Anti-CD19 humanized antibody as well as preparation method and application thereof
By preparing the humanized antibody X159, the problems of large molecular weight and immunogenicity of FMC63 were solved, achieving high affinity and high efficiency in CD19-targeted therapy, which is suitable for the treatment of B-cell tumors.
Patent Information
- Application Number
- CN202511035606.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-25
- Publication Date
- 2025-10-31
AI Technical Summary
The existing anti-CD19 mouse monoclonal antibody FMC63 has a large molecular weight and immunogenicity issues, making it difficult to effectively penetrate the blood-brain barrier, which limits its application in the treatment of B-cell tumors.
A humanized antibody against CD19, X159, was designed and prepared. By constructing an expression vector containing a specific nucleotide sequence, the full-length antibody in E. coli host cells was expressed and purified, including the light chain and heavy chain variable regions and constant regions, for the preparation of drugs to treat tumors.
The humanized antibody X159 has a high affinity for CD19, reducing the risk of heterologous immunity and improving its binding ability and killing effect on CD19 target cells. It is suitable for the prevention and treatment of lymphoma, multiple myeloma or plasmacytoma.
Smart Images

Figure CN120865411A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically relating to an anti-CD19 humanized antibody, its preparation method, and its uses. Background Technology
[0002] CD19, a B-lymphocyte antigen, is a single-pass type I membrane protein containing two Ig-like C2 (immunoglobulin-like) domains. In 1983, Lee M. Nadler and colleagues first identified CD19 as the B4 antigen of human B lymphocytes using a B4 monoclonal antibody. CD19 is specifically expressed in normal and neoplastic B cells, as well as follicular dendritic cells. During B cell generation, CD19 first occurs during immunoglobulin gene rearrangement. Pax5 is essential for normal CD19 expression in this process. CD19 is expressed throughout the entire process of B cell maturation and eventual differentiation into plasma cells. CD19 expression is three times higher in mature B cells than in immature B cells, and slightly higher in B1 cells than in B2 (conventional B) cells. It is not expressed in hematopoietic stem cells, plasma cells, T cells, and other tissues. CD19 is one of the most reliable surface biomarkers for B cells. CD19 expression is highly conserved in most B-cell tumors and is expressed in most acute lymphoblastic leukemia (ALL), chronic lymphocytic leukemia (CLL), and B-cell lymphoma.
[0003] CD19 acts as a co-receptor in B cell activation and signal transduction, regulating B cell activation and proliferation, participating in B cell signal transduction, and mediating T cell killing of target cells. CD19 regulates B cell development, proliferation, and differentiation in a B cell receptor (BCR)-dependent and BCR-independent manner. CD19, along with CD21, the tetraspan protein CD81 (TAPA-1), and CD225, forms a signal transduction complex. The CD19 complex lowers the BCR-mediated B cell activation threshold by modulating endogenous and receptor-induced signaling. CD19 binds to the BCR and other surface molecules, directly and indirectly recruiting and binding various downstream protein kinases. Protein kinases interacting with the CD19 complex include those belonging to the Src family (Lyn, Fyn), the Ras family, Abl, Btk, adaptor molecules (Vav, Grb2), and PI3K. The aggregation of Src family proteins on cell surface lipid rafts enhances BCR signaling. Following BCR activation, CD19 further enhances BCR-induced B cell expansion signaling by recruiting and activating PI3K and downstream Akt kinase. CD19 is considered to play a dual role in B cell activation. First, it acts as an adaptor protein, recruiting intracytoplasmic signaling proteins to the membrane. Second, when bound to BCR, it serves as the signaling subunit of the CD19 / CD21 complex, and complement enhances B cell activation through BCR-CD19 / CD21 binding.
[0004] FMC63 is a mouse monoclonal antibody against CD19 IgG2a, which can recognize the human CD19 protein. However, FMC63 has a molecular weight of 150 kDa, which is relatively large and not conducive to crossing the blood-brain barrier, and it also has immunogenicity issues.
[0005] CD19 is a target for immunotherapy of B-cell leukemia and lymphoma. FMC63-scFv is the most commonly used outer domain component of CD19-specific CARs. To date, most reported CAR19 trials have included anti-CD19 scFv derived from FMC63, including two FDA-approved CARs, Kymriah and Yescarta. Developing a novel humanized antibody against CD19 is of great research value. Summary of the Invention
[0006] In order to solve the above-mentioned problems in the prior art, the purpose of this invention is to provide an anti-CD19 humanized antibody, its preparation method and uses.
