Bovine circRAPGEF1 eukaryotic overexpression vector and application thereof
The plasmid-type overexpression vector pK25ssAAV-circRAPGEF1, constructed through double enzyme digestion and prokaryotic screening, solved the instability problem of bovine circRAPGEF1 gene overexpression, achieving efficient expression and functional identification, and promoting the regulation of muscle growth and development.
Patent Information
- Application Number
- CN202511041956.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-28
- Publication Date
- 2025-10-28
AI Technical Summary
Existing eukaryotic expression vectors suffer from unstable expression and low insertion efficiency in bovine circRAPGEF1 gene overexpression, making it difficult to achieve efficient gene function identification and regulation of muscle growth and development.
The bovine circRAPGEF1 gene was inserted into the shuttle plasmid pK25ssAAV-ciR using a double enzyme digestion method (EcoRI and BamHI). The prokaryotic ampicillin resistance gene was used for screening to construct the plasmid-type overexpression vector pK25ssAAV-circRAPGEF1, ensuring the integrity and functional activity of the target gene. The recombinant vector was obtained by PCR amplification and DNA ligase ligation.
This study achieved efficient expression of the bovine circRAPGEF1 gene in host cells, significantly improving transcription and translation efficiency, simplifying the screening process, providing molecular mechanisms for circRAPGEF1 functional identification and muscle development regulation, and revealing its regulatory role in muscle development.
Smart Images

Figure CN120843604A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology and relates to a eukaryotic overexpression vector pK25ssAAV-circRAPGEF1, which can be used in the modification of seed cells and the functional identification of bovine circRAPGEF1. Background Technology
[0002] Currently, gene expression has become a mainstream technique in biological, medical, and drug development research. Gene overexpression is a "legitimate reversal" of gene knockout. Overexpression ensures the production of more messenger RNA, which in turn produces more proteins or downstream products. It can positively regulate the performance of a gene, facilitating the study of gene function within an organism.
[0003] Many plasmid vectors capable of gene overexpression have been developed. The pK25ssAAV-ciR vector is one of the most commonly used mammalian expression vectors. It utilizes a strong CMV promoter to regulate exogenous gene expression, exhibiting high copy number and expression levels. It is GFP-labeled, tagless, and possesses Amp+ prokaryotic selection resistance. The pK25ssAAV-ciR vector plasmid is 6052 bp in size, contains a multiple cloning site region, and includes various restriction enzyme digestion sites. It can be used to integrate the target gene via double enzyme digestion to construct a recombinant plasmid that achieves the expression of the target gene.
[0004] In molecular biology experiments, two different restriction enzymes are typically used to treat the target gene and vector simultaneously to prevent self-ligation or reverse ligation. The double restriction enzyme digestion method utilizes the principle that restriction endonucleases can recognize and cut specific nucleotides. Two different restriction endonucleases are used to cut the target gene to obtain a target gene fragment with sticky ends at both ends. This fragment is then ligated with a linear vector containing the same sticky ends, obtained by cutting with the same two restriction endonucleases, using T4 DNA ligase, thereby achieving gene cloning.
[0005] Circular RNAs (circRNAs) are a class of covalently closed circular RNA molecules lacking a 5' cap and a 3' poly(A) tail. This structure makes circRNAs less susceptible to degradation by ribonucleases. circRNAs are highly diverse and widely distributed in eukaryotic cells. Advances in sequencing technology and bioinformatics analysis have revealed that circRNAs possess stable biological properties, spatiotemporal expression specificity, and interspecies conservation. circRNAs have been detected in various tissues, including the lung, liver, heart, skeletal muscle, and brain, with a particularly high concentration in skeletal muscle. Skeletal muscle development is a finely regulated process involving the synergistic effects of protein-coding genes and ncRNAs. Recent studies have shown that circRNAs are important regulators in skeletal muscle development. For example, circFGFR4, highly expressed in bovine skeletal muscle, can induce apoptosis and promote myoblast differentiation, but has no effect on myoblast proliferation. In humans, circ-ZNF609 is expressed at higher levels in myotubes than in myoblasts, and reducing its expression can inhibit myoblast proliferation. These findings demonstrate that circRNAs play a crucial role in biological development, regulating gene expression by binding to genes such as miRNAs.
