments remain stagnant.
[0003] To date, none have been found Cep295 Literature reports on mutation or knockout animal models. Summary of the Invention
[0004] The purpose of this invention is to address the shortcomings of existing technologies by providing a method for constructing a knockout mechanism in the cerebral cortex. Cep295 Mouse model methods for genes, as well as targeting vectors and kits.
[0005] To achieve the above objectives, this invention proposes a method for constructing a knockout mechanism for cerebral cortex regions. Cep295 A targeting vector for a mouse model of a gene, wherein the structure of the targeting vector comprises, from the 5' end to the 3' end, the following: 5' homologous arm, the 5' homologous arm being derived from mouse Cep295 The genome sequence upstream of exon 11 of the gene; The flox region contains mouse Cep295 Exons 11 through 15 of the gene; Frt-pGK-Neo-polyA-Frt element, where Frt-pGK-Neo-polyA is a selection marker gene expression cassette; 3' homologous arm, the 3' homologous arm being derived from mouse Cep295 The genomic sequence downstream of exon 15 of the gene; And the MC1-TK-polyA element, where MC1-TK-polyA is a negative selection marker gene expression cassette.
[0006] Preferably, the primer pairs involved in the targeting vector include one or more of the following: CEP295-F1 / CEP295-R1, CEP295-F2 / CEP295-R2, CEP295-F3 / CEP295-R3, and CEP295-F4 / CEP295-R4.
[0007] Preferably, the primer pair CEP295-F1 / CEP295-R1 sequences include SEQ ID NO.1 and SEQ ID NO.2, respectively, wherein the SEQ ID NO.1 sequence is as follows: CGCGGTCGACAAGCTTATAAGACACTGACTCTGCGCTT; The sequence of SEQ ID NO.2 is as follows: AAGGATGTACCAAGGTAGAGTGTTGATAACTTCGTATAATGTATGCTATACGAAGTTATCATGGCATGTAGACAACAAGGAA; The primer pair CEP295-F2 / CEP295-R2 includes SEQ ID NO.3 and SEQ ID NO.4, respectively, wherein the sequence of SEQ ID NO.3 is as follows: CCTTGGTACATCCTTATAGATGGTTGAATGAGTGTCTG; The sequence of SEQ ID NO.4 is as follows: CGACTCTAGAGGATCGGCGCGCCGAGCAAAGTGTGTAGTCTGCTTTAGCCATTATGTCACTTAGGGAAAAA; The primer pair CEP295-F3 / CEP295-R3 includes SEQ ID NO.5 and SEQ ID NO.6, respectively, wherein the sequence of SEQ ID NO.5 is as follows: CTACACACTTTGCTCGGCGCGCCCAGTCAGGTACATAATGAATTCCGAAGTTCCTATT; The sequence of SEQ ID NO.6 is as follows: GTCTCGGAAGCCCAGGCGGATCC; The primer pair CEP295-F4 / CEP295-R4 includes SEQ ID NO.7 and SEQ ID NO.8, respectively, wherein the sequence of SEQ ID NO.7 is as follows: CTGGGCTTCCGAGACATAACTTCGTATAGCATACATTATACGAAGTTATTATAGTTGGTATGGTTATAATCT; The sequence of SEQ ID NO.8 is as follows: CGACTCTAGAGGATCGATTAGTGTTTTCAACTTAATTA.
[0008] Secondly, this invention proposes a method for constructing region-specific knockouts in the cerebral cortex. Cep295 The method for creating a mouse model of a gene includes the following steps: Step S1: Construct the above-mentioned target carrier to obtain a linearized target carrier; Step S2: The linearized targeting vector is transfected into mouse embryonic stem cells via liposomes, screened using resistance drugs, and identified as positive homologous recombinant ES cell clones by long-fragment PCR and sequencing. Step S3: The positive homologous recombinant ES cell clone was injected into the blastocyst of C57BL / 6 mice, and the injected blastocyst was transferred to the uterus of a pseudopregnant mouse to obtain chimeric male mice. Step S4: Mating the chimeric male mouse with Flp transgenic mice to obtain F1 generation heterozygous mice; Step S5: Self-cross the F1 generation heterozygous mice to obtain F2 generation homozygous mice, and cross the F1 generation heterozygous mice with Emx1-Cre transgenic mice to obtain F2 generation heterozygous knockout mice; Step S6: Cross the F2 generation homozygous mice with the F2 generation heterozygous knockout mice to obtain the F3 generation conditional knockout mice. Cep295 homozygous mice, i.e., mice with specific knockouts of cerebral cortex regions Cep295 Mouse models of genes.
