Micro-droplet digital detection method for molecular marker on surface of single vesicle and application of micro-droplet digital detection method

Abstract

The invention discloses a micro-droplet digital detection method for a molecular marker on the surface of a single vesicle and application of the micro-droplet digital detection method. The method comprises the following steps: modifying a DNA tetrahedron combined with a cholesterol modified RNA capture probe on a magnetic bead, enriching EVs with the obtained functionalized magnetic bead, adding an antibody nucleic acid compound to realize signal conversion of the molecular marker on the surface of the EVs, and washing to remove the uncombined antibody nucleic acid compound, thereby obtaining the molecular marker on the surface of the EVs. Then, RNase H enzyme is used for carrying out enzymolysis on an RNA capture probe complementary with an extended chain at the tail end of the DNA tetrahedron, EVs combined with an antibody nucleic acid compound are released, finally, the EVs, a primer probe and other reaction systems are loaded to a micro-fluidic chip to generate micro-droplets, a thermal cycle reaction is carried out, and the detection result is obtained. The digital detection of the molecular marker on the surface of the single vesicle is realized through the identification and reading of the droplet analyzer. According to the method, reversible enrichment of EVs can be achieved, operation is easy, cost is low, and transformation application of EVs subgroup analysis in precise diagnosis and treatment of diseases is facilitated.

Description

Technical Field

[0001] This invention belongs to the field of detection, and specifically relates to a digital detection method for microdroplets containing molecular markers on the surface of single vesicles and its application. Background Technology

[0002] Extracellular vesicles (EVs) are membrane-bound vesicles with a phospholipid bilayer structure secreted by cells. They carry tumor-specific proteins and nucleic acid molecules and can enter the peripheral blood circulation in the early stages of tumor development, making them promising biomarkers for liquid tumor biopsies. However, current EV detection and analysis face significant challenges: firstly, blood composition is complex, and EVs, being nanoscale particles, are small in size, making efficient separation and enrichment difficult; secondly, tumor-derived EVs are often mixed with a large population of EVs derived from normal cells, posing a significant challenge to the accurate detection of tumor-derived EV subpopulations. Therefore, developing technologies for the efficient separation and sensitive detection of tumor-derived EV-specific subpopulations is crucial for advancing the application of EVs in tumor diagnosis and treatment and promoting the development of precision medicine.

[0003] However, current precise analysis techniques for EVs still have many limitations. Traditional EV analysis strategies generally include the separation and enrichment of EVs and the detection and analysis of specific molecular markers. Both separation efficiency and detection accuracy have varying degrees of deficiencies, hindering the clinical application of EVs. In terms of EV separation, ultracentrifugation, as the recognized gold standard, is time-consuming, relies on large, precision instruments such as ultracentrifuges, and has low separation efficiency. Other commonly used methods, such as size exclusion chromatography, polymer precipitation, and ultrafiltration, also suffer from various problems such as complex and time-consuming operations and low EV purity, hindering subsequent precise analysis of EV-specific molecular markers. Based on a deeper understanding of EVs, researchers have also used antibodies against membrane proteins on the EV surface to separate them through antigen-antibody interactions. However, this separation method has a drawback: antibodies often bind to a stationary phase (such as magnetic beads), resulting in low efficiency in eluting EVs from the stationary phase, which is detrimental to subsequent research on EVs, especially single vesicles.

[0004] Existing methods for detecting EV-specific molecular markers include surface molecular markers such as proteins and methylated DNA, which are important molecular markers for identifying specific EV subpopulations. Traditional detection methods for EV surface molecular markers mainly include Western blotting (WB) and enzyme-linked immunosorbent assay (ELISA) based on protein analysis, and real-time quantitative PCR (qPCR) and next-generation sequencing based on DNA methylation analysis. Although technological innovations have led to the emergence of new optical and electrochemical detection platforms that have greatly improved the sensitivity and specificity of EV detection, most methods are still batch detection systems employing population averaging analysis strategies. This detection mode has two key drawbacks: first, in complex biological samples, high-abundance background EVs can severely interfere with the detection of specific signals from rare EV subpopulations (such as tumor-derived EVs), leading to missed detection of important biomarkers; second, it cannot resolve the individual particle heterogeneity characteristics of the EV population, causing the unique molecular information carried by individual EVs to be ignored. These technical bottlenecks not only affect the accuracy of test results, but also limit the in-depth application of EVs in precision medicine.

[0005] In summary, there is an urgent need to develop a novel technology platform that integrates efficient separation and enrichment of EVs with high-precision detection of molecular markers on the surface of EVs, in order to facilitate the translational application of EV subpopulation analysis in precision disease diagnosis and treatment. Summary of the Invention

[0006] The primary objective of this invention is to overcome the shortcomings and deficiencies of the prior art and provide a digital detection method for microdroplets containing molecular markers on the surface of single vesicles.

[0007] Another objective of this invention is to provide an application of the above-mentioned method for digital detection of microdroplets containing molecular markers on the surface of single vesicles.

[0008] The objective of this invention is achieved through the following technical solution: a method for digital detection of microdroplets containing molecular markers on the surface of single vesicles, comprising the following steps:

[0009] (1) A DNA tetrahedron with a rigid structure is bound to a cholesterol-modified RNA capture probe through three fulcrums, and then bound to a magnetic bead through a fourth fulcrum to obtain a functionalized magnetic bead.

[0010] (2) Add RNase inhibitor to the sample to be tested to obtain the treated sample; mix the functionalized magnetic beads with the treated sample evenly, and capture the extracellular vesicles by binding cholesterol to them; then add the antibody-nucleic acid complex for incubation, and then perform solid-liquid separation on the product obtained from incubation, take the solid, wash it, and obtain the magnetic beads with extracellular vesicles connected to the antibody-nucleic acid complex; or mix the functionalized magnetic beads with the treated sample evenly and then perform solid-liquid separation to obtain the magnetic beads enriched with extracellular vesicles, then incubate with the antibody-nucleic acid complex, perform solid-liquid separation, wash it, and obtain the magnetic beads with extracellular vesicles connected to the antibody-nucleic acid complex.

[0011] (3) Place the magnetic beads with extracellular vesicles connected to antibody-nucleic acid complexes into a reaction system containing RNase H enzyme, react, take the supernatant, and recover to obtain functionalized magnetic beads.