[0006] RNAs can influence the inhibitory effect of miRNAs on target genes by competitively binding to common miRNAs. These RNAs are called competing endogenous RNAs (ceRNAs), including mRNAs, pseudogenes, and lncRNAs. circRNAs, containing miRNA binding sites and possessing stable structures, can act as efficient ceRNAs, binding to miRNAs and functioning as miRNA sponges. This effectively inhibits the binding of miRNAs to the untranslated regions of target genes, thereby achieving regulatory effects on target genes. Furthermore, some circRNAs can bind to multiple miRNAs, affecting the regulation of multiple genes. The main way circRNAs regulate muscle development is through sponging; the combination of miRNAs and circRNAs affects the expression of other genes. For example, circHUWE1 can adsorb miR-29b, indirectly activating the AKT signaling pathway, thereby promoting myoblast proliferation and inhibiting apoptosis and differentiation. On the other hand, circFGFR4 promotes myoblast differentiation and induces apoptosis by increasing Wnt3a expression. miR-107, however, inhibits this effect. In bovine skeletal muscle satellite cells, the addition of miR-181a mimics significantly increased the expression of muscle-related differentiation proteins and the number of myotubes in the cells. Furthermore, circRNA-PPP1CC can adsorb miR-181b, regulating muscle proliferation, differentiation, and growth. Competitive binding of circ-CDR1as to miR-7 leads to downregulation of insulin-like growth factor 1 receptors, thereby activating muscle differentiation. Overexpression of circLMO7 inhibits the differentiation of bovine primary myoblasts and competitively binds to miR-378a-3p, participating in bovine muscle development. CircRNAs can directly or indirectly regulate genes related to muscle development, promoting myoblast proliferation and inhibiting apoptosis. For example, circSVIL is highly expressed in late embryonic development of skeletal muscle and promotes myoblast proliferation and differentiation. These studies reveal the important regulatory role of circRNAs in muscle development, providing new perspectives for understanding the pathogenesis of muscle-related diseases and finding potential treatments. Summary of the Invention
[0007] The purpose of this invention is to provide a eukaryotic overexpression vector pK25ssAAV-circRAPGEF1, which can be used in the modification of seed cells and the functional identification of bovine circRAPGEF1.
[0008] To achieve the above objectives, the present invention provides the following technical solution: a plasmid-type overexpression vector, wherein the overexpression vector can express the circRAPGEF1 gene in bovine muscle cells.
[0009] Furthermore, the bovine muscle cells are derived from bovine muscle tissue.
[0010] Furthermore, the overexpression vector is a positive plasmid containing the bovine circRAPGEF1 gene.
[0011] Furthermore, the bovine circRAPGEF1 gene was inserted into the shuttle plasmid using a double enzyme digestion method to obtain the overexpression vector, wherein the enzyme digestion sites were EcoRI and BamHI.
[0012] Furthermore, after inserting the bovine circRAPGEF1 gene into the shuttle plasmid using a double enzyme digestion method, the overexpression vector was obtained by screening using a prokaryotic ampicillin resistance gene.
[0013] Furthermore, the bovine circRAPGEF1 sequence was obtained by PCR amplification. The bovine circRAPGEF1 amplification product obtained by double enzyme digestion and the shuttle plasmid were ligated using DNA ligase to obtain a plasmid-type overexpression vector.
[0014] Specifically: The bovine circRAPGEF1 sequence was amplified by KOD-Plus-Neo (1U / μL) high-fidelity enzyme PCR. The upstream and downstream primers of the amplification product had EcoRI and BamHI restriction sites at their distal ends. The amplification product and the shuttle plasmid (e.g., pK25ssAAV-ciR vector) were digested with EcoRI and BamHI, respectively. The bovine circRAPGEF1 sequence obtained by double digestion and the linearized pK25ssAAV-ciR vector were ligated using DNA ligase. After transformation and plate plating (resistance selection), single clones were selected for identification to obtain the recombinant vector pK25ssAAV-circRAPGEF1.
