Method and device for detecting food-borne pathogenic microorganisms by using tubular device based on Cas12a system

Abstract

The invention relates to the technical field of food safety molecule detection, in particular to a method and a device for detecting food-borne pathogenic microorganisms by using a tubular device based on a Cas12a system, the tubular device is divided into an upper layer and a lower layer according to a mechanical structure, an RPA reaction solution system enrichment target is placed on the upper layer, a CRISPR-Cas12a system is placed on the lower layer, so that physical isolation is formed, and the Cas12a system is arranged on the lower layer. The upper-layer reaction is independently completed. The RPA product enters the lower layer through a gap by moving the tube cover, Cas12a and crRNA recognize and are specifically combined with a target, so that Cas12a trans-cleavage activity is activated, ssDNA marking a fluorophore HEX and a quenching group BHQ1 in a system is cleaved, a fluorescence signal is released, and a result can be observed through a blue light lamp and a filter. Sample detection can be completed within 40 min, the cost is low, operation is easy and convenient, system assembly can be completed at a time in the detection process, repeated uncovering is not needed, the requirement for equipment is low, and the method can be suitable for on-site rapid detection.

Description

Technical Field

[0001] This invention relates to the field of molecular detection technology for food safety, specifically to a method and apparatus for detecting foodborne pathogenic microorganisms using a single-tube device based on the Cas12a system. Background Art

[0002] In recent years, foodborne illnesses have become a significant global public health issue. With rapid globalization, more frequent travel and faster logistics have led to a significant increase in the incidence of foodborne diseases. Many factors, such as microorganisms, viruses, parasites, heavy metals, and antibiotics, make it difficult to maintain food safety stability. In my country, the most common foodborne pathogen is *Escherichia coli* O157:H7, which is mainly found in everyday foods such as beef, raw vegetables, raw milk, and freshly squeezed juice. Even very low doses of contaminated food can cause symptoms such as diarrhea, vomiting, and abdominal pain in consumers, and in severe cases, it can even be life-threatening. Therefore, establishing a rapid, sensitive, and accurate detection method for *E. coli* O157:H7 is crucial.

[0003] Traditional detection methods mainly include plate counting, polymerase chain reaction (PCR), and enzyme-linked immunosorbent assay (ELISA). All of these methods have limitations, such as long processing time, cumbersome steps, expensive equipment, and low throughput. In recent years, detection technologies for this pathogen have been continuously developing, advancing rapid detection by combining isothermal amplification techniques (such as loop-mediated isothermal amplification, recombinase polymerase amplification, and rolling circle amplification) and electrochemical techniques. While these methods have overcome some limitations, they are still not suitable for large-scale on-site testing. The cumbersome initial design steps and high costs prevent them from enabling real-time on-site detection.

[0004] The CRISPR-Cas system is an acquired immune defense system of bacteria against the invasion of exogenous nucleic acids, mainly composed of CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) and Cas proteins. There are many types of Cas proteins; Cas12a (Cpf1) is a type V Cas protein that, guided by crRNA, recognizes a specific PAM sequence in the target strand, activating its RuvC domain for specific cleavage of the target. Furthermore, once activated, this protein also possesses single-stranded deoxyribonuclease activity, capable of indiscriminately cleaving ssDNA in the system. Labeling ssDNA with fluorescent and quenching groups helps observe whether the ssDNA has been cleaved, thus determining the presence of target DNA.

[0005] This single-tube device integrates the RPA and CRISPR-Cas12a enzyme digestion systems, utilizing independent spaces in the upper and lower sections to avoid false positives caused by mutual interference. Similarly, the single-tube device allows for complete system assembly during the detection process, eliminating the need for repeated opening and preventing aerosol contamination from multiple openings. This device is simple to operate, requires no large instruments, has a short detection time, and provides intuitive and easy-to-understand results, thus facilitating the application of high-throughput rapid detection technologies in the field. Summary of the Invention

[0006] The purpose of this invention is to provide a method and apparatus for detecting foodborne pathogens using a single-tube device based on the Cas12a system. It establishes a rapid, accurate, and simple rapid nucleic acid detection method that is applicable to rapid on-site detection and provides strong technical support for food safety supervision. This invention can highly sensitively identify the rbfE gene of Escherichia coli O157:H7 and can detect target genomic DNA as low as 12 fg / μL within 40 minutes.