[0012] (4) The supernatant obtained in step (3) is subjected to microdroplet digital detection to obtain information on molecular markers on the surface of single vesicles.

[0013] The DNA tetrahedron described in step (1) consists of four strands, one of which is modified with biotin, so that it can bind to streptavidin magnetic beads through biotin-streptavidin interaction.

[0014] The preferred nucleic acid sequences for the four strands are as follows:

[0015] S1: 5'-TATCACCAGGCAGTTGACAGTGTAGCAAGCTGTAATAGATGCGAGGGTCCAATACTTTGCGGCGAAATATTAT-3';

[0016] S2: 5'-TCAACTGCCTGGTGATTTAACGACACTACGTGGGAATCTACTATGGCGGCTCTTCTTTGCGGCGAAATATTAT-3';

[0017] S3: 5'-TTCAGACTTAGGAATGTGCTTCCCACGTAGTGTCGTTTGATTTGGACCCTCGCATTTTGCGGCGAAATATTAT-3';

[0018] S4-bio: 5'-ACATTCCTAAGTCTGAAACATTACAGCTTGCTACACGAGAAGAGCCGCCATAGTATT-Biotin-3'.

[0019] The RNA in the cholesterol-modified RNA described in step (1) is partially or completely complementary to the extended end, and the preferred sequence is as follows:

[0020] Cho-S-RNA: 5'-cholesteryl-AUAAUAUUUCGCCGCA-3'.

[0021] The DNA tetrahedral reaction system described in step (1) contains per 20 μL: S1 1 μM, S2 1 μM, S3 1 μM, S4 1 μM, Mg 2+ 5mM, 2μL buffer; Buffer composition: Tris-base 2.4228g / L, NaCl 7.305g / L, KCl 1.491g / L, pH 7.4~7.6.

[0022] The DNA tetrahedron is preferably obtained by the following steps: heating the reaction system at 95°C for 5 minutes, and then cooling it to room temperature.

[0023] In step (1), the DNA tetrahedron and the RNA capture probe are matched in a molar ratio of 1:3 to 3.2 when they bind to the cholesterol-modified RNA capture probe.

[0024] The conditions for binding the cholesterol-modified RNA capture probe described in step (1) are preferably room temperature reaction for 30 to 90 min; more preferably 60 min.

[0025] Step (1) is preferably as follows:

[0026] A. Prepare a 20 μL DNA tetrahedral reaction system, react, and obtain DNA tetrahedra; the 20 μL reaction system contains: S1 1 μM, S2 1 μM, S3 1 μM, S4 1 μM, Mg 2+ 5mM, 2μL buffer; Buffer composition: Tris-base 2.4228g / L, NaCl 7.305g / L, KCl 1.491g / L, pH 7.4~7.6;

[0027] B. Add 3 μL of 20 μM Cho-S-RNA and react;

[0028] C. Add the product obtained in step B to 2 μL of streptavidin magnetic beads with a concentration of 10 mg / mL, mix thoroughly, and allow to react;

[0029] D. Perform solid-liquid separation on the product obtained in step C, add 0.05 μL of avidin site blocking agent to the obtained solid, react, and then perform solid-liquid separation again. Wash the obtained solid with PBS and resuspend it with 2 μL of PBS to obtain functionalized magnetic beads.

[0030] The preferred reaction conditions in step A are 95°C for 5 min and 25°C for ∞.

[0031] The reaction time in step B is preferably 30 to 90 minutes; more preferably 60 minutes.

[0032] The reaction time in step C is preferably 30 to 90 minutes; more preferably 60 minutes.

[0033] The reaction time in step D is preferably 3 to 10 minutes; more preferably 5 minutes.

[0034] The sample to be tested in step (2) is preferably plasma supernatant; more preferably plasma supernatant diluted with PBS.

[0035] The dilution is preferably carried out at a volume ratio of plasma supernatant to PBS of 1:1 to 1:3.

[0036] The preferred amount of RNase inhibitor used in step (2) is 0.5 μL of RNase inhibitor per 1-300 μL of sample to be tested.

[0037] The mixing time in step (2) is preferably 10 to 60 minutes; more preferably 20 minutes.

[0038] The antibody-nucleic acid complex described in step (2) is preferably prepared by the following steps: conjugating an antibody with avidin to obtain an avidinized antibody; reacting the avidinized antibody with biotin-labeled DNA, then adding streptavidin magnetic beads to adsorb the free biotin-labeled DNA for purification to obtain the purified antibody-nucleic acid complex; more preferably, it is prepared by the following steps:

[0039] E. Mix 10 μg of antibody with 1 μL of LL-modifier, shake to mix, and react in the dark for 2–4 h; add 1 μL of LL-quencher to stop the reaction, incubate for 20–40 min, and obtain the avidinized antibody solution;

[0040] F. React an avidinized antibody solution containing 1 μg of avidinized antibody with 0.5 μL of 10 μM biotin-labeled DNA for 30–90 min to obtain an antibody-nucleic acid complex.

[0041] G. Dilute the antibody-nucleic acid complex to 500 μL using PBS, add 2 μL of 10 mg / mL avidinized magnetic beads, react for 30–90 min, and then separate the solid and liquid components.

[0042] H. Collect the purified supernatant to obtain the purified antibody-nucleic acid complex.

[0043] The aforementioned coupling can be achieved via the Streptavidin Conjugation Kit-Lightning- The reagent kit is used to achieve this.

[0044] The molar amount of biotin-labeled DNA used is in excess relative to the avidinized antibody.

[0045] The avidinized antibody and the biotin-labeled DNA are preferably mixed at a ratio of 1 μg: 5 pmol.

[0046] In step (2), the amount of each component used is preferably 1-300 μL: 2 μL: 2 μL for the treated sample, functionalized magnetic beads and antibody-nucleic acid complex.

[0047] The incubation time in step (2) is preferably 30 to 90 minutes; more preferably 60 minutes.

[0048] The solvent used in the washing process described in step (2) is PBS or RNase H reaction buffer diluted with PBS.

[0049] The preferred dilution factor is 1000 times.

[0050] The preferred amount of RNase H enzyme used in step (3) is 15-20 U RNase H per 2 μL of extracellular vesicles enriched with antibody-nucleic acid complexes obtained by functionalizing magnetic beads.