[0007] To achieve the above objectives, the present invention adopts the following technical solution:
[0008] The present invention provides a nucleotide sequence obtained by linking the nucleotide fragments shown in SEQ ID No:10 and SEQ ID No:9 end to end.
[0009] The present invention also provides an expression vector comprising the above-described nucleotide sequence.
[0010] The present invention also provides a host cell comprising the above-described expression vector.
[0011] Furthermore, the host cell is Escherichia coli.
[0012] The present invention also provides a full-length antibody comprising a light chain variable region VL and a light chain constant region CL, wherein the amino acid sequence of the light chain variable region VL is shown in SEQ ID No:1 and the amino acid sequence of the light chain constant region CL is shown in SEQ ID No:2.
[0013] Furthermore, it also includes a heavy chain variable region VH and heavy chain constant regions CH1, CH2, and CH3, wherein the amino acid sequence of the heavy chain variable region VH is shown in SEQ ID No:3, the amino acid sequence of the heavy chain constant region CH1 is shown in SEQ ID No:4, the amino acid sequence of the heavy chain constant region CH2 is shown in SEQ ID No:5, and the amino acid sequence of the heavy chain constant region CH3 is shown in SEQ ID No:6.
[0014] Furthermore, the amino acid sequence of its heavy chain is shown in SEQ ID No:7, and the amino acid sequence of its light chain is shown in SEQ ID No:8.
[0015] The present invention also provides a method for preparing the above-mentioned full-length antibody, the method comprising the following steps:
[0016] (1) The above nucleotide sequence was ligated into an expression vector to obtain a positive plasmid;
[0017] (2) Transform host cells with positive plasmids to induce expression, and you will get the product.
[0018] The present invention also provides the use of the above-described full-length antibody in the preparation of medicaments for the prevention and / or treatment of tumors.
[0019] Furthermore, the tumor is lymphoma, multiple myeloma, or plasmacytoma.
[0020] The present invention also provides a medicament for the prevention and / or treatment of tumors, which is prepared by using the above-mentioned full-length antibody as the active ingredient and adding pharmaceutically acceptable excipients.
[0021] The present invention has achieved the following beneficial effects:
[0022] This invention provides a humanized X159 antibody against CD19. This antibody has a high affinity for CD19 and is superior to the known antibody molecule FMC63. The X159 antibody provided by this invention is itself a humanized antibody, which can minimize the immune risks caused by heterogeneity and is more likely to exert therapeutic effects. It has broad application prospects in the preparation of drugs for the prevention and / or treatment of tumors.
[0023] Obviously, based on the above description of the present invention, and according to common technical knowledge and conventional methods in the field, various other modifications, substitutions or alterations can be made without departing from the basic technical concept of the present invention.
[0024] The following detailed embodiments further illustrate the above-described content of the present invention. However, this should not be construed as limiting the scope of the present invention to the following examples. All technologies implemented based on the above-described content of the present invention fall within the scope of the present invention. Attached Figure Description
[0025] Figure 1 A diagram showing the degree of humanization of the humanized X159 antibody and the known maternal antibody FMC63.
[0026] Figure 2 The results show the affinity test results between the humanized X159 antibody and CD19.
[0027] Figure 3 The binding level of humanized X159 antibody to Raji cells, which are target cells with high CD19 expression.
[0028] Figure 4 The effect of humanized X159 antibody on ADCC killing of target cells with high expression of CD19. Detailed Implementation
[0029] The raw materials and equipment used in this invention are all known products, obtained by purchasing commercially available products.
[0030] The following experiments, where no temperature is specified, are reactions conducted under normal temperature conditions, which is room temperature, or 25±5℃.
[0031] The degree of humanization of the humanized X159 antibody of this invention with the known maternal antibody FMC63 is as follows: Figure 1 As shown.
[0032] Example 1: Preparation of humanized antibody X159
[0033] 1. Constructing recombinant strains
[0034] (1) Restriction vector digestion: The tool vector pcDNA3.1-x-IgG1 (provided by Hangzhou Mige Biotechnology) was digested with BamHI / EcoRI enzyme (purchased from Yisheng Biotechnology). The double digestion system is shown in Table 1. After double digestion at 37℃ for 5 h, the vector was recovered using a PCR product recovery kit (Cycle-Pure Kit PCR Product Purification Kit OMEGA D6492-01).