[0009] Preferably, in step S2, the resistance drug screening is a dual screening of neomycin and ganciclovir.
[0010] Preferably, after step S6, the method further includes the following step: Genotyping of the F3 generation mice was performed using PCR, with primers including a forward primer and a reverse primer. The forward primer included the sequence shown in SEQ ID NO. 13, which is shown below: CCAACCTCCTTGAAGCCTCT; The reverse primer comprises the sequence shown in SEQ ID NO.14, which is shown below: GCCACACACATTAATCATTCAACC.
[0011] Thirdly, the present invention also proposes a target carrier based on the above-mentioned method. Cep295 Applications in mutant or knockout animal models; Preferably, the Cep295 The mutation or knockout animal model is the mouse model.
[0012] Furthermore, the aforementioned Cep295 Mutant or knockout animal models do not express or suppress expression Cep295 Genes and their encoded proteins.
[0013] Fourthly, the present invention also proposes the application of the above-mentioned targeting vector or mouse model obtained according to the above method in screening drugs for the treatment or prevention of brain and neurodevelopment-related diseases. Preferably, the brain and neurodevelopment-related disease is syndromic microcephaly.
[0014] Fifthly, this invention proposes a method for constructing a knockout region of the cerebral cortex. Cep295 A kit for a mouse model of a gene, comprising the aforementioned targeting vector.
[0015] Preferably, the kit further includes a primer pair for genotype identification, the primer pair including a forward primer and a reverse primer, wherein the forward primer includes the sequence shown in SEQ ID NO.13: CCAACCTCCTTGAAGCCTCT; The reverse primer includes the sequence shown in SEQ ID NO.14: GCCACCACATTAATCATTCAACC.
[0016] Preferably, the kit further includes liposome transfection reagent, neomycin, ganciclovir, and ES cell culture-related reagents.
[0017] In the technical solution described in this invention, in order to further explore the pathological mechanism of microcephaly caused by functional loss, the applicant first used a systemic knockout strategy to construct an animal model. The results showed that in mice, knockout... Cep295This resulted in embryo lethality, and the embryos were subsequently knocked down in zebrafish using a morpholino (MO) strategy. Cep295 It was found that although this method could reproduce the microcephaly phenotype, Cep295 Knockout resulted in half of the embryos dying at 6 HPF, and almost all embryos dying at 24 HPF. These results suggest that systemic knockout or knockdown in mice and zebrafish... Cep295 The current technical approach is insufficient to meet the needs of subsequent scientific research, and there is an urgent need to develop target organ-specific knockout animal models.
[0018] Compared with the prior art, the technical solution of the present invention has the following advantages and beneficial effects: On the one hand, it avoids systemic Cep295 Knockout results in embryonic death, while the present invention's technical solution can obtain surviving mice; on the other hand, the present invention's technical solution only knocks out specific brain regions. Cep295 Their research results are more convincing because they are not influenced by other organizations. Attached Figure Description
[0019] Figure 1 Shows Cep295 Lethality results of knockout mouse embryos, where A shows... Cep295 The strategy for constructing knockout mice utilizes CRISPR-Cas9 technology to knock out mice from the genome. Cep295 The 9172 bp region from intron 1 to intron 6 of the gene was knocked out; B represents genotypic analysis showing that the knockout mouse (Cep295) - / - The embryo died before 15.5 days (E15.5). Cep295 After mating, heterozygous (Het) mice did not produce homozygous (Hom) mice after birth (P0). At E12.5, the proportion of homozygous embryos was significantly reduced, and at E15.5, all homozygous embryos died. The lung tissue morphology showed pathological changes, with a decrease in the number of alveoli and secondary protrusions compared to the control group, and an increase in the average lining septum.