[0051] The reaction system described in step (3) consists of RNase H enzyme and RNase H reaction buffer.

[0052] The reaction time in step (3) is preferably 30 to 90 minutes; more preferably 60 minutes.

[0053] The preferred system for digital detection of microdroplets in step (4) is as follows: each 20 μL reaction system contains Mix 1×, upstream primer 900 nM, downstream primer 900 nM, probe 400 nM, supernatant 5 μL, and DNase-free water as the remainder.

[0054] The preferred amplification reaction conditions for the digital detection of microdroplets in step (4) are as follows: 95℃ for 5 min; 94℃ for 30 s, 60℃ for 1 min, 45 cycles; 4℃: ∞.

[0055] The room temperature described in this invention is preferably 15-30°C; more preferably 20-30°C; and even more preferably 24-26°C.

[0056] The preferred solid-liquid separation method described in this invention is magnetic adsorption.

[0057] The application of the above-mentioned digital detection method for microdroplets of molecular markers on the surface of single vesicles in the separation of extracellular vesicles from plasma cells.

[0058] The above-mentioned microdroplet digital detection method for molecular markers on the surface of single vesicles is applied to obtaining protein or DNA methylation markers on the surface of EVs.

[0059] The above-mentioned digital detection method for microdroplets of molecular markers on the surface of single vesicles is applied to the acquisition of tumor markers on the surface of EVs.

[0060] The tumor is preferably gastric cancer.

[0061] The application of the above-mentioned digital detection method for microdroplets of molecular markers on the surface of single vesicles in the early diagnosis of gastric cancer.

[0062] A protein biomarker for gastric cancer diagnosis, consisting of ZnRF3, EpCAM, LPS, VacA, CD3, and CD97 from plasma EVs.

[0063] A DNA methylation marker for gastric cancer diagnosis, consisting of 5-mC and 5-h-mC from plasma EVs.

[0064] Experimental design principles as follows Figure 1 As shown, the components of the DNA tetrahedron were mixed in a 1:1 molar ratio, heat-denatured, and then cooled to room temperature to construct the DNA tetrahedron. Three times the amount of cholesterol-modified RNA capture probe was then added, reacted at room temperature, and then added to magnetic beads for further reaction at room temperature to construct functionalized magnetic beads. Pretreated peripheral blood samples were incubated with the prepared functionalized magnetic beads for efficient capture of plasma vesicles (EVs). An antibody-nucleic acid complex was then added to achieve signal conversion of molecular markers on the EV surface. Unbound antibody-nucleic acid complex was removed by washing with a washing buffer. Subsequently, the RNA capture probe, complementary to the extended strand at the end of the DNA tetrahedron, was enzymatically digested using RNase H enzyme to release the EVs bound to the antibody-nucleic acid complex. Finally, the EVs, along with primers and probes, were loaded onto a microfluidic chip to generate microdroplets, which underwent thermal cycling. Digital detection of molecular markers on the surface of single vesicles was achieved through identification and reading by a droplet analyzer.

[0065] The present invention has the following advantages and effects compared with the prior art:

[0066] (1) This invention provides a method for efficiently obtaining extracellular vesicles. Compared with traditional centrifugation methods, this invention does not require expensive centrifugation equipment, is simple to operate, and has high separation efficiency.

[0067] (2) In the method provided by the present invention, EVs are reversibly enriched, and EVs can be completely separated from the magnetic beads. The functional magnetic beads can be reused, which not only shortens the enrichment process of EVs, but also reduces costs.

[0068] (3) The present invention has excellent anti-interference effect and can realize digital detection of molecular markers on the surface of single vesicles, which is conducive to the translational application of EV subpopulation analysis in the precision diagnosis and treatment of diseases. Attached Figure Description

[0069] Figure 1 This is a schematic diagram of the present invention.

[0070] Figure 2 The image shows the characterization results of successful self-assembly of DNA tetrahedra; where a is an agarose gel electrophoresis image and b is an atomic force microscope image.

[0071] Figure 3 This is a diagram showing the feasibility verification results of the reversible separation and enrichment of EVs by the functionalized magnetic beads constructed in this invention; in the diagram, the PBS group is the control group, the EVs group is the group in which the functionalized magnetic beads bind to EVs, and the RNase H digestion group is the diagram obtained by digesting the EVs group with RNase H enzyme.

[0072] Figure 4 This is a graph showing the results of optimizing the amount of functional magnetic beads using high-sensitivity flow cytometry (HSFCM). In the graph, a represents the concentration of EVs samples before incubation with functional magnetic beads, be represents the concentration of remaining EVs samples after incubation with 1 μL, 2 μL, 4 μL, and 6 μL of functional magnetic beads, respectively, and f represents the calculated concentration of EVs captured under different amounts of functional magnetic beads.

[0073] Figure 5 This figure shows the optimized incubation time of functionalized magnetic beads and EVs using high-sensitivity flow cytometry (HSFCM). In the figure, a represents the concentration of EVs samples before incubation with functionalized magnetic beads, be represents the concentration of remaining EVs samples after incubation with functionalized magnetic beads for 10, 20, 40, and 60 minutes, respectively, and f represents the calculated concentration of EVs captured under different incubation time conditions of functionalized magnetic beads.

[0074] Figure 6The graph shows the evaluation results of EV separation efficiency; where a is the initial concentration of EVs before ultracentrifugation, b is the concentration of EVs extracted by ultracentrifugation, c is the initial concentration of EVs before treatment by the EV enrichment method provided by this invention, d is the concentration of EVs enriched by the EV enrichment method provided by this invention, e is the concentration of EVs before and after separation and enrichment by ultracentrifugation and the EV enrichment method provided by this invention, and f is a comparison of the EV separation efficiency of ultracentrifugation and the EV enrichment method provided by this invention.

[0075] Figure 7 This is a graph showing the purification and washing results of the antibody-nucleic acid complex.

[0076] Figure 8 The diagram shows the detection performance; where a is a fluorescent droplet image of CD9+EVs detected by the constructed platform for EVs samples at different dilutions; b is the detection result of comparing the detection method constructed in this invention with the traditional protein detection method - ELISA; c is a schematic diagram of plasma samples containing EVs and non-EVs components; d is the anti-interference experiment result of plasma matrix components; and e is the anti-interference experiment result of soluble proteins.

