A sex-specific molecular marker for kelp and its application

By designing specific primers Sj-SexI-F and Sj-SexI-R for the sex determination region of kelp, the problems of accuracy and universality in the sex identification of kelp gametophytes in the existing technology have been solved, realizing efficient and accurate sex identification and cross-species application, and improving the efficiency of kelp germplasm bank management and research.

CN120843718BActive Publication Date: 2026-05-05QINGDAO AGRI UNIV +1
View PDF 3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
QINGDAO AGRI UNIV
Filing Date
2025-07-04
Publication Date
2026-05-05

AI Technical Summary

Technical Problem

Existing techniques for sex identification of kelp gametophytes suffer from low accuracy, low efficiency, and lack of cross-species applicability. In particular, male and female gametophytes are prone to contamination during separation and preservation. Furthermore, existing markers may induce non-specific amplification, affecting the accuracy and reliability of experimental results.

Method used

A pair of specific primers, Sj-SexI-F and Sj-SexI-R, for the sex determination region of kelp were designed for rapid identification of kelp sex. By detecting DNA fragments with a male marker of 391 bp and a female marker of 670 bp, they are suitable for sex identification of mixed male and female samples and cross-species samples.

Benefits of technology

It has achieved efficient and accurate identification of the sex of kelp, can distinguish between kelp sporophytes from parthenogenesis and sexual reproduction, and is universal in multiple species, thus improving the efficiency of germplasm bank management and research utilization.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120843718B_ABST
    Figure CN120843718B_ABST
Patent Text Reader

Abstract

This invention provides a sex-specific molecular marker for kelp and its application, wherein the nucleotide sequence of the male marker fragment is SEQ ID NO:1, and the nucleotide sequence of the female marker fragment is SEQ ID NO:2. The gene sequence fragments obtained by this invention are derived from conserved homologous genes in the sex-determining regions of brown algae. The primer sequences for the selected sex identification markers are derived from the regions with the highest similarity in the coding sequences of the homologous genes. This method enables rapid identification of the sex of kelp gametophytes using only a pair of degenerate primers, offering high efficiency, high accuracy, and high interspecies compatibility. This method is applicable to the identification of mixed male and female samples, the differentiation of kelp sporophytes from parthenogenesis and sexual reproduction, and the sex identification of gametophytes in other species of the Laminariales order, providing important support for the efficient management and research utilization of kelp gametophyte germplasm banks.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of algal genetic breeding technology, specifically relating to a sex-specific molecular marker for kelp and its application. Background Technology

[0002] kelp( Saccharina japonica Kelp is an important economic seaweed, widely used in food, medicine and industry. The life cycle of kelp is complex, including two main stages: sporophyte and gametophyte, which is a typical heteromorphic alternation of generations. Kelp has a UV-type sex determination system, and there are male and female differences in the haploid gametophyte stage. Kelp gametophyte cloning technology allows kelp gametophytes to be preserved in vivo for a long time. Therefore, kelp gametophyte cloning is the object of kelp germplasm resource preservation, and it is also an important research object for carrying out research on gametophyte sex differentiation, development and genetic breeding. In the process of kelp gametophyte cloning preservation and utilization, the following problems are often encountered: (1) The separation of kelp female and male gametophytes mainly relies on morphological observation. Since the morphological differences between male and female gametophytes are not significant, and more and more studies have shown that some genetically inherited male gametophytes also have female gametophyte phenotypes and reproductive characteristics, it is inaccurate to rely on morphology to identify male and female gametophytes; (2) In the process of separating and preserving male and female gametophytes in kelp, it is inevitable that male and female gametophytes will be mixed, so it is necessary to establish corresponding identification methods to ensure that the gametophyte germplasm preserved in the germplasm bank is pure female or pure male; (3) Gametophytes can develop into sporophytes through both asexual and sexual reproduction, so it is necessary to distinguish the reproductive mode of sporophyte formation in the study of gametophyte reproduction and development; (4) In addition to the kelp germplasm bank, S. japonica Besides this species, it also preserves gametophyte germplasm from several other species in the order Laminariaceae of the phylum Phaeophyta, which also require corresponding identification methods or universal sex identification methods suitable for multiple species.