[0020] Figure 2 The study shows the developmental assessment of zebrafish after ep295 knockdown. A shows the expression level of Cep295 at different time points (0.2, 1, 2, 3.7, 6, 24, 30, 48, 72, 96, 120, and 144 hpf) in zebrafish embryos analyzed by qRT-PCR; B shows the presence of Cep295 in E7I7-MO injected embryos (26 hpf) confirmed by RT-PCR. Cep295 Intron insertion in exon 7 and partial deletion in exon 7; C is the qRT-PCR assessment of the knockdown efficiency of E7I7-MO on the cep295 gene; D is the survival curves of control, cep295 MO zebrafish and normal development; E is the statistical data of control, cep295 MO zebrafish and normal development.
[0021] Figure 3 The strategy for constructing the target vector for Cep295 gene knockout mice was demonstrated.
[0022] Figure 4 A schematic diagram of primer design for homologous recombination identification in F1 generation mice.
[0023] Figure 5 The results showed that homologous recombination was identified in F1 mice, with a 3.5 kb fragment product (5' and 3' ends identical) amplified in F1 mice with homologous recombination and an 11.9 kb fragment product amplified in F1 mice without homologous recombination.
[0024] Figure 6 This is a breeding protocol for mice.
[0025] Figure 7 for Cep295 Schematic diagram of primer design for genotype identification of gene knockout mice.
[0026] Figure 8 Genotyping results for Cep295 gene knockout mice.
[0027] Figure 9 for Cep295 Conditional gene knockout ( Cep295 -cKO mice showed cortical thinning. Among them, A is a photo of the appearance of wild-type (Ctrl) and Cep295-cKO mice; B is the result of Nissl staining; C is a photo of the appearance of the mouse skull and the statistical results of cortical brain thickness.
[0028] Figure 10 for Cep295 Knockout mice showed thinning of the cerebral cortex, primarily affecting the superficial cortex (7-day-old mice). In this study, A represents the superficial cortical neuronal marker Cux1, and B represents the statistical results.
[0029] Figure 11 for Cep295 Knockout mouse cortical cells exhibit centrosome developmental defects (E14.5 embryonic mice). In the figures, A shows the immunofluorescence image of the centrosome marker γ-Tubulin, B shows the statistical results, C shows the image of pH3-labeled M-phase cells, and D shows the statistical results.
[0030] Figure 12The Cep295 knockout mice showed an increase in the number of ectopic mitotic cells in the cortex and an increase in apoptosis (E14.5 embryonic mice). In the diagram, A is a display of radial glial cells in the ventricular zone (VZ) and subventricular zone (SVZ), B is the statistical result, pH3 is the M phase marker, and Sox2 is the radial glial cell marker; C is an immunofluorescence display of apoptotic cells (Tunnel marker), and D is the statistical result.
[0031] Figure 13 The Cep295 knockout mice showed an increase in the number of ectopic mitotic cells in the cortex, along with increased apoptosis (E16.5 embryonic mice). In the images, A shows the immunofluorescence of intermediate precursor neurons (TBR2) and radial glial cells (Sox2), B shows the statistical results, C shows the immunofluorescence of superficial cortical neurons (Cux1) and deep cortical neurons (Ctip2), and D shows the statistical results. Detailed Implementation
[0032] The present invention will now be described in detail with reference to specific embodiments. These embodiments will help those skilled in the art to further understand the present invention, but do not limit the invention in any way. It should be noted that those skilled in the art can make several adjustments and improvements without departing from the concept of the present invention. These all fall within the scope of protection of the present invention.
[0033] Example 1: Strategy for constructing conditional knockout mice Cep295 Genes are large, contain many exons, and involve many transcripts; apart from the longest transcript, it is currently unclear whether the other transcripts have equivalent functions; therefore, it is necessary to design a knockout method that can cover as many transcripts as possible.