[0077] Figure 9 This is a clinical performance evaluation chart of single-vesicle digital detection of EV surface protein biomarker characteristics based on the present invention; where af are scatter plots of the detection of ZnRF3+EVs, EpCAM+EVs, LPS+EVs, VacA+EVs, CD3+EVs, and CD97+EVs in plasma samples of healthy controls (n=21), benign gastric diseases (n=18), and gastric cancer (n=40), respectively; g is a bar chart of the concentration results of the above six protein-positive EVs subgroups; h is a radar chart of the distribution of the above six protein-positive EVs subgroups in the three types of samples; and i is the GC-EVs biomarker combination composed of the above six protein-positive EVs subgroups and the transmission... The diagnostic efficacy of the traditional tumor screening biomarkers CEA and CA199 was compared between healthy controls and patients with gastric diseases using ROC curve analysis. j represents the diagnostic sensitivity and specificity of the combination of the above biomarkers and the traditional tumor screening biomarkers CEA and CA199. k represents the efficacy of the GC-EVs biomarker combination in distinguishing between healthy controls and patients with gastric diseases, as shown by tSNE dimensionality reduction. l represents the ROC analysis results of the GC-EVs biomarker combination and the traditional tumor screening biomarkers CEA and CA199 in healthy individuals and individuals with benign gastric diseases. m represents the ROC analysis results of the GC-EVs biomarker combination and the traditional tumor screening biomarkers CEA and CA199 between benign and gastric cancers.

[0078] Figure 10This is a graph showing the clinical performance evaluation results of single-vesicle digital detection of methylated DNA markers on the surface of EVs based on this invention; where a is a scatter plot of the detection of 5-mC DNA+EVs in plasma samples of healthy controls (n=20), benign gastric diseases (n=15), and gastric cancer (n=60); b is a scatter plot of the detection of 5-hmC DNA+EVs in plasma samples of healthy controls (n=20), benign gastric diseases (n=15), and gastric cancer (n=60); c is a bar chart of the detection concentration of 5-mC DNA+EVs in plasma samples of healthy controls (n=20), benign gastric diseases (n=15), and gastric cancer (n=60); d is a bar chart of the detection concentration of 5-hmC DNA+EVs in plasma samples of healthy controls (n=20), benign gastric diseases (n=15), and gastric cancer (n=60); and e is a bar chart based on the detection concentration of 5-mC DNA+EVs and 5-hmC... ROC analysis results of the diagnostic efficacy of DNA+EVs detection in distinguishing healthy controls from gastric cancer, where f represents the ROC analysis results of the diagnostic efficacy of 5-mC DNA+EVs and 5-hmC DNA+EVs detection in distinguishing benign gastric diseases from gastric cancer. Detailed Implementation

[0079] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0080] Example 1

[0081] 1. Materials

[0082] 1.1 Cell lines

[0083] Human gastric cancer cell lines: MKN-28 and AGS, purchased from Wuhan Pronosei Life Science Technology Co., Ltd., and stored in liquid nitrogen.

[0084] 1.2 Main Reagents and Consumables

[0085] Table 1. List of Main Reagents and Consumables

[0086]

[0087] Table 2 Summary of Instrument Names and Manufacturers

[0088] Droplet generator Zhejiang Dapu Biotechnology Co., Ltd. Droplet Analysis Instrument Zhejiang Dapu Biotechnology Co., Ltd. Gene Amplification Instrument Hangzhou Borui Technology Co., Ltd.

[0089] Table 3. List of tetrahedral sequences required for the experiment.

[0090] name Sequence (5'→3') concentration S1 TATCACCAGGCAGTTGACAGTGTAGCAAGCTGTAATAGATGCGAGGGTCCAATACTTTGCGGCGAAATATTAT 10μM S2 TCAACTGCCTGGTGATTTAACGACACTACGTGGGAATCTACTATGGCGGCTCTTCTTTGCGGCGAAATATTAT 10μM S3 TTCAGACTTAGGAATGTGCTTCCCACGTAGTGTCGTTTGATTTGGACCCTCGCATTTTGCGGCGAAATATTAT 10μM S4-bio ACATTCCTAAGTCTGAAACATTCAGCTTGCTACACGAGAAGAGCCGCCATAGTATT-Biotin 10μM Cho-S-RNA cholesteryl-AUAAUAUUUCGCCGCA 20μM

[0091] Table 4. List of DNA sequences required for the experiment

[0092]

[0093] 2. Methods

[0094] 2.1 Construction and Validation of DNA Tetrahedrons

[0095] (1) Preparation of buffer solution: Weigh 1.2114g Tris-base, 3.6525g NaCl and 0.7455g KCl into a 500mL container, add deionized water to make up to 500mL, dissolve and adjust the pH to 7.5, and store at 4℃.

[0096] (2) Construction of DNA tetrahedrons:

[0097] Table 5. Sample loading system for tetrahedral construction.

[0098]

[0099] It was then placed in a thermal cycler and subjected to the following procedure: 95℃ for 5 min; 25℃ for ∞.

[0100] (3) Verification of the self-assembly of DNA tetrahedra:

[0101] A 2% agarose gel was pre-prepared, and groups containing different DNA tetrahedral components were set up (S1, S2, S1+S2, S3, S1+S2+S3, S4, S1+S2+S3+S4). After the reaction was completed on a thermal cycler according to the above procedure, 6× loading buffer was added, and finally, agarose gel electrophoresis was performed for verification. Simultaneously, DNA tetrahedra were constructed and analyzed by atomic force microscopy to verify successful self-assembly. Specific results are shown in [link to results]. Figure 2 It can be seen that the DNA strands can complement each other and self-assemble to form a relatively uniform nanostructure.

[0102] 2.2 Construction of Functionalized Magnetic Beads and Feasibility Verification of Their Application in Reversible Separation and Enrichment of EVs

[0103] (1) Prepare DNA tetrahedra according to Table 5;

[0104] (2) Add 3 μL of 20 μM Cho-S-RNA to each tetrahedron and react at room temperature for 1 h;

[0105] (3) Add the above reaction system to 2 μL of streptavidin magnetic beads with a concentration of 10 mg / mL, mix thoroughly, and react at room temperature for 1 h on a mixer to prepare a modified magnetic bead.

