Application of molecular markers related to growth performance of finishing pigs, reproductive performance of lactating sows, and pork flavor

By developing molecular markers related to L-valine content in the longissimus dorsi muscle of pigs and using genotyping at specific SNP sites, the problems of high breeding costs and slow genetic progress have been solved, resulting in improved pork flavor and growth performance. This has significant economic and scientific research value.

CN120843693BActive Publication Date: 2026-01-30INSTITUTE OF ANIMAL SCIENCES OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511059625.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-07-30
Publication Date
2026-01-30
Estimated Expiration
2045-07-30

AI Technical Summary

Technical Problem

The lack of molecular markers related to L-valine content in pork in existing technologies leads to high breeding costs and slow genetic progress in pigs, making it difficult to effectively improve the growth performance of fattening pigs, the reproductive performance of lactating sows, and the flavor of pork.

Method used

Molecular markers associated with L-valine content in the longissimus dorsi muscle of pigs were developed. By detecting the genotype of specific SNP sites, PCR amplification and genotype analysis were used to identify or assist in the identification of pork flavor and growth performance. GG genotype pigs were selected as parents for breeding.

Benefits of technology

By selecting superior genotypes early on, the growth performance of fattening pigs, the reproductive performance of lactating sows, and the quality of pork can be significantly improved, breeding costs can be saved, genetic progress can be accelerated, and the flavor and taste of pork can be enhanced.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120843693B_ABST
    Figure CN120843693B_ABST
Patent Text Reader

Abstract

This invention relates to the application of molecular markers related to the growth performance of finishing pigs, the reproductive performance of lactating sows, and the flavor of pork. The molecular markers are related to the L-valine content in the longissimus dorsi muscle of pigs. This invention discloses a method for identifying the growth performance of finishing pigs, the reproductive performance of lactating sows, and the flavor of pork, as well as a breeding method for selecting pigs with better growth performance in finishing pigs, reproductive performance in lactating sows, and superior meat flavor. This method determines the genotype of the pig by detecting the nucleotide position 72599544 on chromosome 1 of the pig reference genome Sscrofa11.1, GCF_000003025.6. The L-valine content in the longissimus dorsi muscle of pigs with the GG genotype at this locus is higher than that of pigs with the TG genotype, and the TG genotype pigs have a higher content than the TT genotype pigs. In practical breeding work, pigs with the genotype GG at locus 72599544 can be selected as parents for breeding, which is of great significance for selecting pigs with better growth performance in fattening pigs, better reproductive performance in lactating sows, and better pork flavor.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a molecular marker and its application related to the growth performance of finishing pigs, the reproductive performance of lactating sows, and the flavor of pork. The molecular marker is related to the L-valine content in the longissimus dorsi muscle of pigs. Background Technology

[0002] With the improvement of living standards, people have increasingly higher requirements for meat quality. Pork is the most consumed meat in my country, and its quality is one of the key factors affecting market competitiveness and economic benefits. Meat quality evaluation is multifaceted, including its sensory quality and nutritional value. Among these factors, hydrophilic metabolites, as flavor precursors or direct flavor components, make significant contributions to the umami, sweetness, sourness, and overall flavor harmony of meat products.

[0003] In the swine industry, pig growth performance and meat quality are key factors influencing market competitiveness and economic benefits. L-valine levels affect the growth performance of piglets and finishing pigs, as well as the reproductive performance of lactating sows. Furthermore, as a crucial precursor to meat flavor, its level significantly impacts flavor, tenderness, and nutritional value. During heating, it reacts with sugars to generate volatile aldehydes, ketones, pyrazines, and other flavor molecules, enhancing the aroma of the meat. Moreover, L-valine can influence related metabolic pathways, regulate muscle cell activity, promote protein accumulation, and improve palatability. Currently, marker-assisted breeding technology is widely used in the development of new breeds in the livestock and poultry sector, and genome-wide association studies can identify molecular markers closely related to target traits. Early selection of target traits using molecular markers can significantly reduce breeding costs and accelerate genetic progress. However, currently, there are no molecular markers associated with L-valine content in pork. Therefore, developing a molecular marker directly related to the L-valine content in pig muscle can not only provide a new tool for molecular breeding of pigs, but also provide a theoretical basis for the genetic improvement of meat quality traits, and has important industrial application value. Summary of the Invention

[0004] The purpose of this invention is to provide the application of molecular markers related to the growth performance of finishing pigs, the reproductive performance of lactating sows, and the flavor of pork, wherein the molecular markers are related to the L-valine content in the longissimus dorsi muscle of pigs;

[0005] Another object of the present invention is to provide a method for identifying or assisting in the identification of growth performance of finishing pigs, reproductive performance of lactating sows, and pork flavor;

[0006] Another objective of this invention is to provide a breeding method for pigs with better growth performance in fattening pigs, better reproductive performance in lactating sows, and better pork flavor.