[0007] To achieve the above objectives, the present invention provides the following technical solution:

[0008] A method for detecting foodborne pathogens using a single-tube device based on the Cas12a system includes the following steps:

[0009] Specific RPA primers and crRNA were obtained by screening specific genes of foodborne pathogens, and corresponding ssDNA was obtained by screening the CRISPR-Cas12a system. The ssDNA is a single-stranded DNA molecule composed of 6-20 A / T / C / G bases, and the ssDNA fragment is labeled with the fluorescent group HEX at the 5' end and the quenching group BHQ1 at the 3' end.

[0010] The tubular device includes: an outer tube, which forms a reaction cavity inside; a basket-like structure disposed inside the reaction cavity of the outer tube, the basket-like structure dividing the reaction cavity into an upper reaction chamber and a lower reaction chamber that are physically isolated from each other; and a tube cover for sealing the outer tube.

[0011] The CRISPR-Cas12a system was placed in the lower reaction chamber of a tube-type device and centrifuged to avoid residual droplets on the tube wall. The basket-type structure was installed into the outer tube and fixed. The prepared RPA solution was added to the upper reaction chamber, and the tube cap was put on to keep the reaction cavity of the outer tube in a sealed state. The upper and lower reaction chambers formed independent spaces.

[0012] The CRISPR-Cas12a system includes specific crRNA, Cas12a enzyme, and ssDNA;

[0013] The RPA solution includes RPA primers specifically designed for foodborne pathogens, RPA enzyme solution, and DNA from the sample to be tested.

[0014] After the RPA solution in the upper reaction chamber has finished reacting, press down the tube cap to adjust the basket structure, creating a gap between the upper and lower layers. Gently shake or centrifuge to allow the RPA solution that has finished reacting in the upper reaction chamber to flow into the CRISPR-Cas12a system in the lower reaction chamber for incubation. After incubation, observe the fluorescence results by irradiating with a blue light.

[0015] If target DNA is present, the Cas12a enzyme and specific crRNA can recognize and specifically bind to the target DNA to form a complex, thereby activating the trans-cleavage activity of Cas12a. The ssDNA is cleaved, releasing a fluorescent group, and a significant fluorescent signal can be observed. If target DNA is not present, the Cas12a enzyme and specific crRNA cannot bind to the target to form a complex, and the trans-cleavage activity of Cas12a cannot be activated. The ssDNA structure remains intact, and no fluorescent group is released, i.e., there is no significant fluorescent signal.

[0016] Preferably, the RPA solution added to the upper reaction chamber is 15 μL, which includes: 10-12 μL of RPA enzyme solution containing Primer Free Rehydration buffer and ddH2O, 0.5-1 μL each of 10 μM specific RPA upstream and downstream primers, 0.5-1 μL of 280 nM MgOAC, and 0.5-1 μL of DNA from the sample to be tested.

[0017] Preferably, the CRISPR-Cas12a system added to the lower reaction chamber is 25 μL, which includes: 50 nM bCpf1 (Cas12) endonuclease, 10 U RNA inhibitor, 500 nM crRNA, 500 nM ssDNA, 2 μL NE buffer, and the remainder is DEPC water.

[0018] Preferably, the ssDNA sequence is: 5'-HEX-TTTTTTTTTTTT-BHQ1-3', as shown in SEQ ID NO:4.

[0019] The foodborne pathogenic microorganism described in this invention is the rbfE gene of Escherichia coli O157:H7.