[0035] Table 1. BamHI / EcoRI double enzyme digestion plasmid system
[0036] Element Dosage pcDNA3.1-x-IgG1 plasmid 10μg 10×buffer 10μl BamH I 2.5μl EcoRI 2.5μl <![CDATA[ddH2O]]> Add to 100 μl
[0037] (2) Homologous recombination: The nucleotide fragment used for recombination expression (SEQ ID No:9, i.e., the PCR product recovered by gel cutting in Table 2) was diluted 20 times with ddH2O. 1 μL of the diluted sample was taken and homologously recombinated with the vector (pcDNA3.1-x-IgG1 (BamHI / EcoRI) digested vector fragment) recovered by enzyme digestion in step (1) (recombinase, NovoRec Plus one step PCR Cloning Kit nearshore protein catalog number NR005-01B). The homologous recombination reaction system is shown in Table 2. The homologous recombination reaction system was reacted at 50℃ for 30 min on a PCR instrument. 100 μl of TOP10 competent cells were added to each tube of homologous recombination reaction product for transformation (placed on ice for 20 min, heat-shocked at 42℃ for 90 s, immediately placed on ice for 2 min, added 800 μl of LB medium, cultured at 37℃ and 220 rpm for 25-45 min. Plated on Amp resistant plate medium and cultured overnight at 37℃).
[0038] Table 2 Homologous recombination reaction system
[0039] Element Dosage pcDNA3.1-x-IgG1 (BamHI / EcoRI) digestion of large vector fragment 100ng Gel extraction and recovery of PCR products 50ng 5×buffer 2μl Recombinase 0.5μl <![CDATA[ddH2O]]> Add to 10 μl
[0040] The sequence of the nucleotide fragment used for recombinant expression is as follows:
[0041] VH-CH1-CH2-CH3 (heavy chain):
[0042] (SEQ ID NO.9)
[0043]
[0044] VL-CL (Light Chain):
[0045] (SEQ ID NO.10)
[0046] GATATTCAGATGACCCAGAGCCCGAGCAGCCTGAGCGCGAGCGTGGGCGATCGCGTGACCATTACCTGCCGCGCGAGCCAGGATATTAGCAAATATCTGAACTGGTATCAGCAGAAACCGGGCAAAGTGCCGAAACTGCTGATTTATCATACCAGCCGCC TGCATAGCGGCGTGCCGAGCCGCTTTAGCGGCAGCGGCAGCGGCACCGATTATACCCTGACCATTAGCAGCCTGCAGCCGGAAGATGTGGCGACCTATTATTGCCAGCAGGGCAACACCCTGCCGTATACCTTTGGCCAGGGCACCAAACTGGAAATTAAA CGCACCGTGGCGGCGCCGAGCGTGTTTATTTTTCCGCCGAGCGATGAACAGCTGAAAAGCGGCACCGCGAGCGTGGTGTGCCTGCTGAACAACTTTTATCCGCGCGAAGCGAAAGTGCAGTGGAAAGTGGATAACGCGCTGCAGAGCGGCAACAGCCAGG AAAGCTGACCGAACAGGATAGCAAAGATAGCACCTATAGCCTGAGCAGCACCCTGACCCTGAGCAAAGCGGATTATGAAAAACATAAAGTGTATGCGTGCGAAGTGACCCATCAGGGCCTGAGCAGCCCGGTGACCAAAAGCTTTAACCGCGGCGAATGC
[0047] (3) Identification of Escherichia coli culture by PCR: Single colonies of Escherichia coli were picked from the plate and cultured in 200 μL of LLB medium (1L solution: 10g tryptone (Oxoid), 5g yeast extract (Oxoid), 10g sodium chloride) at 37℃ and 220rpm for 3h. 1 μL of the culture was used as a template for culture PCR identification. Positive clones were selected for sequencing. The PCR products were electrophoretically excised and recovered using a gel (Gel Extraction Kit OMEGA, catalog number D2500-01). Homologous recombination was performed again. After culture PCR identification, positive clones were selected for sequencing to obtain the recombinant strain.
[0048] 2. Expression and purification of humanized antibody X159 in Hek293F cells
[0049] (1) Antibody expression
[0050] The recombinant bacterial strain obtained in step 1 was inoculated into 20 ml of LB medium containing ampicillin and incubated overnight at 37°C. Plasmids were extracted using a plasmid extraction kit (Plasmid Miniprep Kit II, Bevo Medical Cat: BW-PD1213) to obtain the expression plasmid. Hek293 cells were passaged to maintain good cell growth with a viability greater than 95%. The Hek293 cell density was adjusted to 2.5 × 10⁶ cells / year at transfection. 6 cells / ml. Take 50 μg of expression plasmid and add it to 1 ml of OPM-293CD03 medium (hereinafter referred to as OPM medium, purchased from Shanghai Aopumai Biotechnology Co., Ltd.) and mix well. Take 150 μg of PEI and add it to 1 ml of OPM medium and mix well. After mixing the two, shake well and let stand at room temperature for 30 min. Then add it to 50 ml of Hek293 cells and culture in a CO2 shaker. On the second day, add 5% final volume of OPM medium to feed the cells and continue to culture until day 7. Centrifuge at 10000 rpm for 20 min to harvest the cell culture supernatant for protein purification.