[0034] In this embodiment, a traditional embryonic stem cell (ES cell) gene targeting method is used to target... Cep295 A large segment of the gene's middle region, exons 11 to 15, was knocked out. Simultaneously, to overcome the lethality of systemic knockout in embryos, this embodiment considers constructing a region-specific knockout mechanism for the cerebral cortex. Cep295 The specific steps for creating a gene-based mouse model are as follows: (1) Obtain from the Ensembl database Cep295The genome sequence (sequence name: ENSMUSG00000046111, see http: / / asia.ensembl.org / Mus_musculus / Gene / Summary?db=core;g=ENSMUSG00000046111;r=9:15228216-15269084;t=ENSMUST00000161132) was used to design targeting vectors. In this embodiment, the target is mice. Cep295 Constructing a targeting vector from exons 11 to 15 of the gene Cep295 -pGK-Neo-polyA, its structure is shown in [link to documentation]. Figure 3 (i.e., the Targeting vector in the figure), which includes: 5' homologous arm (3.0 kb), flux region, Frt-pGK-Neo-polyA-Frt, 3' homologous arm (2.8 kb) and MC1-TK-polyA.
[0035] The relevant primers are as follows: CEP295 -F1: CGCGGTCGACAAGCTTATAAGACACTGACTCTGCGCTT (as shown in SEQ ID NO.1) CEP295-R1: AAGGATGTACCAAGGTAGAGTGTTGATAACTTCGTATAATGTATGCTATACGAAGTTATCATGGCATGTAGACAACAAGGAA (shown in SEQ ID NO.2) CEP295 -F2: CCTTGGTACATCCTTATAGATGGTTGAATGAGTGTCTG (as shown in SEQ ID NO.3) CEP295-R2: CGACTCTAGAGGATCGGCGCGCCGAGCAAAGTGTGTAGTCTGCTTTAGCCATTATGTCACTTAGGGAAAAA (as shown in SEQ ID NO.4) CEP295–F3: CTACACACTTTGCTCGGCGCGCCCAGTCAGGTACATAATGAATTCCGAAGTTCCTATT (as shown in SEQ ID NO.5) CEP295 -R3: GTCTCGGAAGCCCAGGCGGATCC (as shown in SEQ ID NO.6) CEP295–F4: CTGGGCTTCCGAGACATAACTTCGTATAGCATACATTATACGAAGTTATTATAGTTGGTATGGTTATAATCT (as shown in SEQ ID NO.7) CEP295–R4: CGACTCTAGAGGATCGATTAGTGTTTTCAACTTAATTA (shown in SEQ ID NO.8) (2) Using liposome transfection reagent, the linearized targeting vector was transfected into ES cells; positive homologous recombinant ES cell clones were obtained by dual screening with neomycin and ganciclovir, and confirmed by long fragment PCR and sequencing. (3) Positive ES cell clones were injected into wild-type C57BL / 6 mouse blastocysts, and the injected blastocysts were implanted into the uterus of pseudopregnant female mice to obtain chimeric male mice. (4) Chimeric mice were mated with Flp transgenic mice (purchased from Shanghai Southern Model Biotechnology Co., Ltd.) to obtain 4 F1 generation heterozygous mice; specific primers (design strategy see [link to design strategy]) were used. Figure 4 Long-fragment PCR was performed to identify whether homologous recombination occurred in specific genomic regions (see results). Figure 5 ).
[0036] Table 1 shows the primer sequences used to confirm whether recombination has occurred at the 5' end.
[0037] Table 1. Table 2 shows the primer sequences used to confirm whether recombination has occurred at the 3' end.
[0038] Table 2. Table 3 shows the PCR system (purchased from TOYOBO, Toyobo (Shanghai) Biotechnology Co., Ltd.).
[0039] Table 3. Table 4 shows the PCR conditions.
[0040] Table 4. Example 2: Mouse breeding protocol and the acquisition of homozygous knockout mice: The obtained F1 generation heterozygous mice (Cep295) Flox / － Homozygous F2 mice (Cep295) were selected through self-crossing. Flox / Flox Simultaneously, hybridization with Emx1-Cre mice resulted in the selection of F2 generation heterozygous knockout mice (Cep295). Flox / －-Cre＋ / － F2 generation homozygous mice were mated with F2 generation heterozygous knockout mice to screen for F3 generation conditionally knocked-out Cep295 homozygous mice. Cep295 Flox / Flox -Cre ＋ / － The entire solution process can be found here. Figure 6 .
