Automatic chemiluminescence detection reagent for porcine reproductive and respiratory syndrome virus N antibody and application thereof

Abstract

The application discloses a kind of for pig reproductive and respiratory syndrome virus N antibody full-automatic chemiluminescence detection reagent and its application, belong to biotechnology field.The detection reagent includes: serum diluent, first reagent and second reagent;The first reagent includes the magnetic microparticle coated with pig reproductive and respiratory syndrome virus N protein;The second reagent includes aziridine ester labeled anti-pig antibody.It can accurately detect pig reproductive and respiratory syndrome virus N antibody, and has high sensitivity, good specificity, strong anti-interference, high precision, short reaction time, simple operation, automation, provides material guarantee and technical support for pig reproductive and respiratory syndrome disease prevention and control, has important significance.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a fully automated chemiluminescent detection reagent for porcine reproductive and respiratory syndrome virus (PRRSV) N antibody and its application. Background Technology

[0002] Porcine reproductive and respiratory syndrome (PRRS) is a highly contagious and virulent infectious disease of pigs caused by the PRRS virus (PRRSV), commonly known as blue ear disease. Its characteristic clinical manifestations include reproductive disorders in sows (abortion rates can reach 20%-50%), respiratory syndrome in piglets (morbidity rate 30%-80%), and an increased risk of secondary infections, causing significant economic losses to the pig farming industry. Currently available conventional vaccines cannot provide sustainable disease control because they are affected by both the virus's immune evasion strategies and the antigenic heterogeneity of wild-type strains. Therefore, early and accurate diagnosis plays a crucial role in the eradication and purification of PRRSV.

[0003] Currently, PRRSV detection primarily employs traditional ELISA and plate-based chemiluminescence assays. Traditional ELISA is time-consuming and lacks both specificity and sensitivity. Plate-based chemiluminescence assays still mainly utilize solid-phase carriers and are primarily used for horseradish peroxidase-catalyzed luminol flashes, with a precision of 5%-7% and a linear range of 100-500 times. Therefore, providing a highly specific and sensitive diagnostic reagent for PRRSV is crucial. Summary of the Invention

[0004] This invention aims to at least solve one of the technical problems existing in the prior art. To this end, this invention proposes a fully automated chemiluminescent detection reagent for detecting porcine reproductive and respiratory syndrome virus (PRRSV) N antibody, which features high sensitivity, good specificity, strong anti-interference, high precision, rapid detection, full automation, and high throughput, meeting the need for ease of operation in clinical testing.

[0005] The present invention also provides applications of the above-described detection reagents.

[0006] A detection reagent for detecting porcine reproductive and respiratory syndrome virus N antibody according to a first aspect of the present invention comprises: a serum diluent, a first reagent, and a second reagent;

[0007] The serum diluent comprises the following components at the following concentrations: 0.005 M–0.05 M PBS buffer, 0.05% w / v–1% w / v casein, 0.05% w / v–1% w / v hydroxypropyl-β-cyclodextrin, 1 mM–5 mM EDTA, 1% w / v–3% w / v trehalose, 0.01% w / v–0.1% w / v Tween-20, and 0.05–0.2% w / v Proclin 300;

[0008] The first reagent comprises magnetic microparticles coated with porcine reproductive and respiratory syndrome virus N protein (PRRSV-N);

[0009] The second reagent includes an acridinium ester-labeled anti-pig antibody.

[0010] The detection reagent according to embodiments of the present invention has at least the following beneficial effects:

[0011] Magnetic microparticles, as carriers, have a high specific surface area, enabling them to react more fully with the sample. Combined with an external magnetic field, they can detect target substances more quickly.

[0012] Compared to enzymatic and electrochemiluminescence methods, the direct chemiluminescence immunoassay technique using acridinium ester as the luminescent substance in the detection reagents of this example has the following advantages:

[0013] 1) The chromogenic enzymes used in the enzymatic method are easily affected by factors such as transportation conditions, environmental pH, and batch-to-batch differences; electrochemiluminescence requires three electrodes to carry out a complex reaction between an unknown and multiple electroactive samples; while acridine esters do not require any catalysts, have fewer interfering factors in the luminescence reaction process, and have high light efficiency, high intensity, can be quickly concentrated, and the labeled substances are stable and can usually be stored for several months under conditions of 2℃-8℃.