[0051] (2) Antibody purification
[0052] The cell culture supernatant obtained from antibody expression in step (1) was filtered through a 0.22 μm filter membrane and loaded onto a Protein A column (Chutian Microsphere Biotechnology (Changsha) Co., Ltd., TH-protein A, Y5001). Protein was eluted with 0.1 M Gly-HCl at pH 3.0 and then quickly neutralized with 10% volume of 1 M Tris-HCl at pH 8.8. Protein concentration was determined using the A280 method with a micro-spectrophotometer. The X159 protein concentration was determined to be 1 mg / ml, with a purity of not less than 95%.
[0053] The amino acid sequence of the target protein X159 is shown in SEQ ID No:7. It includes light chains VL and CL, and heavy chains VH, CH1, CH2 and CH3.
[0054] Table 3. Amino acid sequence of target protein X159
[0055]
[0056]
[0057]
[0058] The following experimental examples demonstrate the activity of the humanized antibody X159 of this invention.
[0059] Experimental Example 1: Affinity Detection of Humanized Antibody X159 with CD19
[0060] 1. Experimental Methods
[0061] The ELISA plate was coated with 5 μg / ml CD19-His antigen and incubated overnight at 4°C. The coating solution was discarded, and the plate was washed twice with PBS and blocked at 37°C for 2 h. The anti-CD19 antibody X159 (from this invention) and the known monoclonal antibody FMC63 were added in 3-fold serial dilutions starting at 500 nM and incubated at 37°C for 1 h. The plate was washed five times with 0.1% PBST (incubated for approximately 2-3 min each time), and horseradish peroxidase-conjugated Fc secondary antibody (Goat Anti-Human IgG-Fc Secondary Antibody (HRP), prepared with 5% skim milk powder at a 1:10000 ratio) was added and incubated at 37°C for 45 min. The experimental results of the X159 antibody and the FMC63 antibody were detected and compared, and the EC50 was calculated. 50 (half-maximal effect concentration).
[0062] 2. Experimental Results
[0063] Affinity ELISA test results as follows Figure 2 As shown in Table 4, the anti-CD19 antibody X159 of the present invention can target the CD19 protein and has a high affinity for the CD19 protein. Furthermore, the affinity of the anti-CD19 antibody X159 of the present invention for CD19 is significantly better than that of the control antibody FMC63.
[0064] Table 4. Results of Affinity ELISA Test
[0065] name X159 FMC63 <![CDATA[EC 50 (nM)]]> 0.044 0.066
[0066] Experimental Example 2: Detection of binding of humanized antibody X159 to CD19-overexpressing cells
[0067] 1. Experimental Methods
[0068] Humanized antibodies X159 and FMC63 were diluted to 50 nM, and Raji cells (derived from ATCC) were prepared at 3 × 10⁻⁶ m³. 5Cells / group, grouped, centrifuged at 300g for 3 min, washed 3 times, supernatant discarded, sample incubation: add 100 μl / group of CD19 antibody at the corresponding dilution (i.e., 50 nM X159 antibody or 50 nM FMC63 antibody), 4℃, 45 min. Secondary antibody incubation: centrifuged at 300g for 3 min, washed 3 times, supernatant discarded; added 100 μL of FITC-labeled anti-human Fc antibody (Bioleng), 4℃, 45 min. Washed at 300g for 3 min, washed 3 times, resuspended in 200 μl / group, flow cytometry detection:
[0069] The fluorescence values of cells were detected by flow cytometry.
[0070] 2. Experimental Results
[0071] The flow cytometry results of Raji-negative cells and X159 humanized antibody binding to FMC63 antibody are as follows: Figure 3 As shown, compared with the average fluorescence intensity of Raji cells in the negative control group, the flow cytometry results of the FMC63 antibody showed a significant shift, indicating that the FMC63 antibody has a high affinity for Raji cells. Furthermore, the X159 humanized antibody of this invention also showed a significant shift compared to the FMC63 antibody, indicating that the X159 humanized antibody of this invention has a higher affinity for Raji cells than the FMC63 antibody.