[0003] Currently, there are various methods for sex identification of kelp gametophytes. For example, Chinese invention patent CN108034742A has developed specific markers for female and male kelp gametophytes, which can clearly identify whether kelp gametophytes are purely female, purely male, or mixed. It can also be used for sex identification of the parental origin and offspring of parthenogenetic kelp sporophytes. Chinese invention patent CN106834469A discloses a specific molecular marker for male kelp gametophytes, which can rapidly and effectively identify the sex of male kelp gametophytes and can also be used to identify parthenogenetic sporophytes. Chinese invention patent CN112760410A discloses the FSMSJ-1294 specific molecular marker for female kelp gametophytes, which can be used for sex identification of the parental origin and offspring of parthenogenetic kelp sporophytes.

[0004] Existing research on sex identification of kelp gametophytes has certain limitations. While CN106834469A can achieve specific amplification in male kelp gametophytes, it cannot accurately identify them when female gametophytes are mixed in with the male gametophytes. Similarly, CN112760410A has the same problem. Furthermore, the applicant's use of the markers disclosed in this patent to identify the sex of multiple preserved kelp species revealed that the markers do not possess broad specificity. Additionally, the female-specific marker in CN108034742A is designed on introns, a design that may cause the marker to bind to non-target regions, leading to non-specific amplification. Moreover, the significant differences in introns between different species can adversely affect the accuracy and reliability of experimental results. Furthermore, previous sex identification methods required simultaneous amplification of both female and male sex markers, resulting in low identification efficiency. Summary of the Invention

[0005] The purpose of this invention is to provide a widely applicable, highly specific, and efficient primer for identifying the sex of kelp and its application, effectively making up for the shortcomings of the prior art.

[0006] The present invention first provides a kelp sex determination nucleic acid fragment, wherein the nucleotide sequence of the male marker fragment is SEQ ID NO:1 and the nucleotide sequence of the female marker fragment is SEQ ID NO:2;

[0007] The present invention also provides one use of the fragment as a molecular marker for identifying the sex of kelp;

[0008] The present invention also provides a molecular detection product for identifying the sex of kelp, comprising primer pairs for detecting homologous fragments of the sex-determining region of the above-mentioned kelp species;

[0009] The primer pair described herein, as a specific example, has the following sequence information:

[0010] Sj-SexI-F: 5'-ACGGGAATGAARGAAGGTGG-3' (SEQ ID NO: 3),

[0011] Sj-SexI-R: 5'-TTGCCGTACCCCACAAGC-3' (SEQ ID NO: 4).

[0012] The present invention also provides a method for identifying the sex of kelp, which is to identify it by detecting homologous fragments in the sex-determining region of kelp.

[0013] The method involves amplifying a 391 bp DNA fragment in male individuals and a 670 bp DNA fragment in female individuals.

[0014] The gene sequence fragments obtained by screening in this invention are derived from conserved homologous genes in the sex-determining regions of brown algae. The selected sex identification marker primer sequences are derived from the regions with the highest similarity in the coding sequences of the homologous genes. This method enables rapid sex identification of kelp gametophytes using only a single pair of degenerate primers, offering high efficiency, high accuracy, and high interspecies applicability. This method is suitable for identifying mixed male and female samples, distinguishing between parthenogenetic and sexually reproducing kelp sporophytes, and identifying the sex of gametophytes in other species of the Laminariales order. It provides crucial support for the efficient management and research utilization of kelp gametophyte germplasm banks. Attached Figure Description

[0015] Figure 1 : Molecular marker Sj-SexI for sex identification of kelp gametophytes, where M: GL1000 DNA marker; ♀ lanes 1-5: female kelp gametophytes; ♂ lanes 1-5: male kelp gametophytes.

[0016] Figure 2 Image of parthenogenetic sporophytes of kelp identified by molecular marker Sj-SexI, where M: GL1000 DNA marker; ♀ lanes 1-5: sporophytes formed by female gametophytes through parthenogenesis; ♂ lanes 1-5: sporophytes formed by male gametophytes through androgenesis.

[0017] Figure 3 Image of sexually reproducing sporophytes in kelp identified by molecular marker Sj-SexI, where M: GL1000 DNA marker; lanes SP1-6: sporophytes formed by sexual reproduction of male and female gametophytes.