[0015] Based on the exon 2-5 sequence of the RAPGEF1 gene genome sequence NC_000009.12, the full-length sequence of circRAPGEF1 was obtained. The primers for PCR amplification of the coding region of the circRAPGEF1 gene are as follows:
[0016] Upstream primer: 5'>CATTAATATTTCTTCTTTC GAATTC TAATACTTTCAGACTCTCAGCGTTCTCATCTCT<3'
[0017] Downstream primer: 5'>AGTATGGAGTTGTTAGCTA GGATCC AGTTGTTCTTACCTTCACTCCATCCAGCACGGC<3'
[0018] The underlined portions of the upstream and downstream primers represent the EcoRI and BamHI restriction sites, respectively.
[0019] Furthermore, the bovine circRAPGEF1 gene is a cloned exogenous or endogenous bovine circRAPGEF1 gene; the shuttle plasmid is selected from pK25ssAAV-ciR.
[0020] This invention also provides the application of the above-mentioned plasmid-type overexpression vector in the functional identification of the bovine circRAPGEF1 gene.
[0021] Preferably, in the functional identification of circRAPGEF1 in cattle, the recombinant vector pK25ssAAV-circRAPGEF1 is transfected into isolated bovine myoblasts (e.g., bovine primary myoblasts), and the mRNA and protein expression levels of circRAPGEF1 in the bovine muscle cells are detected after 24 hours; at the same time, the expression of proliferation and differentiation marker genes (PCNA, CDK2, CylinD1, MyoD, MyoG, MYHC) of bovine muscle cells after overexpression of pK25ssAAV-circRAPGEF1 is detected.
[0022] The present invention also provides the application of the above-mentioned plasmid-type overexpression vector in cell modification.
[0023] The present invention also provides the application of the above-mentioned plasmid-type overexpression vector in the regulation of muscle growth and development in vivo or in vitro.
[0024] Preferably, bovine muscle cells (e.g., primary bovine muscle cells) isolated from individuals of the corresponding yellow cattle breed were transfected with the recombinant vector pK25ssAAV-circRAPGEF1. After pK25ssAAV-circRAPGEF1 overexpression was detected in the bovine muscle cells, the bovine muscle cells were cultured again. It was found that circRAPGEF1 overexpression can inhibit the differentiation of muscle cells, thereby slowing down the process of muscle development and regeneration.
[0025] Compared with the prior art, the present invention has at least the following beneficial effects:
[0026] The plasmid-type overexpression vector pK25ssAAV-circRAPGEF1 constructed in this invention achieves efficient expression of the bovine circRAPGEF1 gene in host cells, laying the foundation for circRAPGEF1 functional identification and cell modification, as well as regulation of muscle metabolism and growth and development.
[0027] During vector construction, the target gene was precisely inserted into the shuttle plasmid pK25ssAAV-ciR using a double enzyme digestion method (EcoRI and BamHI), avoiding the expression instability caused by random integration. This selection of enzyme sites not only improved insertion efficiency but also solved the inhibitory effect of hairpin structures that may form on gene expression in traditional vector backbones. For example, compared with vectors such as pcDNA3, the pK25ssAAV backbone exhibited a higher overexpression level after transfection of host cells, significantly improving the transcription and translation efficiency of the circRAPGEF1 gene. In addition, the prokaryotic ampicillin resistance gene carried by the vector simplifies the screening process, allowing for rapid acquisition of positive clones through resistance screening, significantly shortening the experimental cycle.
[0028] In the construction of the plasmid-based overexpression vector pK25ssAAV-circRAPGEF1 of this invention, the full-length sequence of circRAPGEF1 was precisely designed by referring to the genomic sequence of the RAPGEF1 gene (e.g., exons 2-5 of NC_000009.12). This design ensures the integrity and functional activity of the target gene, avoiding functional loss due to sequence truncation or mutation. During the functional validation phase, after successful overexpression of circRAPGEF1 in bovine muscle cells, its mRNA and protein levels can be further detected, and its effects on cell proliferation and differentiation marker genes (such as PCNA, CDK2, and MyoD) can be analyzed. This multi-level validation strategy not only reveals the direct function of circRAPGEF1 but also provides molecular mechanism evidence for its role in muscle development regulation. For example, experiments have shown that circRAPGEF1 overexpression can inhibit myocyte differentiation and slow down muscle development, providing a new target for muscle regeneration medicine and livestock improvement.