[0014] 2) Enzymatic luminescence is glow discharge, which reflects the rate at which the enzyme decomposes the substrate (rate method); electrochemiluminescence is electro-excitation flash, which carries the risk of cross-contamination with repeated use; while direct chemiluminescence is flash, which only requires the integral of the light intensity curve over a short period of time (integral method), and has a better linear relationship.

[0015] The detection reagents in this embodiment are highly sensitive, specific, resistant to interference, and precise, with excellent repeatability and a wide linear range, and can accurately identify whether porcine reproductive and respiratory syndrome virus N antibodies are present in the test substance.

[0016] According to some embodiments of the present invention, the method for preparing the magnetic microparticles coated with porcine reproductive and respiratory syndrome virus N protein includes the following steps:

[0017] After coupling magnetic microparticles with carboxyl active groups on their surface to the porcine reproductive and respiratory syndrome virus (PRRSV) N protein, a first blocking process is performed; the mass ratio of the magnetic microparticles to the PRSV N protein is 1000:(1-3). For example, it can be 1000:1, 1000:1.5, 1000:2, 1000:2.5, or 1000:3.

[0018] According to some embodiments of the present invention, the particle size of the magnetic particles is 1 μm-3 μm. For example, it can be 1 μm, 1.2 μm, 1.4 μm, 1.6 μm, 1.8 μm, 2 μm, 2.2 μm, 2.4 μm, 2.6 μm, 2.8 μm or 3 μm.

[0019] According to some embodiments of the present invention, the concentration of porcine reproductive and respiratory syndrome virus (PRRSV) N protein coated by the magnetic microparticles is 5 μg / mL to 60 μg / mL. For example, it can be 5 μg / mL, 10 μg / mL, 15 μg / mL, 20 μg / mL, 25 μg / mL, 30 μg / mL, 35 μg / mL, 40 μg / mL, 45 μg / mL, 50 μg / mL, 55 μg / mL, or 60 μg / mL.

[0020] According to some embodiments of the present invention, the concentration of porcine reproductive and respiratory syndrome virus (PRRSV) N protein coated with the magnetic microparticles is 18 μg / mL to 22 μg / mL. This allows the detection reagent to have better sensitivity and specificity.

[0021] According to some embodiments of the present invention, the magnetic microparticles with carboxyl active groups on their surface need to be activated before the coupling reaction. The activation treatment includes the following steps:

[0022] The cleaned magnetic microparticles are activated by reacting with EDC and NHS. This fully activates the carboxyl active groups on the magnetic microparticles, enabling better protein coupling.

[0023] According to some embodiments of the present invention, the concentration of the magnetic particles during activation is 1 mg / mL to 20 mg / mL. For example, it can be 1 mg / mL, 2 mg / mL, 3 mg / mL, 4 mg / mL, 5 mg / mL, 6 mg / mL, 7 mg / mL, 8 mg / mL, 9 mg / mL, 10 mg / mL, 11 mg / mL, 12 mg / mL, 13 mg / mL, 14 mg / mL, 15 mg / mL, 16 mg / mL, 17 mg / mL, 18 mg / mL, 19 mg / mL, or 20 mg / mL.

[0024] According to some embodiments of the present invention, the concentration of the EDC during activation is 0.5 mg / mL to 25 mg / mL. For example, it can be 0.5 mg / mL, 1 mg / mL, 2 mg / mL, 4 mg / mL, 5 mg / mL, 6 mg / mL, 7 mg / mL, 8 mg / mL, 10 mg / mL, 12 mg / mL, 14 mg / mL, 16 mg / mL, 18 mg / mL, 20 mg / mL, 22 mg / mL, 24 mg / mL, or 25 mg / mL.

[0025] According to some embodiments of the present invention, the concentration of NHS during activation is 0.5 mg / mL to 25 mg / mL. For example, it can be 0.5 mg / mL, 1 mg / mL, 2 mg / mL, 4 mg / mL, 5 mg / mL, 6 mg / mL, 7 mg / mL, 8 mg / mL, 10 mg / mL, 12 mg / mL, 14 mg / mL, 16 mg / mL, 18 mg / mL, 20 mg / mL, 22 mg / mL, 24 mg / mL, or 25 mg / mL.