[0018] Figure 4 : Molecular marker Sj-SexI for sex identification of kelp-induced filaments, where M: GL1000 DNA marker; lanes Apo1-4: filaments induced by kelp sporophytes of the "Dongfang 6" strain; lanes Apo5-8: filaments induced by kelp sporophytes of the "DFKH" strain.

[0019] Figure 5 Molecular marker Sj-SexI for identifying gametophyte sex in different kelp species Separate Figure, where M: GL1000 DNA marker; Kelp, Kelpia stenoptera, Kelpia angustifolia, Kelpia pulidonis and Kelpia sacchari are all species of the genus Kelp.

[0020] Figure 6Image of gametophyte sex identification of *Undaria pinnatifida* using the molecular marker Sj-SexI, where M: GL1000 DNA marker; lanes 1-5: female gametophytes of *Undaria pinnatifida*; lanes 1-5: male gametophytes of *Undaria pinnatifida*.

[0021] Figure 7 The image shows the amplification of Undaria gametophyte DNA using the existing female-specific primer HFM4 in the laboratory, where M: GL1000 DNA marker; lanes 1-5 for female Undaria gametophytes; and lanes 1-5 for male Undaria gametophytes.

[0022] Figure 8 The image shows the amplification of Undaria gametophyte DNA using the male-specific primers MSj68 / 67 / 1 in the laboratory. M: GL1000 DNA marker; lanes 1-5: Undaria female gametophytes; lanes 1-5: Undaria male gametophytes. Detailed Implementation

[0023] The present invention will now be described in detail with reference to the embodiments and accompanying drawings.

[0024] Example 1: Development of a kelp sex marker (Sj-SexI)

[0025] First, based on the assembled male and female gametophyte genomes in our laboratory, and through previous GWAS and transcriptome results, candidate regions for sex determination in kelp were obtained, and 92 pairs of homologous genes in the sex determination region were screened. Homologous gene fragments (SEQ ID NO:1) and (SEQ ID NO:2) conserved in brown algae were selected from the kelp sex determination candidate regions for subsequent primer design.

[0026] The principles for designing sex identification primers are as follows: primers should be designed in functionally conserved regions of the gene to ensure universality across different varieties or related species; upstream and downstream primers should be designed on two adjacent exons, and the length of the introns between the two exons should differ between the two homologous genes (at least 150 bp); primer amplification products should be less than 1500 bp.

[0027] Based on gene structure diagrams and sequence alignment results, and according to primer design principles, two target genes were identified. Exons 3 and 4 of the target genes were found to be located in conserved functional regions with the highest sequence identity. However, the intron 3 between the two exons differed in length by more than 150 bp between male and female individuals. The nucleotide sequence of the male fragment is as follows (SEQ ID NO:1, where the underlined region is the exon):

[0028] GGGAAAGGAGACGGGATGAAGGAAGAGTGGATTGCATACGTCTTGAAGCAGACTCTGCAGGGTCTCAA ATATTTTCACGATCAGGGACAGGTGGGTAACCGTACCAGTGCCTCGGCCGATTATCCTCTACATCAGGTGCAACTTTTATCAGTTGCGATACTACAGCATACGCCACCAGTGTAGTGTGTTCACTTCGACTTATTGCCGCTCTTTTTAATATACTACTACGTTCTCATCCGGAACTTGTTTACAGTTGGCATGGTGATAACAGCCCCATTGTGTGTCGATGATTTTTTACAG ATTCACCGAGACATCAAGGCCGGGAATATTCTCCTGGGAGAGGACGGGCGAGTAAAGCTAGCTGATTTTGGC GTGGCGGGATGGCTTGTGGGGTACGGCAACCGTCGGAATGTCGCTAAGACCTTCGTCGGTACGCCATGCTGGATGG CACCAGAAGTATTGGAACAG;

[0029] The nucleotide sequence of the female fragment is as follows (SEQ ID NO:2, where the underlined regions are exons):