[0029] By transfecting the recombinant vector pK25ssAAV-circRAPGEF1 into bovine primary myoblasts, researchers could detect the mRNA and protein expression levels of circRAPGEF1 within 24 hours, thus rapidly validating the gene's transcriptional and translational activities. Furthermore, the vector overexpression system allows for dynamic regulation of gene function; for example, by adjusting the transfection concentration or time, the effects of changes in gene expression levels on cell phenotype can be observed. In the functional identification of circRAPGEF1 in cattle, vector overexpression significantly altered the expression patterns of cell proliferation (PCNA, CDK2) and differentiation (MyoD, MyoG) marker genes, revealing the dual regulatory role of circRAPGEF1 in muscle development. Attached Figure Description
[0030] Figure 1A represents the result of the overexpression efficiency of the pK25ssAAV-circRAPGEF1 recombinant plasmid at the mRNA level.
[0031] Figure 1 B represents the results of quantitative PCR detection of myoblast differentiation marker gene expression after transfection with pK25ssAAV-circRAPGEF1;
[0032] Figure 1 C represents the results of quantitative PCR detection of myoblast proliferation marker gene expression after pK25ssAAV-circRAPGEF1 transfection;
[0033] Figure 2 A represents the EdU assay results of myoblast expression after transfection with pK25ssAAV-circRAPGEF1;
[0034] Figure 2 B and Figure 2 C represents the results of CCK-8 and EdU assays on pK25ssAAV-circRAPGEF1-positive cells. Detailed Implementation
[0035] The present invention will now be described in detail with reference to the accompanying drawings and embodiments. The embodiments are merely explanations of the present invention and are not intended to limit the scope of protection of the present invention.
[0036] This invention constructs a recombinant vector capable of overexpressing bovine circRAPGEF1. After transfection of primary cultured bovine muscle cells or other homologous or heterologous host cells with this recombinant vector, efficient expression of circRAPGEF1 gene mRNA and circRAPGEF1 protein can be obtained in the host cells. This lays the foundation for circRAPGEF1 functional identification and cell modification, as well as for regulating muscle metabolism and growth. The specific steps are as follows:
[0037] (I) Construction of eukaryotic overexpression vector pK25ssAAV-circRAPGEF1
[0038] 1. Materials and Methods
[0039] 1.1 Instruments
[0040] Clean bench, biochemical incubator, gene amplification instrument, PTC-200 single-tank gradient gene amplification instrument, Heraeus refrigerated high-speed centrifuge (Germany), Bio-Rad gel imaging analyzer (USA), CO2 incubator, HZS-H water bath shaker (Harbin), Eppendorf pipettes, DYY-Ⅲ type constant voltage and constant current electrophoresis apparatus (Beijing Liuyi), DYY-Ⅲ31A and DYY-Ⅲ28D electrophoresis tanks (Beijing Liuyi), ice maker, MDF-382E ultra-low temperature freezer (Sanyo, Japan), Eppendorf benchtop high-speed centrifuge, Sartorious electronic balance (Germany), conventional freezer, etc.
[0041] 1.2 Biochemical reagents and kits
[0042] KOD Plus Neo, Fast Digest endonuclease, PrimeSTAR DNA polymerase, DNA restriction endonucleases (EcoRI, BamHI, etc.), collagen, trypsin, collagenase I, DNA marker, T4 DNA Ligase, Trizol, reverse transcription kit, Hieff Plus One Step Cloning Kit, expression vector (pK25ssAAV-ciR), low endotoxin plasmid miniprep kit, agarose gel DNA recovery kit, fetal bovine serum, etc.
[0043] 1.3 Culture medium
[0044] 1) Resistance screening
[0045] LB medium: tryptone, yeast extract, NaCl and agar powder; add 10g tryptone, 5g yeast extract and 10g NaCl to 950mL deionized water, adjust the pH to 7.0 with 5mol / L NaOH, and add 15g agar powder.