[0020] Preferably, the specific RPA primer F sequence for the rbfE gene of Escherichia coli O157:H7 is: 5'-AAACCATGTGCAATATGCAACTACTGTAAG-3', as shown in SEQ ID NO:1;

[0021] The specific RPA primer R sequence is: 5'-TAGAACCAAAGGCTTCAGCGCAA TCTTCAA-3', as shown in SEQ ID NO:2.

[0022] Preferably, the crRNA sequence of the specific gene against foodborne pathogens is: AAUUUCUACUGUUGUAGAUUAGCAUUAACUGAUGCUAUAUAU, as shown in SEQ ID NO:3.

[0023] A tubular device for the method, comprising:

[0024] The outer tube has a reaction cavity formed inside it;

[0025] A basket-type structure is set inside the reaction cavity of the outer tube, and the reaction cavity is divided into an upper reaction chamber and a lower reaction chamber that are physically isolated from each other;

[0026] A cap is used to seal the outer tube;

[0027] The basket-type structure includes a liquid storage tank and a fixing column. The bottom of the liquid storage tank is provided with a through hole, and the fixing column is movably disposed in the through hole of the liquid storage tank. The bottom of the fixing column is provided with a blocking part to prevent it from falling out of the through hole.

[0028] The cap is connected to the top of the fixed column. By pressing or rotating the cap, the fixed column can be driven to move downward in the through hole of the liquid storage tank, thereby forming a gap between the fixed column and the liquid storage tank for liquid flow.

[0029] Preferably, the basket-type structure is 3D printed, and the bottom diameter of the fixing column is larger than that of the upper layer. It can be fixed to the through hole of the liquid storage tank to form a sealed state and prevent leakage of the upper reaction solution. The bottom of the liquid storage tank is provided with a 2mm wide anti-fall rail.

[0030] Preferably, the outer tube is a 0.2 mL PCR tube.

[0031] Preferably, the tube cap consists of an inner ring and an outer ring, with the outer ring used to seal the reaction vessel and the inner ring fitting into the fixed column.

[0032] This invention targets the detection of foodborne pathogens. It utilizes a novel one-tube device combined with specific RPA primers and crRNA, along with a CRISPR-Cas12a system to construct an integrated detection method. The main principle is that the Cas12a enzyme and crRNA specifically recognize and aggregate target DNA, while simultaneously activating the trans-cleavage activity of Cas12a to cleave ssDNA labeled with fluorescent and quenching groups in the system, thereby releasing a fluorescent signal. The presence of the target can be observed through a specific blue light illumination system.

[0033] Furthermore, for the detection of *E. coli* O157:H7, the specific gene *rfbE* in *E. coli* O157:H7* is used as the detection target. The target sequence in the RPA nucleic acid amplification system is a segment of the *rfbE* gene of *E. coli* O157:H7, GenBank: S83460, 350 bp in length, with the nucleotide sequence: AAACCATGTGCAATATGCAACTACTGTAAGTA. ATGGAACGTTGCTCTTCATTTAGCTTTGTTAGCGTTAGGTATATCGGAAGGAGATGAAGTTATTGTTCCAACACTGACATATATAGCATCAGTTAATGCTATAAAATACACAGGAGCCACCCCCATTTTCGTTGATTCAGATAATGAAACTTGGCAAATG TCTGTTAGTGACATAGAACAAAAAATCACTAATAAAACTAAAGCTATTATGTGTGTCCATTTATACGGACATCCATGTGATATGGAACAAATTGTAGAACTGGCCAAAAGTAGAAATTTGTTTGTAATTGAAGATTGCGCTGAAGCCTTTGGTTCTA, as in SEQ Shown as ID NO.5.

[0034] The specific RPA primer pair consists of primer RPA-F and primer RPA-R, wherein the specific nucleotide sequence of primer RPA-F is shown in SEQ ID NO.1 and the specific nucleotide sequence of primer RPA-R is shown in SEQ ID NO.2.

[0035] When the nucleotide sequence of the target sequence is as shown in SEQ ID NO.5, the sequence of the target sequence-specific crRNA is crRNA-rfbE, wherein the nucleotide sequence of crRNA-rfbE is as shown in SEQ ID NO.3.