[0030] GGGAAAGGTAACGGGATGAAAGAAGAGTGGATCGCGTACGTTTTAAAGCAGACCCTTCAGGGGCTCAA GTACTTCCACGACCAGGGACAG GTATGGGCAACTGCACTGCTCCTTGTGTCTGATGTTTTTATTTAGCTATTACCGACTCGTGGCCAGCGGCTATTTTATTGCACGGGACATATTACAGTACGTTGCCAGCACATTTTTAAACTTTCGTGTAGCACGAAACTTGAATCATTGTATATAGCACCCGGATACATCGACAAAAAACGTATGGAGATCGCGGTCTTATTGACCGTTTATTAAGAATGTGAGCAAGCAGCATGAGTAATACA GCAGCTTGCTGCGCACGTATCGTACAACACCGTGCATGGTAAATCGAACACTGTGTATTTAGTACCCCGAAACCCAGTACCCCGGGCTGCTTTGTCTGGCCGATGCTGTAACCTTTTACGTTGTTTCGACATATTTTCCCAGTGGGGTATCTAATGAGGTCACCGCTCCGGGCAATAGGCCCCTCCAGGTTTTGGGCTTATCAGTATGTCGCGGCATGTGTGGACAATTTATCGCACAACGACAG ATCCACCGAGACATCAAGGCC GGCAATATTCTTTTAGGAGAGGACGGGCGTGTTAAGCTCGCTGATTTTGGCGTCGCGGGGTGGCTTGTGGGGTACG GCAACCGCCGAAACGTCGCCAAAACGTTTGTAGGCACGCCATGCTGGATGGCGCCGGAGGTTTTGGAACAG .

[0031] Therefore, primers for exon 3 and exon 4 regions were designed and screened.

[0032] Five DNA samples each from known-sex kelp gametophytes (male and female) were selected from laboratory-preserved samples and amplified using a designed PCR method. The reaction conditions and procedure were as follows: The PCR reaction system consisted of 9.5 µL ddH2O, 1 µL each of forward and reverse primers, 12.5 µL 2xrTaq enzyme (5 U / µL), and 1 µL template DNA (50 ng / µL). The PCR amplification program was: 95 ℃ for 3 min; 95 ℃ for 15 s, 60 ℃ for 15 s, 72 ℃ for 5 s, for 30 cycles; 72 ℃ for 5 min; and storage at 4 ℃. After initial screening and validation, four of the initially designed primer pairs simultaneously amplified the target bands in both male and female gametophytes. Further analysis revealed a one-base difference (A / G) in the upstream primers of two effective primer pairs, while the downstream primers were identical. Therefore, a degenerate primer, Sj-SexI, was designed.

[0033] Sj-SexI-F: 5'-ACGGGAATGAARGAAGGTGG-3' (SEQ ID NO: 3),

[0034] Sj-SexI-R: 5'-TTGCCGTACCCCACAAGC-3' (SEQ ID NO: 4).

[0035] The primers were used to amplify DNA from both male and female gametophytes. The PCR products were then subjected to 1.0% agarose gel electrophoresis, and the results are as follows: Figure 1 As shown, male gametophyte DNA can amplify a specific band of 391 bp, while female gametophyte DNA can amplify a specific band of 670 bp.

[0036] Example 2: Application of kelp sex markers in distinguishing kelp sporophytes from different sources

[0037] Five known parthenogenetic kelp sporophytes, five parthenogenetic kelp sporophytes, and eight sexually reproducing kelp sporophytes were selected. Genomic DNA from these sporophytes was amplified by PCR using primer pair Sj-SexI. The reaction conditions and procedure were as follows: The PCR reaction system included 9.5 µL dd H2O, 1 µL each of the forward and reverse primers SEQ ID NO:3 and SEQ ID NO:4, 12.5 µL 2× rTaq enzyme (5 U / µL), and 1 µL template DNA (50 ng / µL). The PCR amplification program was: 95 ℃ for 3 min; 95 ℃ for 15 s, 60 ℃ for 15 s, 72 ℃ for 5 s, 30 cycles; 72 ℃ for 5 min; and storage at 4 ℃.

[0038] The PCR products were subjected to 1.0% agarose gel electrophoresis as shown in the following results. Figure 2 and Figure 3As shown, only specific bands of 391 bp and 670 bp were amplified in the DNA of parthenogenetic and hermaphroditic kelp sporophytes, respectively. Figure 2 ); sexually reproduced kelp sporophyte DNA can simultaneously amplify specific bands of 391 bp and 670 bp ( Figure 3 ).