[0026] According to some embodiments of the present invention, the activation temperature is 16℃-37℃. For example, it can be 16℃, 17℃, 18℃, 19℃, 20℃, 21℃, 22℃, 23℃, 24℃, 25℃, 26℃, 27℃, 28℃, 29℃, 30℃, 31℃, 32℃, 33℃, 34℃, 35℃, 36℃ or 37℃.

[0027] According to some embodiments of the present invention, the activation time is 10 min to 60 min. For example, it can be 10 min, 20 min, 25 min, 30 min, 35 min, 40 min, 45 min, 50 min, 55 min or 60 min.

[0028] According to some embodiments of the present invention, the activation speed is 100 rpm to 1000 rpm. For example, it can be 100 rpm, 200 rpm, 300 rpm, 400 rpm, 500 rpm, 600 rpm, 700 rpm, 800 rpm, 900 rpm or 1000 rpm.

[0029] According to some embodiments of the present invention, the coupling reaction time is 2 h to 6 h. For example, it can be 2 h, 2.5 h, 3 h, 3.5 h, 4 h, 4.5 h, 5 h, 5.5 h or 6 h.

[0030] According to some embodiments of the present invention, the temperature of the coupling reaction is 16℃-37℃. For example, it can be 16℃, 17℃, 18℃, 19℃, 20℃, 21℃, 22℃, 23℃, 24℃, 25℃, 26℃, 27℃, 28℃, 29℃, 30℃, 31℃, 32℃, 33℃, 34℃, 35℃, 36℃ or 37℃.

[0031] According to some embodiments of the present invention, the magnetic bead activating solution for cleaning comprises the following components at the following concentrations: 0.05M-0.2M MES buffer and 0.01-0.1% v / v Tween-20. The pH of the MES buffer is 4.0-6.0. For example, the pH of the MES buffer can be 4.0, 4.5, 5.0, 5.5, or 6.0; the concentration of the MES buffer can be 0.05 M, 0.1 M, 0.15 M, or 0.2 M; and the concentration of Tween-20 can be 0.01% v / v, 0.025% v / v, 0.05% v / v, 0.075% v / v, or 0.1% v / v Tween-20.

[0032] According to some embodiments of the present invention, the first blocking is achieved using a magnetic microparticle blocking solution comprising the following components at concentrations: 0.005 M-0.05 M PBS buffer, 0.1% w / v-2% w / v BSA, and 0.01% v / v-0.1% v / v Tween-20. The pH of the PBS buffer is 7.0-8.0. For example: the concentration of PBS buffer can be 0.005 M, 0.01 M, 0.02 M, 0.03 M, 0.04 M or 0.05 M; the pH of PBS buffer can be 7.0, 7.2, 7.4, 7.6, 7.8 or 8.0; the BSA concentration can be 0.1% w / v, 0.2% w / v, 0.4% w / v, 0.6% w / v, 0.8% w / v, 1.0% w / v, 1.2% w / v, 1.4% w / v, 1.6% w / v, 1.8% w / v or 2.0% w / v; the Tween-20 concentration can be 0.01% v / v, 0.025% v / v, 0.05% v / v, 0.075% v / v or 0.1% v / v. The magnetic microparticle blocking solution can block unreacted activated magnetic microparticles, preventing further protein coupling and improving the sensitivity and specificity of the detection reagent.

[0033] According to some embodiments of the present invention, the temperature of the first enclosure is 16°C-37°C. For example, it can be 16°C, 17°C, 18°C, 19°C, 20°C, 21°C, 22°C, 23°C, 24°C, 25°C, 26°C, 27°C, 28°C, 29°C, 30°C, 31°C, 32°C, 33°C, 34°C, 35°C, 36°C, or 37°C.

[0034] According to some embodiments of the present invention, the first sealing time is 0.5 h to 4 h. For example, it can be 0.5 h, 1 h, 1.5 h, 2 h, 2.5 h, 3 h, 3.5 h or 4 h.