[0106] (4) Place the system obtained in step (3) on a magnetic rack and magnetically remove the supernatant. Add avidin site blocking agent (Biotin Detection Blocking Kit, P0101, Beyotime), with 0.05 μL of avidin site blocking agent per sample of modified magnetic beads. React at room temperature for 5 min on a mixer, magnetically remove the supernatant, wash once with PBS, and finally resuspend each sample of blocked modified magnetic beads in 2 μL of PBS to obtain functionalized magnetic beads.

[0107] (5) The functionalized magnetic beads constructed above were subjected to the following experiments: The functionalized magnetic beads were incubated with PBS at room temperature for 1 h, washed once with PBS, and used as the negative control group; 2 μL of functionalized magnetic beads were incubated with 1 μL of EVs sample (extracted from 20 mL of plasma according to the "2.4 EVs extraction" section, where the plasma sample and PBS were mixed at a volume ratio of 1:1) at room temperature for 1 h, washed once with PBS, and used as the positive group; 2 μL of functionalized magnetic beads were incubated with 1 μL of EVs sample at room temperature for 1 h, washed once with PBS, and then 0.3 μL of RNase H (60 U / μL) and 49.7 μL of the corresponding reaction buffer (i.e., RNase H reaction buffer diluted 1000 times with PBS) were added for enzymatic digestion for 1 h, and used as the digestion group (RNase H digestion). The samples from all three groups were subsequently examined using scanning electron microscopy to verify the feasibility of using functionalized magnetic beads for the reversible separation and enrichment of EVs. Specific results are shown in [link to results]. Figure 3 As can be seen from the results, compared to the PBS control group, the surface of the magnetic beads in the EVs group exhibited nanoscale vesicle-like structures. After RNase H digestion, the EVs were released, and the surface of the magnetic beads was similar to that of the blank control group, with no vesicle-like structures observed, indicating that the functionalized magnetic beads can reversibly enrich EVs. To ensure a more efficient EV capture effect, the amount of magnetic beads and the incubation time for both magnetic beads and EVs were optimized, as shown below. Figures 4-5 The results of nanoflow cytometry analysis are shown. Figure 4 In the figure, 'a' represents the concentration of the EVs sample before incubation with functionalized magnetic beads, and 'be' represents the concentration of the remaining EVs sample after incubation of 1 μL of EVs sample with different amounts of functionalized magnetic beads (1 μL, 2 μL, 4 μL, 6 μL) (incubation volume of 50 μL). The concentrations of EVs were calculated using (C... 捕获EVs =C 捕获前 -C 捕获后 The EV capture concentrations were obtained at different amounts of functionalized magnetic beads, as shown in f. The experimental results show that the captured EVs increase with the increase of functionalized magnetic bead dosage. However, after exceeding 2 μL of functionalized magnetic beads, the increase in captured EVs gradually decreases with further increases in dosage, indicating that 2 μL of functionalized magnetic beads is sufficient to capture EVs. Figure 5In the figure, 'a' represents the concentration of the EVs sample before incubation with functionalized magnetic beads, and 'be' represents the concentration of the remaining EVs sample after incubation of 1 μL of EVs sample with 2 μL of functionalized magnetic beads (incubation volume of 50 μL) for different times (10 min, 20 min, 40 min, 60 min). The concentrations of EVs were calculated using (C...). 捕获EVs =C 捕获前 -C 捕获后 The EV capture concentrations at different incubation times were obtained, as shown in f. The results showed that after an incubation time of more than 20 min, the increase in captured EVs did not increase significantly, and 20 min was finally selected as the incubation time for subsequent experiments.

[0108] 2.3 Construction of Functionalized Magnetic Beads and Evaluation of EV Capture Efficiency: EV samples were divided into four equal parts (100 μL each). Two parts were used for evaluating EV separation efficiency by ultracentrifugation (one part was the original concentration control, and the other part was centrifuged at 120,000 g for 45 min using a 355645 ultracentrifugation tube, with PBS added to a final volume of 4 mL, and the mixture was discarded and resuspended in 100 μL of PBS). The other two parts were used for evaluating the EV separation efficiency of the newly constructed reversible EV separation and enrichment system (one part was the original concentration control, and the other part was digested with 0.3 μL L Nase H after adsorption with functionalized magnetic beads, with a reaction volume of 100 μL for each part). 2 μL of functionalized magnetic beads were used for each 100 μL EV sample. The EV concentrations before and after enrichment were measured using nanoflow cytometry, and the EV separation efficiency was calculated using the following formula: Separation efficiency = C EVs-after / C EVs-before *100%, see details for specific results. Figure 6 The results showed that the average EV separation efficiency of the functionalized magnetic beads provided by the present invention was 94.97%, which was significantly higher than that of ultracentrifugation (40.54%).

[0109] 2.4 EVs extraction

[0110] (1) Extraction of EV from cell supernatant:

[0111] ① Resuscitate gastric cancer cells MKN-28 (the culture medium used was obtained by adding 10% volume of fetal bovine serum and 1% volume of penicillin G in RPMI 1640, the penicillin G composition was 10 kU / mL penicillin G sodium salt and 10 mg / mL streptomycin sulfate) and AGS cell line (the culture medium used was obtained by adding 10% v / v fetal bovine serum and 1% v / v penicillin G in Ham's F12), centrifuge at 800 rpm for 3 min, resuspend and seed in culture dishes, and culture at 37℃ and 5% CO2. When the cell density reaches 70-80%, perform cell passage treatment; when the cell growth density reaches about 60%, replace the supernatant with basal medium containing only 1% penicillin G and starve for 12 h, then replace the supernatant with medium containing 1-3% v / v exosome-free serum (commercially available) and 1% v / v penicillin G and culture for 36-48 h, and finally collect the cell supernatant;

[0112] ② Pretreatment of cell supernatant: First, centrifuge at 3000g for 20min, collect the supernatant, then centrifuge at 16000g for 30min, collect the supernatant again;

[0113] ③ Ultracentrifugation to extract EVs: Add the pretreated cell supernatant to an ultracentrifuge tube (catalog number: 326823, Beckman), and centrifuge at 135000g for 70 min using a 32Ti rotor. Discard the supernatant, resuspend in PBS, and centrifuge again at 135000g for 70 min. Discard the supernatant, and centrifuge 500mL of cell supernatant. The resulting precipitate is then resuspended in 100μL of PBS. Store the resuspended EVs sample at -80℃ for later use.