[0036] This invention utilizes a structural design to achieve a single-tube device that combines physical isolation with controlled mixing. The basket-style structure, as the core component, is not merely a simple partition, but a precision structure consisting of a storage tank and a fixed column. The movable fixed column's fit with the through-hole in the storage tank ensures an initial seal, guaranteeing absolute physical isolation between the upper and lower reagent layers—the foundation for avoiding false positives. A simple action of pressing the cap moves the fixed column downwards, creating a controllable gap (approximately 2mm) at the bottom of the storage tank. Subsequent mixing is achieved through gentle shaking or centrifugation. The anti-drop design prevents the fixed column from falling completely into the lower layer and contaminating the reaction system due to improper operation, greatly enhancing the device's reliability and user experience.

[0037] This invention's single-tube device cleverly utilizes the internal structure (difference in inner diameter between the top and bottom) of a standard 0.2mL PCR tube to fix a basket-type structure, achieving low cost and high compatibility. The double-ring cap design: the outer ring is responsible for sealing, while the inner ring is dedicated to driving and fixing the column, providing functional separation and intuitive operation.

[0038] The present invention provides a novel solution for "isolation followed by mixing" through mechanical action without the need for temperature changes.

[0039] Compared with the prior art, the present invention has the following beneficial effects:

[0040] This invention utilizes an innovative mechanical structure design for a single-tube device, allowing for fully closed-tube operation: from sample addition to final result interpretation, the entire process only requires sealing the tube cap after initial sample addition, followed by observation under a blue light lamp, without any intermediate steps of opening the cap. This fundamentally eliminates aerosol contamination and addresses a major source of false positives in molecular diagnostics.

[0041] One-step sample addition, two-step reaction: Users only need to assemble the device once (the lower layer is pre-loaded with the Cas12a system, and the upper layer is added with RPA solution). The connection between the two key steps of RPA amplification and CRISPR detection can be automatically triggered by simply "pressing the tube cap", which greatly simplifies the operation and reduces the technical requirements for operators.

[0042] Isothermal detection: The entire detection process (RPA amplification and Cas12a cleavage) is completed at a single temperature of 37°C, eliminating the need for temperature-controlled equipment, thus reducing equipment costs and energy consumption, making it particularly suitable for field environments. Reagents can be pre-prepared and stored in tubes at -20°C; the target can be added only when needed for detection, which can shorten the operation process to some extent.

[0043] The method described in this invention targets the detection of the rfbE gene in Escherichia coli O157:H7. It designs a specific RPA primer and crRNA sequence. This optimized system achieves ultra-high sensitivity (as low as 12 fg / μL) and rapid detection within 40 minutes. The results can be observed through a specific light system, eliminating the need for large-scale precision instruments. Compared with other tube-based detection methods, the single-tube detection operation of this invention is more accurate and convenient, and is more suitable for large-scale, high-throughput detection on-site.

[0044] When the target of detection changes, the detection method of this invention only requires changing the RPA primers and crRNA, and has strong universality for the detection of foodborne pathogens.

[0045] Chinese patent CN 117512215A discloses a kit for visually detecting 12 pathogens using a single tube of RPA-CRISPR / Cas12a. It uses paraffin phase change to achieve isolation / mixing. The paraffin method depends on temperature changes, which may affect enzyme activity. Moreover, it targets respiratory pathogens (such as the novel coronavirus) and does not involve foodborne pathogens or related sequences. Attached Figure Description

[0046] Figure 1 This is a schematic diagram of the structure of the tubular device of the present invention;

[0047] Figure 2 A schematic diagram comparing the results of different RPA primers at different intensities;

[0048] Figure 3 This is a schematic diagram comparing the detection results of different crRNAs;

[0049] Figure 4 A schematic diagram comparing different ssDNA detection results;

[0050] Figure 5 This is a flowchart of the CRISPR-Cas12a detection method in an embodiment of the present invention;

[0051] Figure 6 The results of the detection of the rfbE gene in Escherichia coli O157:H7 in this embodiment of the invention. Detailed Implementation

[0052] To further illustrate the effects and features of the present invention, the present invention will be further described in conjunction with the following drawings and specific embodiments, but the scope of protection of the present invention is not limited to the following embodiments.