[0035] According to some embodiments of the present invention, the rotational speed of the first enclosure is 100 rpm to 1000 rpm. For example, it can be 100 rpm, 200 rpm, 300 rpm, 400 rpm, 500 rpm, 600 rpm, 700 rpm, 800 rpm, 900 rpm or 1000 rpm.

[0036] According to some embodiments of the present invention, the preservation solution for preserving the magnetic microparticles coated with porcine reproductive and respiratory syndrome virus N protein comprises the following components at concentrations: 0.005 M-0.05 M PBS buffer, 0.05% w / v-2% w / v BSA, 1% w / v-3% w / v trehalose, 0.01% v / v-0.1% v / v Tween-20, and 0.05-0.2% v / v Proclin 300. The pH of the PBS buffer is 6.5-8.0. For example: BSA concentrations can be 0.05% w / v, 0.075% w / v, 0.1% w / v, 0.25% w / v, 0.5% w / v, 0.75% w / v, 1%, 1.25% w / v, 1.5% w / v, 1.75% w / v, or 2% w / v; trehalose concentrations can be 1% w / v, 1.25% w / v, 1.5% w / v, 1.75% w / v, 2% w / v, 2.25% w / v, 2.5% w / v, 2.75% w / v, or 3% w / v; Tween-20 concentrations can be 0.01% v / v, 0.025% v / v, 0.05% v / v, 0.075% v / v, or 0.1% v / v; Proclin The concentration of 300 can be 0.05% v / v, 0.075% v / v, 0.1% v / v, 0.125% v / v, 0.15% v / v, 0.175% v / v, or 0.2% v / v; the concentration of PBS buffer can be 0.005 M, 0.01 M, 0.02 M, 0.03 M, 0.04 M, or 0.05 M; the pH of PBS buffer can be 6.5, 6.7, 7.0, 7.2, 7.4, 7.6, 7.8, or 8.0. This magnetic bead preservation solution is beneficial for the stability of magnetic microparticles coated with PRRSV N protein, allowing for long-term storage and extending their shelf life.

[0037] According to some embodiments of the present invention, the method for preparing the acridinium ester-labeled anti-pig antibody includes the following steps:

[0038] After crosslinking the anti-pig antibody with acridine ester, a second blocking and purification process is performed sequentially. During the crosslinking process, the molar ratio of the anti-pig antibody to the acridine ester is 1:(5-20). For example, the molar ratio of the anti-pig antibody to the acridine ester can be 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, or 1:20.

[0039] According to some embodiments of the present invention, the anti-pig antibody includes at least one of anti-pig IgM antibody and anti-pig IgG antibody.

[0040] According to some embodiments of the present invention, the anti-pig antibody is an anti-pig IgG antibody.

[0041] According to some embodiments of the present invention, the crosslinking is carried out in CB buffer.

[0042] According to some embodiments of the present invention, the final concentration of the anti-pig antibody during the crosslinking process is 0.1 mg / mL to 1 mg / mL. For example, it can be 0.1 mg / mL, 0.2 mg / mL, 0.3 mg / mL, 0.4 mg / mL, 0.5 mg / mL, 0.6 mg / mL, 0.7 mg / mL, 0.8 mg / mL, 0.9 mg / mL, or 1 mg / mL.

[0043] According to some embodiments of the present invention, the crosslinking temperature is 16℃-37℃. For example, it can be 16℃, 17℃, 18℃, 19℃, 20℃, 21℃, 22℃, 23℃, 24℃, 25℃, 26℃, 27℃, 28℃, 29℃, 30℃, 31℃, 32℃, 33℃, 34℃, 35℃, 36℃ or 37℃.

[0044] According to some embodiments of the present invention, the crosslinking time is 0.5 h to 2 h. For example, it can be 0.5 h, 0.6 h, 0.7 h, 0.8 h, 0.9 h, 1 h, 1.1 h, 1.2 h, 1.3 h, 1.4 h, 1.5 h, 1.6 h, 1.7 h, 1.8 h, 1.9 h or 2 h.

[0045] According to some embodiments of the present invention, the crosslinking rotation speed is 100 rpm to 1000 rpm. For example, it can be 100 rpm, 200 rpm, 300 rpm, 400 rpm, 500 rpm, 600 rpm, 700 rpm, 800 rpm, 900 rpm or 1000 rpm.