[0007] This invention is implemented as follows:

[0008] The application of molecular markers related to growth performance of finishing pigs, reproductive performance of lactating sows, and pork flavor, wherein the application is any one of the following A1) to A8):

[0009] A1) Detection or auxiliary detection of pork flavor;

[0010] A2) Identification and auxiliary identification of pork flavor;

[0011] A3) Pig breeding;

[0012] A4) Detection or auxiliary detection of SNP polymorphisms or genotypes;

[0013] A5) Prepare products for detecting or assisting in the detection of pork flavor;

[0014] A6) Prepare products for identification and auxiliary identification of pork flavor;

[0015] A7) Preparation of pig breeding products;

[0016] A8) Prepare products for detecting or assisting in the detection of SNP polymorphisms or genotypes;

[0017] The molecular marker corresponds to nucleotide position 72599544 on chromosome 1 of the pig reference genome Sscrofa11.1, GCF_000003025.6, as shown in sequence SEQ ID NO:1, the nucleotide at the 62 bp of the DNA molecule, the nucleotide type is T or G, and the genotype of this site is related to the L-valine content in the longissimus dorsi muscle of pigs.

[0018] A method for identifying or assisting in the identification of growth performance of finishing pigs, reproductive performance of lactating sows, and pork flavor includes the following steps:

[0019] S1 extracts genomic DNA from the pigs to be tested as a template;

[0020] S2 designed primers targeting the 262 bp site of the DNA molecule shown in SEQ ID NO.1 for PCR amplification;

[0021] S3 detects the genotype at the 62 bp site of the pig sequence SEQ ID NO.1;

[0022] S4 uses the genotypes obtained in step S3 to identify or assist in identifying the pork flavor of the pigs being tested. Pigs with the GG genotype have a higher L-valine content in the longissimus dorsi muscle than pigs with the TG genotype, resulting in better growth performance in fattening pigs, better reproductive performance in lactating sows, and better pork flavor. Similarly, pigs with the TG genotype have a higher L-valine content in the longissimus dorsi muscle than pigs with the TT genotype, resulting in better growth performance in fattening pigs, better reproductive performance in lactating sows, and better pork flavor.

[0023] Preferably, the sequences of the primers described in step S2 are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0024] A breeding method for selecting pigs with better growth performance in fattening pigs, better reproductive performance in lactating sows, and better pork flavor involves identifying the genotype of the pigs to be tested according to the aforementioned method, and selecting the pigs with the GG genotype as parents for breeding. The GG genotype is a homozygous type where the 62nd bp of the SEQ ID NO.1 sequence is G.

[0025] The aforementioned application of molecular markers related to the growth performance of finishing pigs, the reproductive performance of lactating sows, and the flavor of pork, wherein the pork flavor refers to the taste and aroma of pork, and the product is a reagent kit.

[0026] The beneficial effects of this invention are as follows: The SNP molecular marker of this invention is related to the L-valine content trait in the longissimus dorsi muscle of pigs. It is a new molecular marker. By determining the genotype of the SNP locus in the pig to be tested, the L-valine content trait in the longissimus dorsi muscle of pigs can be selected at an early stage, which can save production costs, improve the growth performance of fattening pigs, the reproductive performance of lactating sows, and the quality and flavor of pork, and accelerate genetic progress, thus better serving pig breeding. It has great economic application value and scientific research value. Attached Figure Description

[0027] Figure 1 This is a graph showing the results of the genome-wide association analysis in Example 1. Detailed Implementation

[0028] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0029] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0030] The following examples used GraphPad Prism 8 statistical software to process the data. The experimental results are expressed as mean ± standard deviation. One-way ANOVA was used, and P < 0.05 (*) indicates a significant difference.

[0031] Example 1: Determination of the correlation between specific SNPs and L-valine content in the longissimus dorsi muscle.

[0032] Experimental animals: Landrace pigs, Large White pigs, and crossbred pigs, all of which were sourced from COFCO Jiajiakang (Chifeng) Co., Ltd.

[0033] I. Determination of L-valine content in the longissimus dorsi muscle

[0034] Under the same feeding conditions, the pigs were fed for 180 days. 521 healthy pigs were randomly selected, and 10g samples of their longissimus dorsi muscle were collected and frozen in liquid nitrogen.

[0035] Sample pretreatment: Take uniform samples, grind and mix the muscle tissue, and accurately weigh approximately 40 mg of sample (place a certain amount of sample in a mortar, add liquid nitrogen before weighing to prevent sample degradation) into a 2 mL centrifuge tube. Add 300 μL of methanol, then add a 5 mm steel bead. Homogenize the muscle tissue using a homogenizer (60 Hz, 60 s). Remove the steel bead with a magnet, add 1 mL of MTBE, vortex for 1 min, then add 250 μL of water to separate the layers and let stand for 5 min. After thorough extraction, centrifuge at 4℃ for 5 min at 5000 rpm. Take 250 μL of the lower layer and resuspend it. Reconstitute the lower layer with 200 μL of 80% methanol-water solution and analyze.