[0053] The reagents, methods, and equipment used in this invention are conventional reagents in this technical field, and all materials are commercially available. RPA primers, crRNA, ssDNA, etc., were all synthesized at Sangon Biotech (Shanghai) Co., Ltd.

[0054] See Figure 1 A tubular device for the method, comprising:

[0055] Outer tube 1, with a reaction cavity formed inside it;

[0056] The basket-type structure 2 is set inside the reaction cavity of the outer tube and divides the reaction cavity into an upper reaction chamber and a lower reaction chamber that are physically isolated from each other.

[0057] Pipe cap 3 is used to seal the outer pipe;

[0058] The basket-type structure 2 includes a liquid storage tank 21 and a fixing column 22. The bottom of the liquid storage tank is provided with a through hole. The fixing column 22 is movably disposed in the through hole of the liquid storage tank 21, and its bottom is provided with a blocking part 23 to prevent it from falling out of the through hole.

[0059] The tube cap 3 is connected to the top of the fixed column 22. By pressing or rotating the tube cap, the fixed column 22 can be driven to move downward in the through hole of the liquid storage tank 23, thereby forming a gap between the fixed column 22 and the liquid storage tank 23 for liquid to flow.

[0060] Preferably, the basket-type structure 2 is 3D printed, the bottom diameter of the fixing column is larger than that of the upper layer, and it can be fixed to the through hole of the liquid storage tank to form a sealed state, so as not to leak the upper reaction solution. There is a 2mm wide anti-fall railing at the bottom of the liquid storage tank.

[0061] Preferably, the outer tube is a 0.2 mL PCR tube, and the difference in the inner diameter of the upper and lower parts of the outer tube is used to fix the basket-type device.

[0062] Preferably, the tube cap 3 consists of two parts: an inner ring 31 and an outer ring 32. The outer ring is used to seal the reaction vessel, and the inner ring fits into the fixed column.

[0063] 1. Design and synthesis of RPA primers, crRNA, and ssDNA for target sequences.

[0064] The specific gene rfbE (GenBank: S83460) of Escherichia coli O157:H7 was retrieved from the National Center for Biotechnology Information (NCBI) database. Multiple alignment of the genome sequence confirmed the specificity of the sequence. RPA primers were designed for the specific sequence of E. coli O157:H7 using Primer 5 software, and the recognition region of crRNA (PAM sequence is TTTN, N is any one of A / T / G / C bases) was screened within the sequence.

[0065] 1.1 Study on the applicability of RPA primers

[0066] Four sets of primers were designed targeting the rfbE gene specific to *E. coli* O157:H7, and each set was used for RPA amplification. The RPA premix was added to enzyme powder tubes, and 2-2.5 μL of MgOAC was added to each tube, for a total of 50 μL per RPA reaction tube. The tubes were inverted and mixed thoroughly, then incubated at 35-42℃ for 12-15 min to obtain the RPA amplification products. The RPA premix consisted of: 28.5-30.5 μL of Primer-Free Rehydration Buffer, 2-2.5 μL each of 10 μM RPA forward and reverse primers, 7-13 μL of ddH2O, and 2-5 μL of target DNA. A target-free RPA amplification control group was also included for each primer set.

[0067] Take 5 μL of the corresponding RPA products amplified with different primers, add 2 μL of 6× loading buffer, mix well, and then perform electrophoresis on a 2% agarose gel. See the results below. Figure 2 The band of RPA-4 primer was brighter than that of other primers, indicating that the primer had a better amplification effect.