[0114] (2) Extraction of plasma EVs:

[0115] ① Take a whole blood sample treated with EDTA anticoagulation, centrifuge at 2500g for 15min, repeat twice, and collect the plasma supernatant.

[0116] ② Dilute the plasma sample with PBS at a volume ratio of 1:1 to 1:3. Then, extract plasma EVs from the diluted plasma sample according to the above pretreatment and ultracentrifugation steps. The precipitate obtained from the 30-60 mL diluted plasma is resuspended in 100 μL of PBS and stored at -80℃ for later use.

[0117] 2.5 Preparation and purification of antibody-coupled nucleic acid complexes

[0118] (1) Preparation and purification of antibody-nucleic acid complexes: Following the Streptavidin Conjugation Kit-Lightning- The kit instructions describe the preparation of avidinized antibodies: Mix 10 μg of antibody with 1 μL of LL-modifier, vortex to mix, and then add Lightning- The reaction mixture was placed in a mix flask and incubated at room temperature in the dark for 3 hours. Then, 1 μL of LL-quencher was added to terminate the reaction, and the mixture was incubated at room temperature for 30 minutes to obtain an avidinized antibody solution. Take one of the prepared avidinized antibody solutions (containing 1 μg of avidinized antibody) and add 0.5 μL of 10 μM biotin-labeled DNA (i.e., DNA1 or DNA2). The mixture was incubated at room temperature for 1 hour to obtain an antibody-nucleic acid complex. Subsequently, the antibody-nucleic acid complex was diluted to 500 μL with PBS, and 2 μL of avidinized magnetic beads (10 mg / mL) was added. The mixture was incubated at room temperature for 1 hour, and the supernatant was magnetically collected. The purification process was repeated 3-6 times (i.e., repeatedly mixing the supernatant with avidin magnetic beads to remove free biotin-labeled DNA, and then magnetically collecting the supernatant). Finally, the purified supernatant was collected to obtain the purified antibody-nucleic acid complex, which was stored at 4°C for later use. The purification effect was verified by subsequent ddPCR.

[0119] (2) Verification of antibody-nucleic acid complex purification effect: Take 2 μL of the functionalized magnetic beads prepared in step 2.2, add 2 μL of antibody-nucleic acid complex, react at room temperature for 60 min, then wash twice with washing buffer (RNase H reaction buffer diluted 1000 times with PBS), resuspend the magnetic beads in 30 μL of enzyme reaction buffer (RNase H reaction buffer diluted 1000 times with PBS), then add 0.3 μL of RNase H enzyme, react at room temperature for 1 h, collect the supernatant, rinse the magnetic beads once with 30 μL of PBS, collect the supernatant into the same EP tube, and then perform ddPCR reaction according to the sample loading system in Table 6 to verify the purification effect. See the specific results below. Figure 7 The results showed that, compared with the positive control group (i.e., the purified antibody-nucleic acid complex obtained in the previous step), the signal generated by the non-specific adsorption of the antibody-nucleic acid complex was significantly reduced after purification and washing (i.e., the wash group), with no significant difference from the PBS blank control group. In this experiment, CD63 antibody-DNA1 complex and CD9 antibody-DNA2 complex were prepared, respectively. Forward primer1, Reverse primer1, and Probe1 in Table 4 correspond to DNA1, while Forward primer2, Reverse primer2, and Probe2 correspond to DNA2.

[0120] Table 6. Preparation of sample loading systems related to purification validation.

[0121]

[0122] The ddPCR reaction system was prepared by adding 5 μL of the sample to the system listed in Table 6, mixing thoroughly, generating droplets, and then performing the amplification reaction in a thermal cycler according to the following program: 95℃ for 5 min; 94℃ for 30 s, 60℃ for 1 min, 45 cycles; 4℃: ∞. Finally, the signal was read and analyzed using a droplet analyzer.

[0123] 2.6 Detection Performance Evaluation

[0124] (1) Sensitivity verification: EVs samples were diluted with PBS at volume ratios of 1:1, 1:2, 1:10, 1:100, and 1:1000 to prepare EVs samples of different concentrations. Each EVs sample was divided into two equal parts. One part was used for CD9 assay with an ELISA kit (CSB-EL004969HU, Cusabio). + EV concentration was detected using a novel method, as follows: 1 μL of diluted plasma EV sample was first mixed with 0.5 μL of RNA inhibitor (RNasin), followed by the addition of 2 μL of functionalized magnetic beads. The mixture was incubated at room temperature for 20 min, then 2 μL of purified CD9 antibody-DNA2 complex (obtained according to procedure 2.5) was added. The mixture was then incubated at room temperature for 1 h. After the reaction, the supernatant was discarded, and the sample was washed twice with washing buffer (RNase H reaction buffer diluted 1000 times with PBS). The mixture was resuspended in 30 μL of enzyme reaction buffer (RNase H reaction buffer diluted 1000 times with PBS), and then 0.3 μL of RNase H enzyme was added. The mixture was incubated at room temperature for 1 h, and the supernatant was collected. The magnetic beads were rinsed once with 30 μL of PBS, and the supernatant was collected into the same EP tube. ddPCR was then performed according to the sample loading system in Table 6 to detect CD9. + EV concentration was detected; see the results below. Figure 8 , Figure 8 As shown in ab, the detection signal value increases with the increase of EV concentration, and there is a linear relationship. Compared with the ELISA method, the detection sensitivity (LOD: 6.94±3.39EVs / μL) of the method constructed in this invention is 4 orders of magnitude higher than that of ELISA.