[0046] Resistance: Ampicillin (added at a ratio of 1:1000).
[0047] 2) Cell Culture
[0048] DMEM complete culture medium.
[0049] 1.4 Common reagents
[0050] Tris, EDTA, NaCl, NaOH, anhydrous ethanol, sodium dodecyl sulfonate (SDS), agarose, KCl, Na2HPO4, KH2PO4, Tris saturated phenol (pH=8.0), chloroform, isopropanol, glycerol.
[0051] 1.5 Synthesis of bovine circRAPGEF1 PCR primers
[0052] Based on the exon 2-5 sequence of the RAPGEF1 gene (NC_000009.12) published in GenBank, the full-length sequence of circRAPGEF1 was obtained, and the primer sequences for amplifying the coding region of the circRAPGEF1 gene were designed as follows:
[0053] Sequence 1 - Upstream primer: 5'>CATTAATATTTCTTCTTTC GAATTC TAATACTTTCAGACTCTCAGCGTTCTCATCTCT<3'
[0054] Sequence 2 - Downstream primer: 5'>AGTATGGAGTTGTTAGCTAGGATCCAGTTGTTCTTACCTTCACTCCATCCAGCACGGC<3'
[0055] The underlined portions of the upstream and downstream primers represent the EcoRI and BamHI restriction sites, respectively.
[0056] 1.6 PCR amplification of the bovine circRAPGEF1 gene fragment
[0057] 1) Obtaining cDNA from Qin Chuan cattle muscle tissue
[0058] Muscle tissue from Qinchuan cattle (slaughterhouse of Shaanxi Qinbao Animal Husbandry Co., Ltd., March 2019) was collected. RNA was extracted using the Trizol method and analyzed using PrimeScript. TM The reverse transcription RT kit (Clontech, TaKaRa) synthesizes cDNA based on the extracted RNA. Sequence 3 is as follows:
[0059] ACTCTCAGCGTTCTCATCTCTCCTCCTTCACCATGAAGCTGAAGGACAAATTCCACTCGCCCAAAATCAAGAGGACGCCATCAAAGAAGGGAAAACCAGCCGAGGTGTCTGTGAAGATTCCAGAGAAGCCCGTGAACAAAGAGGCAA CAGACAGATTTCTACCAGAGGGCTACCCTATCCCCTTGGATCTGGAGCAGCAGGCAGTAGAGTTTATGTCCACCAGTGCTGTGGCTTCCAGGTCTCAAAGGCAGAAGAACCTGAGCTGGCTGGAGGAGAAAGAGAAGGAAGTTGTCAG TGCCTTGCGCTACTTTAAGACCATTGTGGACAAAATGGCTATTGATAAGAAGGTCCTGGAGATGCTCCCAGGGTCCGCCAGCAAGGTGCTGGAGGCCATCTTACCCCTGGTGCAGAGCGACCCTCGAATTCAGCACAGCTCAGCCCT CTCCTCCTGCTACAGCCGAGTGTACCAAAGTCTCGCCAATCTCATCCGTTGGTCTGACCAAGTGATGCTGGAAGGCGTGAACTCAGAAGATAAAGAGATGGTGACAACTGTGAAGGGGGTCATCAAGGCCGTGCTGGATGGAGTGAAG
[0060] 2) The PCR reaction system is 20 μL, see Table 1:
[0061] Table 1 PCR primer amplification system
[0062]
[0063] 3) PCR reaction procedure, see Table 2:
[0064] Table 2 PCR Primer Amplification Procedure
[0065]
[0066] The PCR products were separated by 1.5% agarose gel electrophoresis, and the amplified circRAPGEF1 gene fragment was recovered from the gel.
[0067] 4) The double enzyme digestion reaction system is shown in Table 3.