[0068] The RPA-4 primer sequences are shown below:

[0069] RPA-F: 5'-AAACCATGTGCAATATGCAACTACTGTAAG-3' (SEQ ID NO: 1);

[0070] RPA-R: 5'-TAGAACCAAAGGCTTCAGCGCAATCTTCAA-3' (SEQ ID NO: 2);

[0071] 1.2 Applicability Study of crRNA

[0072] Based on the selected RPA primer sequences, crRNA was designed using the PAM sequence (PAM sequence is TTTN, N is any one of A / T / G / C bases), resulting in three groups of crRNAs. 2 μL each of the RPA-4 primer amplification product and the blank control group were added to a CRISPR-Cas12a digestion system containing different crRNAs and incubated at 37°C for 15-20 min. The CRISPR-Cas12a digestion system consisted of: 1-3 μL buffer, 0.5-1.5 pmol Cas12a enzyme, 15 U-40 U RNase inhibitor, 100-500 nM ssDNA, 100-500 nM crRNA, and DEPC water to a final volume of 18 μL.

[0073] After incubation, 20 μL of the Cas12a digestion product was added to 180 μL of ddH2O and transferred to a 96-well plate. The fluorescence intensity was measured using a microplate reader at specific excitation and absorption wavelengths. See results below. Figure 3 The fluorescence intensity of the crRNA1 group was higher than that of other groups, indicating that the recognition efficiency of this crRNA is higher. N1 is the result of adding crRNA1 and RPA without target in the CRISPR-Cas12a system, N2 is the result of adding crRNA2 and RPA without target in the CRISPR-Cas12a system, and N3 is the result of adding crRNA3 and RPA without target in the CRISPR-Cas12a system.

[0074] The crRNA1 sequence is shown below:

[0075] crRNA-rfbE: AAUUUCUACUGUUGUAGAUUAGCAUUAACUGAUG CUAUAUAU (SEQ ID NO: 3);

[0076] 1.3 Applicability Study of ssDNA

[0077] Four sets of ssDNA of different lengths were designed for the CRISPR-Cas12a digestion system, as described above with the RPA product and CRISPR-Cas12a digestion system. The four sets of designed ssDNA of different lengths were added to the CRISPR-Cas12a digestion system for digestion. The digestion efficiency of each set was observed by qPCR. The results are shown in [link to results]. Figure 4 HEX-12NT-BHQ1 showed higher efficiency than other groups, indicating that this length of ssDNA was cleaved more efficiently.

[0078] The ssDNA sequences obtained through screening are shown below.

[0079] ssDNA: 5'-HEX-TTTTTTTTTTTT-BHQ1-3' (SEQ ID NO: 4).

[0080] See Figure 5

[0081] Example 1: A method for detecting the rfbE gene of Escherichia coli O157:H7 using a single-tube device based on the Cas12a system, comprising the following steps:

[0082] 1. Design and synthesis of RPA primers, crRNA, and ssDNA for target sequences.

[0083] Specific RPA primers and crRNA were obtained through specific gene screening targeting foodborne pathogens, and corresponding ssDNA was obtained through screening against the CRISPR-Cas12a system. The sequences are shown below:

[0084] RPA-F: SEQ ID NO:1;

[0085] RPA-R: SEQ ID NO:2;

[0086] crRNA-rfbE: SEQ ID NO:3;

[0087] ssDNA: SEQ ID NO:4;

[0088] 2. Configure the RPA and CRISPR-Cas12a system and assemble a tubular device.

[0089] The RPA nucleic acid amplification system added to the upper reaction chamber is 15 μL, which includes: 10-12 μL of RPA enzyme solution containing Primer-Free Rehydration buffer and ddH2O, 0.5-1 μL each of 10 μM RPA forward and reverse primers, 0.5-1 μL of 280 nM MgOAC, and 0.5-1 μL of target DNA at different concentrations, wherein the target DNA concentrations are 4.8 × 10⁻⁶. 6 4.8×10 5 4.8×10 4 4.8×10 3 4.8×10 2 The concentrations were 4.8×10, 4.8×5, 4.8×2.5 and 4.8 fg / μL, with the control group not containing target DNA.