[0041] Example 3: Mouse Genotyping Genome DNA was extracted from mouse tail using a kit, and mouse genotypes were identified by PCR. See the primer design diagram below. Figure 7 .
[0042] Primer sequences: Forward see sequence SEQ ID NO.13: CCAACCTCCTTGAAGCCTCT; Reverse see sequence SEQ ID NO.14: GCCACCACACATTAATCATTCAACC.
[0043] Table 5 shows the PCR system and PCR reaction conditions: Table 5. See final results Figure 8 .
[0044] Depend on Figure 8 As shown in the results analysis, wild-type (WT) mice could only amplify one 239bp band, heterozygous (HE) mice had two bands, 239bp and 298bp, and homozygous (HO) mice could only amplify one 298bp band.
[0045] Example 4 Phenotypic Analysis of Cep295 Conditional Knockout Mice 1) General situation analysis: Compared with wild-type mice, there were no differences in birth rate, survival rate, body weight, and body length among knockout mice; 2) Head circumference measurement: Brain tissue was collected from mice 21 days after birth, frozen sections were prepared and stained with Nissl stain. The results showed that Cep295 homozygous knockout (Cep295-cKO) mice exhibited significant cortical thinning and reduced head circumference. 3) Cell development: To elucidate the pathological mechanism of Cep295 knockout leading to microcephaly, immunofluorescence staining was performed on mouse brain tissue sections to analyze the development of corresponding nerve cells.
[0046] See the above results Figures 9 to 11 ,in, Figure 9This study showed that Cep295 conditional knockout (Cep295-cKO) mice exhibited cortical thinning. Furthermore, the cortical thinning caused by Cep295 knockout primarily stemmed from superficial cortical abnormalities (see [link to study]). Figure 10 Homozygous knockout mice exhibit centrosome segregation defects in radial glial cells (RGCs) of the cortical brain, and display unipolar mitosis (see [link to original text]). Figure 11 The number of ectopic mitotic cells in the cortex increases, along with increased apoptosis (see...). Figure 12 Further research revealed that RGCs differentiated prematurely, leading to depletion of the progenitor cell pool; premature differentiation of RGCs resulted in a reduction in intermediate progenitor cells and a decrease in new neurons during late neurodevelopment (see [link to study]). Figure 13 ).
[0047] The specific embodiments of the present invention have been described above. It should be understood that the present invention is not limited to the specific embodiments described above, and those skilled in the art can make various modifications or variations within the scope of the claims, which do not affect the essence of the present invention.
Claims
1. A method for constructing knockout regions of the cerebral cortex. Cep295 The gene-targeting vector for a mouse model is characterized by, The structure of the target carrier, from the 5' end to the 3' end, includes the following: 5' homologous arm, the 5' homologous arm being derived from mouse Cep295 The genomic sequence upstream of exon 11 of the gene; The flox region contains mouse Cep295 Exons 11 through 15 of the gene; Frt-pGK-Neo-polyA-Frt element, where Frt-pGK-Neo-polyA is a selection marker gene expression cassette; 3' homologous arm, the 3' homologous arm being derived from mouse Cep295 The genomic sequence downstream of exon 15 of the gene; And the MC1-TK-polyA element, where MC1-TK-polyA is a negative selection marker gene expression cassette.
2. The target carrier according to claim 1, characterized in that, The primer pairs involved in the targeting vector include one or more of the following: CEP295-F1 / CEP295-R1, CEP295-F2 / CEP295-R2, CEP295-F3 / CEP295-R3, and CEP295-F4 / CEP295-R4.