[0125] (2) Specificity verification:

[0126] ① Plasma matrix experiment: PBS was used as a blank control, and EVs samples were used as a positive control. Two experimental groups were formed: extracellular vesicle-free plasma matrix samples (supernatant obtained by partial ultracentrifugation 5-6 times according to section 2.4) and extracellular vesicle-free plasma matrix with purified EVs samples added. A novel method was constructed for detection: Samples were first mixed with 0.5 μL of RNA inhibitor (RNasin), followed by 2 μL of functionalized magnetic beads. The mixture was incubated at room temperature for 20 min. 2 μL of purified CD63 antibody-DNA1 complex and CD9 antibody-DNA2 complex were added to each tube, and the mixture was incubated at room temperature for 1 h. After the reaction, the supernatant was discarded, and the samples were washed twice with washing buffer (RNase H reaction buffer diluted 1000 times with PBS). The mixture was resuspended in 30 μL of enzyme reaction buffer (RNase H reaction buffer diluted 1000 times with PBS), followed by 0.3 μL of RNase H enzyme. The mixture was incubated at room temperature for 1 h, and the supernatant was collected. 30 μL of the supernatant was then added. Rinse the magnetic beads once with PBS, collect the supernatant into the same EP tube, then prepare the sample loading system according to Table 7, add 5 μL of sample, and perform ddPCR reaction according to the above procedure to target CD9. + EVs and CD63 + The concentration of EVs was also detected simultaneously; see the results below. Figure 8 , Figure 8 The data in the d- ... + EVs and CD63 + The EVs signal was similar to that of the blank control group, but when 1 μL of EVs sample was incorporated into 100 μL of extracellular vesicle-free plasma matrix sample, a significant CD9 response was detected. + EVs and CD63 + The EVs signal was similar to that of the positive control group (EVs sample), indicating that this method is not affected by plasma matrix components.

[0127] Table 7 Premixed solution addition system

[0128]

[0129] Note: *Preparation of Primer mix: Take 4.5 μL of 100 μM Forward primer1, Reverse primer1, Forward primer2, and Reverse primer2 respectively, add 32 μL of TE buffer, and bring the volume to 50 μL to prepare a 10× Primer mix.

[0130] ② Soluble protein interference experiment: PBS was used as a blank control, and EVs samples were used as positive controls. 10 μL of soluble proteins CD9 and CD63 (1 mg / mL) were added to 1 μL of EVs samples to form two experimental groups. The specific steps of the newly constructed method described above were used to investigate the interference of CD9. + EVs and CD63 + The concentration of EVs was also detected simultaneously; see the results below. Figure 8 , Figure 8 The value of 'e' in the figure shows that the signal value did not increase significantly relative to the EVs sample when a large amount of soluble protein was added, indicating that this method is not affected by soluble protein.

[0131] 2.2.7 Clinical specimen testing performance evaluation

[0132] (1) Take 100 μL of pretreated gastric cancer patient plasma sample, add 200 μL PBS to dilute to a total volume of 300 μL, add 0.5 μL RNA inhibitor (RNasin) and mix at room temperature, then add 2 μL functionalized magnetic beads, mix and place in a mixer to react at room temperature for 20 min.

[0133] (2) Discard the supernatant, wash once with 50 μL PBS and resuspend, add 2 μL of purified antibody nucleic acid complex, mix well and place in a mixer at room temperature for 1 h;

[0134] (3) Prepare washing buffer using RNase H-compatible reaction buffer, i.e., mix reaction buffer and PBS at a volume ratio of 1:1000 and incubate at 37°C. Then wash the magnetic beads after reaction in step (2) with 50 μL of washing buffer to remove unbound antibody-nucleic acid complexes. Repeat twice. Finally, resuspend the magnetic beads with 30 μL of washing buffer, add 0.3 μL of RNase H, mix well, and incubate at room temperature for 1 h.

[0135] (4) Collect the supernatant of magnetic absorption, then add 30 μL of PBS to wash the magnetic beads once, collect the supernatant, and obtain a total volume of 60 μL of supernatant;

[0136] (5) Prepare the premixed solution according to Table 7 above;

[0137] (6) Then, 5 μL of the supernatant from step (4) was added to the premixed solution, mixed well, and droplet generation was carried out. The amplification reaction was carried out in a thermal cycler according to the following program: 95℃ for 5 min; 94℃ for 30 s, 60℃ for 1 min, 45 cycles; 4℃ for ∞.

[0138] Finally, signal reading and analysis were performed on a droplet analysis instrument. Digital detection of common surface molecular markers such as EV surface proteins and methylated DNA was conducted at the single-vesicle level. Specific results are shown in [link to results]. Figure 9 and Figure 10 .in, Figure 9 The sample consisted of 21 healthy individuals, 18 patients with benign gastric diseases, and 40 patients with gastric cancer. Figure 10 The sample consisted of 20 healthy individuals, 15 patients with benign gastric diseases, and 60 patients with gastric cancer.

[0139] from Figure 9 As can be seen from the ag data, the levels of ZnRF3, EpCAM, LPS, VacA, CD3, and CD97 in the plasma EVs of gastric cancer patients were significantly higher than those in the healthy control group. Figure 9 The h in the figure is based on the GC-EVs signature, which consists of the aforementioned 6 proteins. It can be seen that the expression levels are different in healthy controls, patients with benign gastric diseases, and patients with gastric cancer. Figure 9 In the figure, 'i' represents ROC analysis, showing that GC-EVs signature can effectively distinguish between healthy controls and gastric disease groups (covering both benign and gastric cancer groups). AUC and sensitivity (see [reference needed]) Figure 9 The specificity of the samples in the study was higher than that of plasma biomarkers CEA and CA199 detected by traditional methods. Figure 9 In the figure, k represents dimensionality reduction analysis, which shows that GC-EVs signature can effectively distinguish between healthy controls and the gastric disease group. Figure 9 The 'l' in the figure represents ROC analysis, showing that this can also be used to analyze healthy and benign conditions, as well as (see...). Figure 9 The m) markers effectively distinguished between benign and gastric cancer, with AUCs significantly higher than those of traditional markers (CEA, CA199). Figure 9 The results demonstrate that the detection of a panel of six protein markers using this invention can effectively distinguish between gastric cancer and benign or healthy individuals, proving that this method has great potential for application in the detection of molecular markers on the surface of EVs in clinical samples to explore their clinical application value.

[0140] Figure 10This report presents the clinical performance evaluation results of a novel method for digital detection of methylated DNA biomarkers on the surface of gastric vesicles (EVs). The results show that different types of methylated DNA biomarkers (5-mC and 5-hmC) exist on the surface of EVs, and the levels of 5-mC+EVs and 5-hmC+EVs in gastric cancer patients were significantly higher than those in healthy individuals and those with benign gastric diseases. The ROC analysis of the results shows that the combined use of 5-mC+EVs and 5-hmC+EVs can effectively distinguish gastric cancer patients from healthy controls or those with benign gastric diseases, with an AUC > 0.90, indicating high diagnostic efficacy.