[0068] Table 3. Double enzyme digestion reaction system
[0069]
[0070] 1.7 Construction of pK25ssAAV-circRAPGEF1 recombinant plasmid carrying the circRAPGEF1 sequence
[0071] ReferenceHieff The Plus One Step Cloning Kit (Shanghai Yisheng) instructions describe how to prepare the ligation reaction solution, maintain it at 50℃ for 20 minutes, and then perform the conversion or store it at -20℃. The ligation system is shown in Table 4.
[0072] Table 4. Plasmid ligation system of circRAPGEF1-pK25ssAAV-ciR
[0073]
[0074] The pK25ssAAV-ciR plasmid vector containing the circRAPGEF1 gene sequence was transformed into competent Trans1 T1 cells.
[0075] 1.8, pK25ssAAV-circRAPGEF1 transforms into competent cells
[0076] (1) Remove competent cells from the -80℃ freezer and place them on ice to thaw;
[0077] (2) Under aseptic conditions, take 50 μL of competent cells and place them in a sterilized 1.5 mL centrifuge tube;
[0078] (3) Add 10 μL of the ligation product and place on ice for 30 min;
[0079] (4) Place at 42℃ for 30 seconds (heat shock), do not shake the centrifuge tube;
[0080] (5) Quickly transfer the centrifuge tubes to ice and place them for 2 to 3 minutes;
[0081] (6) Add 200 μL of LB liquid medium, mix well by pipetting, spread on LA agar plates, and incubate at 37°C upside down for 12-16 hours. Centrifuge for 1 minute and collect 400 μL of supernatant.
[0082] (5) Inoculate 150μL to 200μL onto LB plates containing kanamycin;
[0083] (6) Let it sit for 30 minutes, then invert it and incubate overnight at 37°C for 12-16 hours;
[0084] (7) Select single-clone colonies, perform bacterial culture PCR, and send them to the company for sequencing to select successfully transformed samples.
[0085] 1.9. Extract plasmids from successfully transformed samples.
[0086] (1) Take 1.5 mL of bacterial culture and centrifuge at 8000 g for 2 min at room temperature to collect the bacterial cells. Discard or absorb the culture medium.
[0087] (2) Add 250 μL of Buffer P1 to the bacterial pellet and aspirate or shake until completely suspended;
[0088] (3) Add 250 μL Buffer P2, immediately gently invert the centrifuge tube 5-10 times until completely mixed, and let stand at room temperature for 2-4 minutes;
[0089] (4) Add 350 μL Buffer P3 and immediately gently invert 5 to 10 times until completely mixed;
[0090] (5) Centrifuge at a speed ≥12000g for 5-10 minutes. Carefully transfer all the supernatant into the adsorption column and centrifuge at 9000g for 30 seconds. Discard the liquid in the collection tube and place the adsorption column back into the original collection tube.
[0091] (6) Add 500 μL of protein removal buffer DW1 to the adsorption column and centrifuge at 9000g for 30s. Discard the liquid in the collection tube and return the adsorption column to the original collection tube (to further reduce protein residue);
[0092] (7) Add 500 μL Wash Solution to the adsorption column, centrifuge at 9000g for 30s, discard the liquid in the collection tube, and put the adsorption column back into the original collection tube.
[0093] (8) Repeat the previous step;
[0094] (9) Place the adsorption column and collection tube into a centrifuge and centrifuge at 9000g for 1 min;
[0095] (10) Add 50 μL to 100 μL of Elution Buffer to the center of the adsorption membrane, let it stand at room temperature for 1 min to 2 min, and centrifuge at 9000g for 1 min. Store the obtained plasmid DNA solution at -20℃ for later use.
[0096] 2. Applications and related testing
[0097] 2.1 Primary Culture of Qin Chuan Bovine Muscle Cells
[0098] Fetal calves were placed in a handling dish and rinsed three times with sterile PBS containing 1% penicillin-streptomycin. The epidermal tissue was cut along the fetal calves' spine, and the back muscles were cut out and placed in PBS (6cm culture dish) containing 1% penicillin-streptomycin. The muscle pieces were cut into small pieces with scissors and then collected into 50mL centrifuge tubes. Collagenase I was added and digested in a 37°C water bath for 1.5h. The mixture was then filtered through a 200-mesh nylon mesh, and the filtrate was collected in a centrifuge tube. The mixture was centrifuged at 1000r / min for 10min, and the supernatant was removed. The precipitate was the muscle cells. The cells were resuspended in DMEM complete medium containing 15% FBS and 1% penicillin-streptomycin. Cells were counted and seeded at a ratio of 60% in 6cm culture dishes. The cells were cultured at 37°C in a 5% CO2 incubator for 2h. The supernatant was then transferred to a new 6cm culture dish and cultured until the cell density reached about 80%-90%. The cells were then passaged or cryopreserved for subsequent experiments.