[0039] Example 3: Application of kelp sex markers in artificially induced sex identification of kelp filaments

[0040] Four filamentous organisms artificially induced from sporophytes of the "Dongfang 6" strain and four filamentous organisms artificially induced from sporophytes of the "DFKH" strain were selected. Genomic DNA from these filamentous organisms was amplified by PCR using the kelp sex marker Sj-SexI. The PCR products were subjected to 1.0% agarose gel electrophoresis, and the results are shown below. Figure 4 As shown, the artificially induced filaments of "Dongfang 6" sporophytes could only amplify a 670bp band, indicating that its genetic sex is female; the artificially induced filaments of "DFKH" sporophytes could simultaneously amplify 391bp and 670bp bands, indicating that its genetic sex is both male and female.

[0041] Implementation Case 4: Cross-species universal application of sex markers in kelp

[0042] Selected with kelp ( Saccharina japonica Kelp (also belonging to the Laminariaceae family) Saccharina longissima ) 4 plants, kelp ( Saccharina sculpera ) 4 plants and narrow-leaved kelp ( Saccharina angustata 4 strains, Ring-shaped Algae ( Kjellmaniella gyrata 4 plants and sugar kelp ( Laminaria saccharina ) Four strains were subjected to sex determination. PCR electrophoresis results are as follows: Figure 5 As shown, only a 391 bp specific band was amplified in the male gametophyte DNA of all five Laminariaceae species, while only a 670 bp specific band was amplified in the female gametophyte DNA. This indicates that the Sj-SexI primer has good universality in sex identification among different species of Laminariaceae in the order Laminariales.

[0043] Select wakame (from the family Laminariaceae, order Laminariales) Undaria pinnatifida Ten plants were sexed for identification. PCR electrophoresis results are as follows: Figure 6As shown, the DNA from the male gametophytes of *Wakame* amplified to obtain a specific band of 391 bp, and the DNA from the female gametophytes amplified to obtain a specific band of 670 bp, indicating that the Sj-SexI primer has good universality for sex identification in different families of *Laminaria*. Simultaneously, the sex of 10 identical *Wakame* plants was identified using our laboratory's male-specific primers (publication number CN106834469A) and female-specific primers (publication number CN108034742A). The results are as follows. Figure 7 and Figure 8 As shown, the publicly available female-specific primers fail to amplify bands in either females or males. This indicates that existing primers cannot meet the needs of cross-species ("family" taxonomic level) sex identification, while the primers of this invention have better versatility and applicability.

Claims

1. The application of kelp sex-determining nucleic acid fragments as molecular markers in identifying kelp sex, characterized in that, The nucleic acid fragments are male-related and female-related, wherein the sequence of the male-related nucleic acid fragment is SEQ ID NO:1 and the sequence of the female-related nucleic acid fragment is SEQ ID NO:

2.

2. The application of a molecular detection product for identifying the sex of kelp in the identification of kelp sex, characterized in that, The detection product contains a primer pair for detecting the sex-determining nucleic acid fragment of kelp as described in claim 1, wherein the sequence of the upstream primer is SEQ ID NO:3 and the sequence of the downstream primer is SEQ ID NO:

4.

3. A method for identifying the sex of kelp, characterized in that, The method described above uses nucleic acid fragments that determine the sex of kelp to identify it; the nucleic acid fragments are nucleic acid fragments related to male sex and nucleic acid fragments related to female sex, wherein the sequence of the nucleic acid fragment related to male sex is SEQ ID NO:1 and the sequence of the nucleic acid fragment related to female sex is SEQ ID NO:

2.

4. The method as described in claim 3, characterized in that, The method involves PCR amplification of the genomic DNA of the sporophyte to be tested using primer pairs. The sequence of the upstream primer is SEQ ID NO:3, and the sequence of the downstream primer is SEQ ID NO:

4. A DNA fragment of 391 bp is amplified in male individuals, and a DNA fragment of 670 bp is amplified in female individuals.

Citation Information

Patent Citations

  • Specific molecular marker for kelp male gametophyte and application thereof

    CN106834469A

  • Kelp gametophyte sex determination method

    CN108034742A

  • Saccharina japonica female gametophyte specific molecular marker FSMSJ-1294 and application thereof

    CN112760410A