[0141] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A method for digital detection of microdroplets containing molecular markers on the surface of single vesicles, characterized in that... Includes the following steps: (1) A DNA tetrahedron with a rigid structure is bound to a cholesterol-modified RNA capture probe through three fulcrums, and then bound to a magnetic bead through a fourth fulcrum to obtain a functionalized magnetic bead. (2) Add RNase inhibitor to the sample to be tested to obtain the treated sample; mix the functionalized magnetic beads with the treated sample evenly, and capture the extracellular vesicles by binding cholesterol to them; then add the antibody-nucleic acid complex for incubation, and then perform solid-liquid separation on the product obtained from incubation, take the solid, wash it, and obtain the magnetic beads with extracellular vesicles connected to the antibody-nucleic acid complex; or mix the functionalized magnetic beads with the treated sample evenly and then perform solid-liquid separation to obtain the magnetic beads enriched with extracellular vesicles, then incubate with the antibody-nucleic acid complex, perform solid-liquid separation, wash it, and obtain the magnetic beads with extracellular vesicles connected to the antibody-nucleic acid complex. (3) Place the magnetic beads with extracellular vesicles connected to antibody-nucleic acid complexes into a reaction system containing RNase H enzyme, react, take the supernatant, and recover to obtain functionalized magnetic beads. (4) The supernatant obtained in step (3) is subjected to microdroplet digital detection to obtain information on molecular markers on the surface of single vesicles.

2. The method for digital detection of microdroplets containing molecular markers on the surface of single vesicles according to claim 1, characterized in that: The DNA tetrahedron described in step (1) consists of four strands, one of which is modified with biotin; The RNA in the cholesterol-modified RNA described in step (1) is partially or completely complementary to the extended end.

3. The method for digital detection of microdroplets containing molecular markers on the surface of single vesicles according to claim 2, characterized in that: The nucleic acid sequences of the four strands are as follows: S1: 5'-TATCACCAGGCAGTTGACAGTGTAGCAAGCTGTAATAGATGCGAGGGTCCAATACTTTGCGGCGAAATATTAT-3'; S2: 5'-TCAACTGCCTGGTGATTTAACGACACTACGTGGGAATCTACTATGGCGGCTCTTCTTTGCGGCGAAATATTAT-3'; S3: 5'-TTCAGACTTAGGAATGTGCTTCCCACGTAGTGTCGTTTGATTTGGACCCTCGCATTTTGCGGCGAAATATTAT-3'; S4-bio: 5'-ACATTCCTAAGTCTGAAACATTACAGCTTGCTACACGAGAAGAGCCGCCATAGTATT-Biotin-3'; The sequence of the cholesterol-modified RNA is as follows: Cho-S-RNA: 5'-cholesteryl-AUAAUAUUUCGCCGCA-3'.

4. The method for digital detection of microdroplets containing molecular markers on the surface of single vesicles according to claim 3, characterized in that: Step (1) is as follows: A. Prepare a 20 μL DNA tetrahedral reaction system, react, and obtain DNA tetrahedra; the 20 μL reaction system contains: S1 1 μM, S2 1 μM, S3 1 μM, S4 1 μM, Mg 2+ 5mM, 2μL buffer; Buffer composition: Tris-base 2.4228g / L, NaCl 7.305g / L, KCl 1.491g / L, pH 7.4~7.6; B. Add 3 μL of 20 μM Cho-S-RNA and react; C. Add the product obtained in step B to 2 μL of streptavidin magnetic beads with a concentration of 10 mg / mL, mix thoroughly, and allow to react; D. Perform solid-liquid separation on the product obtained in step C, add 0.05 μL of avidin site blocking agent to the obtained solid, react, and then perform solid-liquid separation again. Wash the obtained solid with PBS and resuspend it with 2 μL of PBS to obtain functionalized magnetic beads.

5. The method for digital detection of microdroplets containing molecular markers on the surface of single vesicles according to claim 4, characterized in that: The sample to be tested in step (2) is plasma supernatant; The antibody-nucleic acid complex described in step (2) is prepared by the following steps: conjugating an antibody with avidin to obtain an avidinized antibody; reacting the avidinized antibody with biotin-labeled DNA, and then adding streptavidin magnetic beads to obtain the antibody-nucleic acid complex; The solvent used in the washing process described in step (2) is PBS or RNase H reaction buffer diluted with PBS; In step (2), the amount of each component used is the treated sample, functionalized magnetic beads and antibody-nucleic acid complex in a ratio of 1-300 μL: 2 μL: 2 μL; The amount of RNase H enzyme used in step (3) is 15-20 U RNase H per 2 μL of extracellular vesicles connected with antibody-nucleic acid complexes obtained by enriching functionalized magnetic beads. The reaction system described in step (3) consists of: RNase H enzyme and RNase H reaction buffer; The system for digital detection of microdroplets described in step (4) is as follows: each 20 μL reaction system contains Mix 1×, upstream primer 900 nM, downstream primer 900 nM, probe 400 nM, supernatant 5 μL, and DNase-free water as the remainder.

6. The method for digital detection of microdroplets containing molecular markers on the surface of single vesicles according to claim 5, characterized in that: The reaction conditions described in step A are 95℃ for 5 min; 25℃ for ∞; The reaction time described in step B is 30–90 min; The reaction time described in step C is 30–90 min; The reaction time described in step D is 3 to 10 minutes; The mixing time described in step (2) is 10–60 min; The incubation time mentioned in step (2) is 30 to 90 minutes; The reaction time described in step (3) is 30–90 min; The amplification reaction conditions for the digital detection of microdroplets described in step (4) are as follows: 95℃ for 5 min; 94℃ for 30 s, 60℃ for 1 min, 45 cycles; 4℃ for ∞.

7. The application of the microdroplet digital detection method for molecular markers on the surface of single vesicles according to any one of claims 1 to 6 in the isolation of extracellular vesicles and the acquisition of surface proteins or DNA methylation markers of EVs.

8. The application according to claim 7, characterized in that: The aforementioned protein or DNA methylation markers on the surface of EVs are tumor markers on the surface of EVs.

9. A diagnostic marker for gastric cancer, characterized in that: It consists of ZnRF3, EpCAM, LPS, VacA, CD3 and CD97 from plasma EVs.

10. A DNA methylation marker for gastric cancer diagnosis, characterized in that: It consists of 5-mC and 5-h-mC from plasma EVs.

Images