[0072] Experimental Example 3: Effect of humanized antibody X159 on ADCC killing of CD19-overexpressing target cells
[0073] 1. Experimental Methods
[0074] NALM-6 cells were labeled with Calcein-AM (working concentration: 0.03 μM), incubated at 37°C in the dark for 30 minutes, centrifuged, and resuspended in pre-warmed complete medium (RPMI-1640 complete medium containing 10% FBS). Cells were cultured for 10 minutes to ensure effective retention of Calcein-AM. After centrifugation (1000 rad, 4 minutes), the supernatant was discarded, and the labeled cells were transferred to wells at a density of 4 x 10⁻⁶ cells / well. 5 NK cells were seeded at a concentration of 500 μL into 12-well suspension plates. Antibody was added at a concentration of 100 nM to the 12-well plates seeded with NALM-6 cells, and incubated at 37°C for 30 minutes. NK cells were collected, centrifuged to remove the supernatant, resuspended in complete culture medium (RPMI-1640 complete medium containing 10% FBS), and counted at a concentration of 4 × 10⁶ cells / well. 5Cells were seeded at a concentration of [value missing] / well in 12-well plates as described above, and the plates were incubated at 37°C (5% CO2, 90% humidity) for 4 hours. After incubation, the solution in the plates was transferred to centrifuge tubes, and the cells were washed twice with 1×PBS. After centrifugation, 100 μL of apoptosis staining reagent (5 μL APC Annexin V staining solution + 5 μL 7-AAD activity staining solution + 90 μL apoptosis binding buffer) was added to the cell pellet. The cells were gently inverted and briefly centrifuged, then incubated in the dark at room temperature (25°C) for 15 minutes. After incubation, the cells were washed with 1×PBS, centrifuged, and resuspended in 100 μL / tube of 1×PBS. Analysis was performed using flow cytometry.
[0075] 2. Experimental Results
[0076] The ADCC test results of the humanized anti-CD19 antibody X159 and FMC63 antibody of this invention are as follows: Figure 4 As shown, both the FMC63 antibody and the humanized X159 antibody of this invention can increase the killing effect of NK cells on NALM-6 tumor cells. Furthermore, the humanized X159 antibody of this invention exhibits a stronger ADCC effect compared to the control FMC63 antibody.
[0077] The above results indicate that the humanized X159 antibody of this invention has a better ADCC effect on CD19-overexpressing target cells than the control antibody FMC63.
[0078] In summary, this invention provides a humanized X159 antibody against CD19. This antibody has a high affinity for CD19 and is superior to the known antibody molecule FMC63. The X159 antibody provided by this invention is itself a humanized antibody, which can minimize the immune risks caused by heterogeneity and is more likely to exert therapeutic effects. It has broad application prospects in the preparation of drugs for the prevention and / or treatment of tumors.
Claims
1. A nucleotide sequence, characterized in that, The nucleotide sequence is obtained by linking the nucleotide fragments shown in SEQ ID No:10 end-to-end with the nucleotide fragments shown in SEQ ID No:
9.
2. An expression vector comprising the nucleotide sequence of claim 1.
3. A host cell comprising the expression vector of claim 2; preferably, the host cell is Escherichia coli.
4. A full-length antibody comprising a light chain variable region VL and a light chain constant region CL, characterized in that, The amino acid sequence of the light chain variable region VL is shown in SEQ ID No:1, and the amino acid sequence of the light chain constant region CL is shown in SEQ ID No:
2.
5. The full-length antibody according to claim 4, characterized in that, It also includes a heavy chain variable region VH and heavy chain constant regions CH1, CH2, and CH3. The amino acid sequence of the heavy chain variable region VH is shown in SEQ ID No:3, the amino acid sequence of the heavy chain constant region CH1 is shown in SEQ ID No:4, the amino acid sequence of the heavy chain constant region CH2 is shown in SEQ ID No:5, and the amino acid sequence of the heavy chain constant region CH3 is shown in SEQ ID No:
6.
6. The full-length antibody according to claim 5, characterized in that, Its heavy chain amino acid sequence is shown in SEQ ID No:7, and its light chain amino acid sequence is shown in SEQ ID No:
8.
7. A method for preparing the full-length antibody according to any one of claims 4 to 6, characterized in that, The method includes the following steps: (1) The nucleotide sequence of claim 1 is ligated into an expression vector to obtain a positive plasmid; (2) Transform host cells with positive plasmids to induce expression, and you will get the product.
8. Use of the full-length antibody according to any one of claims 4 to 6 in the preparation of a medicament for the prevention and / or treatment of tumors.
9. The use according to claim 8, characterized in that, The tumor is lymphoma, multiple myeloma, or plasmacytoma.
10. A drug for the prevention and / or treatment of tumors, characterized in that, It is prepared using the full-length antibody as the active ingredient according to any one of claims 4 to 6, plus pharmaceutically acceptable excipients.