[0046] According to some embodiments of the present invention, the sealing agent used in the second sealing includes at least one of lysine, gelatin, bovine serum albumin (BSA), skim milk powder, and casein.

[0047] According to some embodiments of the present invention, the second sealing is achieved by treatment with a sealing agent; the molar ratio of the sealing agent to the acridine ester is (100-200):1. For example, it can be 100:1, 110:1, 120:1, 130:1, 140:1, 150:1, 160:1, 170:1, 180:1, 190:1, or 200:1.

[0048] According to some embodiments of the present invention, the temperature of the second enclosure is 16°C-37°C. For example, it can be 16°C, 17°C, 18°C, 19°C, 20°C, 21°C, 22°C, 23°C, 24°C, 25°C, 26°C, 27°C, 28°C, 29°C, 30°C, 31°C, 32°C, 33°C, 34°C, 35°C, 36°C, or 37°C.

[0049] According to some embodiments of the present invention, the second sealing time is 15 min to 60 min. For example, it can be 15 min, 20 min, 25 min, 30 min, 35 min, 40 min, 45 min, 50 min, 55 min or 60 min.

[0050] According to some embodiments of the present invention, the rotational speed of the second enclosure is 100 rpm to 1000 rpm. For example, it can be 100 rpm, 200 rpm, 300 rpm, 400 rpm, 500 rpm, 600 rpm, 700 rpm, 800 rpm, 900 rpm or 1000 rpm.

[0051] According to some embodiments of the present invention, the purification is dialysis purification.

[0052] According to some embodiments of the present invention, the dialysis purification is performed in 0.01M PBS buffer.

[0053] According to some embodiments of the present invention, the single dialysis time for the dialysis purification is 2 h-3 h.

[0054] According to some embodiments of the present invention, the dialysis purification is repeated 3-5 times.

[0055] According to some embodiments of the present invention, the purified acrid ester-labeled anti-pig antibody was stored at 50% v / v glycerol.

[0056] According to some embodiments of the present invention, the detection reagent further includes at least one of a standard, a quality control, a serum diluent, a concentrated washing solution, and a chemiluminescent substrate solution.

[0057] According to some embodiments of the present invention, the standard is serum containing porcine anti-PRRSV antibodies. The porcine anti-PRRSV antibody titer at the highest dilution confirmed as positive by the ELISA test using the IDEXX PRRS 2XR kit is defined as 100 U. The concentration gradients of porcine anti-PRRSV antibodies in the standard are 0 U, 50 U, 100 U, 200 U, 400 U, and 800 U.

[0058] According to some embodiments of the present invention, the quality control products include high-quality control products and low-quality control products. The high-quality control product has a porcine anti-PRRSV antibody titer of 400 U. The low-quality control product has a porcine anti-PRRSV antibody titer of 100 U. The titer is assigned using a master curve generated from the standards.

[0059] According to some embodiments of the present invention, the serum diluent comprises the following components at concentrations: 0.005 M–0.05 M PBS buffer, 0.05% w / v–1% w / v casein, 0.05% w / v–1% w / v hydroxypropyl-β-cyclodextrin, 1 mM–5 mM EDTA, 1% w / v–3% w / v trehalose, 0.01% v / v–0.1% v / v Tween-20, and 0.05–0.2% v / v Proclin 300. The pH of the PBS buffer is 6.5–8.0. For example: casein concentrations can be 0.05% w / v, 0.1% w / v, 0.2% w / v, 0.3% w / v, 0.4% w / v, 0.5% w / v, 0.6% w / v, 0.7% w / v, 0.8% w / v, 0.9% w / v, or 1% w / v; hydroxypropyl-β-cyclodextrin concentrations can be 0.05% w / v, 0.1% w / v, 0.2% w / v, 0.3% w / v, 0.4% w / v, 0.5% w / v, 0.6% w / v, 0.7% w / v, 0.8% w / v, 0.9% w / v, or 1% w / v; EDTA concentrations can be 1 mM, 1.5 mM, 2 mM, 2.5 mM, 3 mM, 3.5 mM, 4 mM, 4.5 mM, or 5 mM. mM; Trehalose concentrations can be 1% w / v, 1.25% w / v, 1.5% w / v, 1.75% w / v, 2% w / v, 2.25% w / v, 2.5% w / v, 2.75% w / v, or 3% w / v; Tween-20 concentrations can be 0.01% v / v, 0.02% v / v, 0.03% v / v, 0.04% v / v, 0.05% v / v, 0.06% v / v, 0.07% v / v, 0.08% v / v, 0.09% v / v, or 0.1% v / v; proclin The concentration of 300 can be 0.05% v / v, 0.075% v / v, 0.1% v / v, 0.125% v / v, 0.15% v / v, 0.175% v / v, or 0.2% v / v; the concentration of PBS buffer can be 0.005 M, 0.01 M, 0.02 M, 0.03 M, 0.04 M, or 0.05 M; the pH of PBS buffer can be 6.5, 6.7, 7.0, 7.2, 7.4, 7.6, 7.8, or 8.0. This allows for accurate detection of hemolyzed and lipemic samples, avoiding the influence of interfering substances such as hemoglobin, triglycerides, bilirubin concentration, and protein.