[0090] The CRISPR-Cas12a digestion system consists of 50 nM LbCpf1 (Cas12) endonuclease, 10 U RNA inhibitor, 500 nM crRNA, 500 nM ssDNA, 2 μL NE buffer, and DEPC water to a final volume of 25 μL.

[0091] The configured CRISPR-Cas12a system was placed in the lower reaction chamber of a tube-type device and centrifuged to avoid residual droplets on the tube wall. The basket-type structure was installed into the outer tube and fixed. The prepared RPA solution was added to the upper reaction chamber, the tube cap was closed, and the reaction cavity of the outer tube was kept in a sealed state, so that the upper and lower reaction chambers formed independent spaces.

[0092] 3. RPA amplification and Cas12a enzyme-mediated trans cleavage reaction

[0093] The target-added tube device was placed in a constant temperature amplification at 37°C for 15 min. After the RPA reaction was completed, the tube cap was pressed down to move the fixed column, creating a gap between the upper and lower layers. The upper RPA product was gently shaken or centrifuged to allow it to flow into the lower CRISPR-Cas12a system and incubated at 37°C for 25 min.

[0094] 4. Analysis of test results

[0095] The results were observed using a blue light lamp and a filter. Figure 6 As shown.

[0096] from Figure 6 It can be seen that the detection sensitivity of the rfbE gene of Escherichia coli O157:H7 using the method described in this invention is as low as 12 fg / μL.

[0097] This invention utilizes a single-tube device to independently perform the RPA reaction and CRISPR-Cas12a enzyme digestion reaction. Based on the Cas12a-mediated target-specific recognition and trans-cleavage activity principle, the detection results are characterized. The experiment can be completed with only one opening of the tube, effectively avoiding false positives caused by aerosol contamination due to frequent opening. This detection method requires no other instruments besides a constant-temperature metal bath. Under certain circumstances, the reaction temperature can be provided by the human body, and fluorescence results can be visualized with the naked eye using a handheld blue light lamp and filter at a specific wavelength (440-485nm). Due to its portability and operability, this method can be applied to on-site, real-time detection. Furthermore, by designing RPA primers and corresponding crRNAs for other pathogenic microorganisms, it can meet the detection needs of various pathogenic microorganisms, contributing to the microbial monitoring of food products in the market and supporting food safety supervision.

Claims

1. A method for detecting foodborne pathogenic microorganisms using a single-tube device based on the Cas12a system, characterized in that, Includes the following steps: Specific RPA primers and crRNA were obtained by screening specific genes of foodborne pathogens, and corresponding ssDNA was obtained by screening the CRISPR-Cas12a system. The ssDNA is a single-stranded DNA molecule composed of 6-20 A / T / C / G bases, and the ssDNA fragment is labeled with the fluorescent group HEX at the 5' end and the quenching group BHQ1 at the 3' end. The tubular device includes: an outer tube, which forms a reaction cavity inside; a basket-like structure disposed inside the reaction cavity of the outer tube, the basket-like structure dividing the reaction cavity into an upper reaction chamber and a lower reaction chamber that are physically isolated from each other; and a tube cover for sealing the outer tube. The CRISPR-Cas12a system was placed in the lower reaction chamber of a tube-type device and centrifuged to avoid residual droplets on the tube wall. The basket-type structure was installed into the outer tube and fixed. The prepared RPA solution was added to the upper reaction chamber, and the tube cap was put on to keep the reaction cavity of the outer tube in a sealed state. The upper and lower reaction chambers formed independent spaces. The CRISPR-Cas12a system includes specific crRNA, Cas12a enzyme, and ssDNA; The RPA solution includes RPA primers specifically designed for foodborne pathogens, RPA enzyme solution, and DNA from the sample to be tested. After the RPA solution in the upper reaction chamber has finished reacting, press down the tube cap to adjust the basket structure, creating a gap between the upper and lower layers. Gently shake or centrifuge to allow the RPA solution that has finished reacting in the upper reaction chamber to flow into the CRISPR-Cas12a system in the lower reaction chamber for incubation. After incubation, observe the fluorescence results by irradiating with a blue light. If target DNA is present, the Cas12a enzyme and specific crRNA can recognize and specifically bind to the target DNA to form a complex, thereby activating the trans-cleavage activity of Cas12a. The ssDNA is cleaved, releasing a fluorescent group, and a significant fluorescent signal can be observed. If target DNA is not present, the Cas12a enzyme and specific crRNA cannot bind to the target to form a complex, and the trans-cleavage activity of Cas12a cannot be activated. The ssDNA structure remains intact, and no fluorescent group is released, i.e., there is no significant fluorescent signal.