3. The target carrier according to claim 2, characterized in that, The primer pair shown includes SEQ ID NO.1 and SEQ ID NO.2, respectively. The sequence of SEQ ID NO.1 is as follows: CGCGGTCGACAAGCTTATAAGACACTGACTCTGCGCTT; The sequence of SEQ ID NO.2 is as follows: AAGGATGTACCAAGGTAGAGTGTTGATAACTTCGTATAATGTATGCTATACGAAGTTATCATGGCATGTAGACAACAAGGAA; The primer pair CEP295-F2 / CEP295-R2 includes SEQ ID NO.3 and SEQ ID NO.4, respectively, wherein the sequence of SEQ ID NO.3 is as follows: CCTTGGTACATCCTTATAGATGGTTGAATGAGTGTCTG; The sequence of SEQ ID NO.4 is as follows: CGACTCTAGAGGATCGGCGCGCCGAGCAAAGTGTGTAGTCTGCTTTAGCCATTATGTCACTTAGGGAAAAA; The primer pair CEP295-F3 / CEP295-R3 includes SEQ ID NO.5 and SEQ ID NO.6, respectively, wherein the sequence of SEQ ID NO.5 is as follows: CTACACACTTTGCTCGGCGCGCCCAGTCAGGTACATAATGAATTCCGAAGTTCCTATT; The sequence of SEQ ID NO.6 is as follows: GTCTCGGAAGCCCAGGCGGATCC; The primer pair CEP295-F4 / CEP295-R4 includes SEQ ID NO.7 and SEQ ID NO.8, respectively, wherein the sequence of SEQ ID NO.7 is as follows: CTGGGCTTCCGAGACATAACTTCGTATAGCATACATTATACGAAGTTATTATAGTTGGTATGGTTATAATCT; The sequence of SEQ ID NO.8 is as follows: CGACTCTAGAGGATCGATTAGTGTTTTCAACTTAATTA.
4. A method for constructing region-specific knockouts in the cerebral cortex Cep295 The method for creating a mouse model of a gene is characterized by, Includes the following steps: Step S1: Construct the target carrier as described in any one of claims 1 to 3 to obtain a linearized target carrier; Step S2: The linearized targeting vector was transfected into mouse embryonic stem cells via liposomes, and positive homologous recombinant ES cell clones were obtained by screening with resistance drugs and identification by long fragment PCR and sequencing. Step S3: The positive homologous recombinant ES cell clone was injected into the blastocyst of C57BL / 6 mice, and the injected blastocyst was transferred to the uterus of a pseudopregnant mouse to obtain chimeric male mice. Step S4: Mating the chimeric male mouse with Flp transgenic mice to obtain F1 generation heterozygous mice; Step S5: Self-cross the F1 generation heterozygous mice to obtain F2 generation homozygous mice, and cross the F1 generation heterozygous mice with Emx1-Cre transgenic mice to obtain F2 generation heterozygous knockout mice; Step S6: Cross the F2 generation homozygous mice with the F2 generation heterozygous knockout mice to obtain the F3 generation conditional knockout mice. Cep295 homozygous mice, i.e., mice with specific knockouts of cerebral cortex regions Cep295 Mouse models of genes.
5. The method according to claim 4, characterized in that, In step S2, the resistance drug screening involves dual screening with neomycin and ganciclovir.
6. The method according to claim 4, characterized in that, The step S6 is followed by the following step: Genotyping of the F3 generation mice was performed using PCR, with primers including a forward primer and a reverse primer. The forward primer included the sequence shown in SEQ ID NO. 13, which is shown below: CCAACCTCCTTGAAGCCTCT; The reverse primer comprises the sequence shown in SEQ ID NO.14, which is shown below: GCCACACACATTAATCATTCAACC.
7. The target carrier according to any one of claims 1 to 3 Cep295 Applications in mutant or knockout animal models; Preferably, the Cep295 The mutation or knockout animal model is the mouse model.
8. The use of the targeting vector according to any one of claims 1 to 3 or the mouse model obtained by the method according to any one of claims 4 to 6 in screening drugs for the treatment or prevention of brain and neurodevelopment-related diseases; Preferably, the brain and neurodevelopment-related disease is syndromic microcephaly.
9. A method for constructing knockout regions of the cerebral cortex. Cep295 A kit for a mouse model of a gene, characterized in that, The kit includes the targeting vector as described in any one of claims 1 to 3.
10. The reagent kit according to claim 9, characterized in that, The kit also includes primer pairs for genotype identification, the primer pairs including a forward primer and a reverse primer, wherein the forward primer includes the sequence shown in SEQ ID NO.13: CCAACCTCCTTGAAGCCTCT; The reverse primer comprises the sequence shown in SEQ ID NO.14: GCCACCACATTAATCATTCAACC; Alternatively, the kit may also include liposome transfection reagents, neomycin, ganciclovir, and ES cell culture-related reagents.