[0099] 2.2 Transfection of bovine muscle cells with the circRAPGEF1 recombinant overexpression vector
[0100] When the cultured primary muscle cells of Qinchuan cattle reach a density of 60%, the pK25ssAAV-circRAPGEF1 recombinant plasmid encapsulated in liposomes is added (according to Lipofectamine). TM (Follow the instructions for using the 3000 Transfection Reagent kit) Transfect cells and detect the expression of the circRAPGEF1 gene by real-time quantitative PCR, as well as the expression of muscle cell proliferation marker genes (PCNA, CDK2, CyllnD1) and muscle cell differentiation marker genes (MyoD, MyoG, MYHC) in bovine muscle cells after overexpression of the circRAPGEF1 gene.
[0101] 2.3 EdU assay for cell proliferation
[0102] The EdU detection kit was purchased from Guangzhou Ribobio Biotechnology Co., Ltd., and the procedure was performed according to the instructions:
[0103] (1) Cell culture and transfection: Bovine muscle primary cells were seeded into 96-well plates, and 100 μL of LMEM complete medium was added to each well (about 1×104 cells). When the cell density reached about 70%, the cells were transfected with pK25ssAAV-circRAPGEF1 and pK25ssAAV-ciR empty vectors, respectively, and cultured for 24 h after transfection.
[0104] (2) EdU staining: Add 100 μL of 50 μmol / L EdU-containing medium to each well, incubate for 2 h, remove the medium, and wash the cells 3 times with PBS for 3-5 min each time.
[0105] (3) Cell fixation: Add 50 μL of 4% paraformaldehyde solution to each well for fixation, incubate on a decolorizing shaker at room temperature for 30 min and then remove the solution. Add 50 μL of glycine solution and incubate at room temperature for 5 min and then discard the solution. Wash the cells with PBS 3 times, 3-5 min each time.
[0106] (4) Apollo staining: Add 100 μL of Apollo staining reaction solution to each well and incubate on a shaker at room temperature in the dark for 30 min. After discarding the solution, add 100 μL of PBS solution containing 0.5% Triton X-100 and incubate 3 times for 10 min each time. After discarding the solution, add 100 μL of formaldehyde to each well and wash twice for 5 min each time, and then wash with PBS for 5 min.
[0107] (5) DNA staining: Add 100 μL of 1×Hoechst33342 reaction solution to each well, incubate on a shaker at room temperature in the dark for 30 min, then discard the reaction solution and wash with PBS 3 times, 5 min each time.
[0108] (6) EdU imaging: Immediately after staining, the images were observed using a fluorescence inverted microscope, and the number of cells was analyzed. It was found that after overexpression of circRAPGEF1, the number of DNA replication-positive cells increased, and the proliferation rate of bovine muscle primary cells was accelerated compared with the control.
[0109] 2.4 CCK-8 Detection
[0110] (1) Seed cell suspension (100 μL / well) in 96-well plates. Usually, about 2000 cells are used per well for cell proliferation assay. The specific number of cells used per well needs to be determined by taking into account factors such as cell size and proliferation rate.
[0111] (2) According to the experimental requirements, culture and stimulate with 0-10 μL of specific drugs for a period of time (6, 12, 24, 48 hours);
[0112] (3) Add 10 μL of CCK-8 solution to each well. If the initial culture volume is 200 μL, then add 20 μL of CCK-8 solution (and so on). Cell-free wells can be used as controls by adding the corresponding volume of cell culture medium and CCK-8 solution. If you want to know whether the added specific drug has an effect, you can also add the corresponding volume of cell culture medium, specific drug and CCK-8 solution to cell-free wells as controls.