[0036] Instruments and equipment: autosampler, liquid chromatograph, mass spectrometer, liquid chromatography column (ACQUITY UPLC HSS T3 Column, 2.1mm×100mm, Waters).

[0037] Preparation of mobile phase: Mobile phase A: Dissolve 0.315 g ammonium formate in 1000 mL of deionized water (5% ammonium formate); Mobile phase B: Dissolve 0.315 g ammonium formate in 20 mL of deionized water, and then add 980 mL of acetonitrile (5% ammonium formate);

[0038] Table 1. Mobile phase gradient settings

[0039] Step Time (min) Flow rate (mL / min) %A %B 0 0 0.35 98 2 1 2 0.35 98 2 2 14 0.35 2 98 3 17 0.35 2 98 4 17 0.35 98 2 5 20 0.35 98 2

[0040] Table 2. Mass Spectrometer Parameter Settings

[0041]

[0042] II. Detection of SNP molecular markers

[0043] 1. Blood sample collection: Collect venous blood from the wing vein of the pig to be tested using heparin sodium anticoagulant blood collection tubes and store at -20℃ for later use.

[0044] 2. Whole blood genomic DNA extraction: Refer to the instructions for the blood genomic DNA extraction kit (Tiangen, DP319) for specific procedures.

[0045] 3. Genotyping: Genomic DNA was collected from each pig and whole-genome sequencing was performed on the Illumina HiSeq X-Ten sequencing platform. The sequencing depth for each individual was approximately 5×. The specific method followed the standard operating procedure provided by Illumina. After quality control, the data were sequenced and genotypes extracted using two bioinformatics software programs: BWA and GATK.

[0046] III. Genome-wide association analysis of L-valine in the longissimus dorsi muscle

[0047] Genome-wide association analysis of L-valine and genotype in the longissimus dorsi muscle was performed using a compressed mixed linear model in EMMAX software. The results of the association analysis are shown in the figure below. Figure 1 The horizontal axis represents chromosome number, and the vertical axis represents -log. 10 (P).

[0048] A SNP significantly associated with the L-valine trait was discovered at nucleotide 72,599,544 on chromosome 1. This SNP was named "Chr6:72599544 SNP," which corresponds to nucleotide 72,599,544 on chromosome 1 of the porcine genome (Sscrofa11.1, GCF_000003025.6) (corresponding to nucleotide 62 in SEQ ID NO:1). Multiple nucleotide types of this SNP are T / G. For simplicity, it will be referred to hereafter as a specific SNP.

[0049] A pair of primers, consisting of F and R, was designed based on a specific SNP. The target sequence of F and R in the pig genomic DNA is 217 bp, and the specific SNP is located at the 62nd nucleotide of the target sequence.

[0050] F (SEQ ID NO:2): 5'-GTGTGTGTATGTGCACTGAGAA-3';

[0051] R (SEQ ID NO: 3): 5'-TTCATCGAGATGAGATGATG-3'.

[0052] Therefore, the genotype of the pig to be tested can be defined according to the following rules:

[0053] GG genotype: If the PCR product obtained by amplifying the genomic DNA of the pig to be tested using upstream primer F and downstream primer R contains only a DNA fragment with the nucleotide sequence of SEQ ID NO:1 and the 62nd nucleotide of SEQ ID NO:1 being G, and does not contain a DNA fragment with the nucleotide sequence of SEQ ID NO:1 and the 62nd nucleotide of SEQ ID NO:1 being T, then the aforementioned SNP genotype of the pig to be tested is GG.

[0054] TT genotype: If the PCR product obtained by amplifying the genomic DNA of the pig to be tested using upstream primer F and downstream primer R does not contain a DNA fragment with the nucleotide sequence of SEQ ID NO:1 and the 62nd nucleotide of SEQ ID NO:1 being G, and only contains a DNA fragment with the nucleotide sequence of SEQ ID NO:1 and the 62nd nucleotide of SEQ ID NO:1 being T, then the aforementioned SNP genotype of the pig to be tested is TT.

[0055] TG genotype: If the PCR product obtained by amplifying the genomic DNA of the pig to be tested using upstream primer F and downstream primer R contains both a DNA fragment with the nucleotide sequence of SEQ ID NO:1 and the 62nd nucleotide of SEQ ID NO:1 being T, and a DNA fragment with the nucleotide sequence of SEQ ID NO:1 and the 62nd nucleotide of SEQ ID NO:1 being G, then the aforementioned SNP genotype of the pig to be tested is TG.