[0060] According to some embodiments of the present invention, the serum diluent comprises the following components at concentrations: 0.01M PBS buffer (pH 7.4), 0.4% w / v casein, 0.5% w / v hydroxypropyl-β-cyclodextrin, 2 mM EDTA, 2% w / v trehalose, 0.05% v / v Tween-20, and 0.1% v / v Proclin 300.

[0061] According to some embodiments of the present invention, the concentrated washing solution can be obtained by diluting it appropriately with 0.005-0.05 M PBS buffer (pH 5.5-7.4).

[0062] According to some embodiments of the present invention, the washing solution is a 0.005-0.05 M PBS buffer containing 0.01-0.1% v / v Tween-20 and 0.05-0.2% v / v Proclin 300. The pH of the PBS buffer is 5.5-7.4. For example: Tween-20 concentrations can be 0.01%v / v, 0.02%v / v, 0.03%v / v, 0.04%v / v, 0.05%v / v, 0.06%v / v, 0.07%v / v, 0.08%v / v, 0.09%v / v, or 0.1%v / v; Proclin 300 concentrations can be 0.05%v / v, 0.075%v / v, 0.1%v / v, 0.125%v / v, 0.15%v / v, 0.175%v / v, or 0.2%v / v; PBS buffer concentrations can be 0.005 M, 0.01 M, 0.02 M, 0.03 M, 0.04 M, or 0.05 M; PBS buffer pH can be 5.5, 5.8, 6.0, 6.5, 7.0, 7.2, or 7.4.

[0063] According to some embodiments of the present invention, the chemiluminescent substrate liquid includes chemiluminescent substrate A liquid and chemiluminescent substrate B liquid.

[0064] According to some embodiments of the present invention, the chemiluminescent substrate A solution comprises 0.5% v / v-2% v / v hydrogen peroxide and 0.05 M-0.2 M nitric acid. For example, the hydrogen peroxide concentration can be 0.5% v / v, 0.75% v / v, 1% v / v, 1.25% v / v, 1.5% v / v, 1.75% v / v, or 2% v / v; the nitric acid concentration can be 0.05 M, 0.075 M, 0.1 M, 0.125 M, 0.15 M, 0.175 M, or 0.2 M. The balance of the chemiluminescent substrate A solution is ultrapure water.

[0065] According to some embodiments of the present invention, the chemiluminescent substrate B solution comprises 0.1 M-1 M sodium hydroxide and 0.1% w / v-1% w / v hexadecyltrimethylammonium chloride (CTAC). For example, the sodium hydroxide concentration can be 0.1 M, 0.25 M, 0.5 M, 0.75 M, or 1 M sodium hydroxide; the CTAC concentration can be 0.1% w / v, 0.25% w / v, 0.5% w / v, 0.75% w / v, or 1% w / v CTAC. The balance of the chemiluminescent substrate B solution is ultrapure water.

[0066] According to some embodiments of the present invention, the detection reagent further includes a magnetic microparticle preservation solution for diluting the first reagent and an acridine ester preservation solution for diluting the second reagent.