2. The method for detecting foodborne pathogens using a single-tube device based on the Cas12a system as described in claim 1, characterized in that, The RPA solution added to the upper reaction chamber is 15 μL, which includes: 10-12 μL of RPA enzyme solution containing Primer Free Rehydration buffer and ddH2O, 0.5-1 μL each of 10 μM specific RPA upstream and downstream primers, 0.5-1 μL of 280 nM MgOAC, and 0.5-1 μL of DNA from the sample to be tested.

3. The method for detecting foodborne pathogens using a single-tube device based on the Cas12a system as described in claim 1, characterized in that, The CRISPR-Cas12a system added to the lower reaction chamber is 25 μL, which includes: 50 nM bCpf1 (Cas12) endonuclease, 10 U RNA inhibitor, 500 nM crRNA, 500 nM ssDNA, 2 μL NE buffer, and the remainder is DEPC water.

4. The method for detecting foodborne pathogens using a single-tube device based on the Cas12a system as described in claim 1, characterized in that, The ssDNA sequence is shown in SEQ ID NO:

4.

5. The method for detecting foodborne pathogenic microorganisms using a single-tube device based on the Cas12a system as described in any one of claims 1 to 4, characterized in that, The foodborne pathogen is the rbfE gene of Escherichia coli O157:H7.

6. The method for detecting foodborne pathogens using a single-tube device based on the Cas12a system as described in claim 5, characterized in that, The specific RPA primer F sequence for the rbfE gene of Escherichia coli O157:H7 is shown in SEQ ID NO:1; The specific RPA primer R sequence is shown in SEQ ID NO:

2.

7. The method for detecting foodborne pathogens using a single-tube device based on the Cas12a system as described in claim 5, characterized in that, The crRNA sequence of the rbfE gene targeting Escherichia coli O157:H7 is shown in SEQ ID NO:

3.

8. A tubular device for use in the method according to any one of claims 1 to 7, characterized in that, It includes: The outer tube has a reaction cavity formed inside it; A basket-type structure is set inside the reaction cavity of the outer tube, and the reaction cavity is divided into an upper reaction chamber and a lower reaction chamber that are physically isolated from each other; A cap is used to seal the outer tube; The basket-type structure includes a liquid storage tank and a fixing column. The bottom of the liquid storage tank is provided with a through hole, and the fixing column is movably disposed in the through hole of the liquid storage tank. The bottom of the fixing column is provided with a blocking part to prevent it from falling out of the through hole. The cap is connected to the top of the fixed column. By pressing or rotating the cap, the fixed column can be driven to move downward in the through hole of the liquid storage tank, thereby forming a gap between the fixed column and the liquid storage tank for liquid flow.

9. The tubular device as described in claim 7, characterized in that, The outer tube is a 0.2mL PCR tube; preferably, the basket-type structure is 3D printed, the bottom diameter of the fixing column is larger than that of the upper layer, and it can be fixed to the through hole of the storage tank to form a sealed state and prevent leakage of the upper reaction solution. The bottom of the storage tank is provided with a 2mm wide anti-drop rail.

10. The tubular device as described in claim 7, characterized in that, The tube cap consists of two parts: an inner ring and an outer ring. The outer ring is used to seal the reaction vessel, and the inner ring fits into the fixed column.

Images