[0056] Example 2: Application of specific SNPs in the genetic improvement of L-valine content trait in the longissimus dorsi muscle of pigs

[0057] Experimental animals: 493 Landrace pigs, Large White pigs, and crossbred pigs, sourced from COFCO Jiajiakang (Chifeng) Co., Ltd.

[0058] I. Detection of genotypes based on specific SNP loci

[0059] 1. Blood sample collection

[0060] Blood from the wing veins of experimental animals was collected using heparin sodium anticoagulant blood collection tubes and stored at -20°C for later use.

[0061] 2. Extract genomic DNA

[0062] Take the venous blood obtained in step 1 and extract genomic DNA.

[0063] 3. Genotyping

[0064] Using the genomic DNA obtained in step 2 as a template, PCR amplification was performed using primers consisting of F and R, and then the PCR amplification products were sequenced.

[0065] The results showed that PCR amplification products of 217 bp were obtained from all 493 experimental animals.

[0066] Based on specific SNPs, the 493 experimental animals were divided into three genotypes: GG genotype (196 experimental animals), TG genotype (230 experimental animals), and TT genotype (67 experimental animals).

[0067] II. Determination of L-valine content in the longissimus dorsi muscle

[0068] The liquid chromatography-mass spectrometry conditions are shown in Tables 1 and 2. The results in Table 3 show that the relative L-valine content of the three pig genotypes differed significantly (P < 0.001). The relative L-valine content of the tested pigs with genotype GG was higher than that of the tested pigs with genotype TG (P < 0.001) and genotype TT (P < 0.001), and the relative L-valine content of the tested pigs with genotype TG was higher than that of the tested pigs with genotype TT.

[0069] Table 3. Relative L-valine content in experimental animals of different genotypes

[0070]

[0071] Table 4. Genotypes and relative L-valine content of 493 pigs tested.

[0072]

[0073]

[0074]

[0075]

[0076]

[0077]

[0078]

[0079]

[0080]

[0081]

[0082]

[0083]

[0084] SEQ ID NO:1

[0085] 5'-GTGTGTGTATGTGCACTGAGAAAATCATCTTTATAGCGGTTATCTCCAGGTGTGGCATGATRGGGATTTGAATTTCCAATTTGTTTCCGTGGAGTTTTTTTCTTCCAGTTTTTATTGAGATAATTGACATACAGCACAGCATCACGACTTACTTAGGTTACAAAATGATTACCACAATAAGTTTAGATCATGTCCATCATCTCATCTCGATGAA-3'.

[0086] R is either T or G.

[0087] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. Use of a product for detecting or aiding in the detection of a molecular marker associated with the L-valine content in the longissimus dorsi muscle of a fattening pig, characterized in that, The molecular marker is shown in sequence SEQ ID NO:1, the nucleotide at position 62 of the DNA molecule, which is T or G, corresponding to the nucleotide at position 72599544 on chromosome 1 of the pig reference genome Sscrofa11.1, GCF_000003025.6, and the genotype of the site is related to the L-valine content in the longissimus dorsi muscle of the pig.

2. Use of a product according to claim 1 for the detection or aid in the detection of a molecular marker associated with the content of L-valine in the longissimus dorsi muscle of a fattening pig, characterized in that, The product is a kit.

3. A method of identifying or aiding in the identification of L-valine content in the longissimus dorsi muscle of a finishing swine, characterized by, The method comprises the following steps: S1. extracting the genomic DNA of the pig to be tested as a template; S2. designing primers for the site at position 62 of the DNA molecule shown in sequence SEQ ID NO.1, and performing PCR amplification; S3. detecting the genotype of the pig to be tested at position 62 of sequence SEQ ID NO.1; S4. identifying or assisting in identifying the genotype obtained in step S3, and the L-valine content in the longissimus dorsi muscle of a pig individual with GG genotype is higher than that of a pig individual with TG genotype, and the L-valine content in the longissimus dorsi muscle of a pig individual with TG genotype is higher than that of a pig individual with TT genotype. The sequence of the primers in step S2 is shown in SEQ ID NO.2 and SEQ ID NO.

3.

4. The method of claim 3, wherein, The method according to claim 3 or 4 is used to identify the genotype of the pig to be tested, and the pig to be tested with GG genotype is selected as the parent for breeding, and the GG genotype is the homozygous type of G at position 62 of sequence SEQ ID NO.

1.

5. A breeding method for breeding a fattening pig having a high L-valine content in longissimus dorsi, characterized by, ​

Citation Information

Patent Citations

  • Use single nucleotide polymorphsm in the coding region of the porcine leptin receptor gene to enhance pork production

    CA2533500A1

  • Genetic marker for determining meat quality traits of pigs and use thereof

    CA2984938A1