[0113] (4) Incubate in a cell culture incubator for 1 to 3 hours. The specific time can be determined by a preliminary experiment (the enzyme-linked immunosorbent assay (ELISA) can be used to detect the absorbance at 0.5, 2 and 4 hours after the preliminary experiment, and then select the time point with appropriate absorbance for the experiment).
[0114] (5) The absorbance value is measured at 450nm using an enzyme-linked immunosorbent assay (ELISA) reader. If a 450nm filter is unavailable, a 420-480nm filter can be used. If the cell suspension is highly turbid, a wavelength greater than 600nm can be used for measurement.
[0115] (6) If preservation is required and the OD value is not measured temporarily, 10 μL of 0.1 M HCl solution should be added to each well and stored at room temperature in the dark. The absorbance can be maintained for 24 hours.
[0116] 2.5 Test Results
[0117] like Figure 1 As shown in Figure A, the constructed overexpression vector successfully promoted the mRNA expression of circRAPGEF1 in bovine myoblasts. Figure 1 The q-PCR results for B showed that overexpression of the circRAPGEF1 gene significantly promoted the expression of differentiation marker genes, including MyhC, although the effect was not significant, it still had a certain promoting effect. Conversely, Figure 1 The results of C mRNA and protein level detection showed that circRAPGEF1 plays a promoting role in muscle cell proliferation. Figure 2 The results for CCK-8 and EdU shown also indicate that cell proliferation is promoted with overexpression of circRAPGEF1.
Claims
1. A plasmid-type overexpression vector, characterized in that, The overexpression vector can express the circRAPGEF1 gene in bovine muscle cells.
2. The plasmid-type overexpression vector according to claim 1, characterized in that, The bovine muscle cells are derived from the muscle tissue of yellow cattle.
3. The plasmid-type overexpression vector according to claim 1, characterized in that, The overexpression vector is a positive plasmid containing the bovine circRAPGEF1 gene.
4. The plasmid-type overexpression vector according to claim 3, characterized in that, The bovine circRAPGEF1 gene was inserted into a shuttle plasmid using a double enzyme digestion method to obtain the overexpression vector, wherein the enzyme digestion sites were EcoRI and BamHI.
5. The plasmid-type overexpression vector according to claim 4, characterized in that, After inserting the bovine circRAPGEF1 gene into the shuttle plasmid using a double enzyme digestion method, the overexpression vector was obtained by screening using a prokaryotic ampicillin resistance gene.
6. The plasmid-type overexpression vector according to claim 4, characterized in that, The bovine circRAPGEF1 sequence was obtained by PCR amplification. The bovine circRAPGEF1 amplification product obtained by double enzyme digestion and the shuttle plasmid were ligated with DNA ligase to obtain a plasmid-type overexpression vector. Based on the exon 2-5 sequence of the RAPGEF1 gene genome sequence NC_000009.12, the full-length sequence of circRAPGEF1 was obtained. The primers for PCR amplification of the coding region of the circRAPGEF1 gene are as follows: Upstream primer: 5'>CATTAATATTTCTTCTTTC GAATTC TAATACTTTCAGACTCTCAGCGTTC TCATCTCT<3' Downstream primer: 5'>AGTATGGAGTTGTTAGCTA GGATCC AGTTGTTCTTACCTTCACTCCATCC AGCACGGC<3' The underlined portions of the upstream and downstream primers represent the EcoRI and BamHI restriction sites, respectively.
7. The plasmid-type overexpression vector according to claim 4, characterized in that, The bovine circRAPGEF1 gene is a cloned exogenous or endogenous bovine circRAPGEF1 gene; the shuttle plasmid is selected from pK25ssAAV-ciR.
8. The application of a plasmid-type overexpression vector as described in any one of claims 1 to 7 in the functional identification of the bovine circRAPGEF1 gene.
9. The use of a plasmid-type overexpression vector as described in any one of claims 1 to 7 in cell modification.
10. The use of a plasmid-type overexpression vector as described in any one of claims 1 to 7 in the regulation of muscle growth and development in vivo or in vitro.