[0067] According to some embodiments of the present invention, the magnetic microparticle preservation solution comprises: 0.005 M-0.05 M PBS buffer, 0.5% w / v-2% w / v BSA, 1% w / v-3% w / v trehalose, 0.01% v / v-0.1% v / v Tween-20, and 0.05-0.2% v / v Proclin 300. The pH of the PBS buffer is 6.5-8.0. For example: BSA concentrations can be 0.5% w / v, 1% w / v, 1.5% w / v, or 2% w / v; trehalose concentrations can be 1% w / v, 1.5% w / v, 2% w / v, 2.5% w / v, or 3% w / v; Tween-20 concentrations can be 0.01% v / v, 0.02% v / v, 0.03% v / v, 0.04% v / v, 0.05% v / v, 0.06% v / v, 0.07% v / v, 0.08% v / v, 0.09% v / v, or 0.1% v / v; proclin The concentration of 300 can be 0.05% v / v, 0.075% v / v, 0.1% v / v, 0.125% v / v, 0.15% v / v, 0.175% v / v, or 0.2% v / v; the concentration of PBS buffer can be 0.005 M, 0.01 M, 0.02 M, 0.03 M, 0.04 M, or 0.05 M; the pH of PBS buffer can be 6.5, 7.0, 7.5, or 8.0.

[0068] According to some embodiments of the present invention, the magnetic microparticle preservation solution comprises: 0.01M PBS buffer (pH 7.4), 1% w / v BSA, 2% w / v trehalose, 0.05% v / v Tween-20 and 0.1% v / v Proclin 300.

[0069] According to some embodiments of the present invention, the acridinium ester preservation solution comprises 0.005 M–0.05 M PBS buffer, 0.05% w / v–1% w / v casein, 0.01% v / v–0.1% v / v Tween-20, and 0.05–0.2% v / v Proclin 300. The pH of the PBS buffer is 5.5–7.0. For example: casein concentrations can be 0.05% w / v, 0.1% w / v, 0.2% w / v, 0.4% w / v, 0.6% w / v, 0.8% w / v, or 1% w / v; Tween-20 concentrations can be 0.01% v / v, 0.02% v / v, 0.03% v / v, 0.04% v / v, 0.05% v / v, 0.06% v / v, 0.07% v / v, 0.08% v / v, 0.09% v / v, or 0.1% v / v; Proclin 300 concentrations can be 0.05% v / v, 0.075% v / v, 0.1% v / v, 0.125% v / v, 0.15% v / v, 0.175% v / v, or 0.2% v / v; PBS buffer concentrations can be 0.005 M, 0.01 M, or 0.01 M. M, 0.02 M, 0.03 M, 0.04 M or 0.05 M; the pH of the PBS buffer can be 5.5, 5.7, 6.0, 6.2, 6.4, 6.6, 6.8 or 7.0.

[0070] According to some embodiments of the present invention, the acridinium ester preservation solution comprises 0.01 M PBS buffer (pH 6.5), 0.5% w / w casein, 0.05% v / v Tween-20, and 0.1% v / v Proclin 300.

[0071] The application of the detection reagent described in the first aspect of the second aspect of the present invention in the preparation of a product for detecting porcine reproductive and respiratory syndrome virus N antibody.

[0072] According to some embodiments of the present invention, the product includes a reagent kit.

[0073] According to some embodiments of the present invention, the method of using the detection reagent includes the following steps:

[0074] After the substance to be tested is mixed and reacted with the first reagent, the magnetic particles are separated and washed; the separated magnetic particles are reacted with the second reagent, a chemiluminescent substrate solution is added, and the relative light intensity is measured.

[0075] According to some embodiments of the present invention, the method of use further includes: mixing the standard with the first reagent and reacting, adding the second reagent to continue the reaction, adding the chemiluminescent substrate solution, measuring the relative light intensity, and plotting a standard curve. The standard curve is plotted with the porcine anti-PRRSV antibody titer in the standard as the x-axis and the relative light intensity as the y-axis.

[0076] According to some embodiments of the present invention, when the analyte reacts with the first reagent, the working solution concentration of the magnetic microparticles is 0.1 mg / mL to 0.3 mg / mL. For example, it can be 0.1 mg / mL, 0.125 mg / mL, 0.15 mg / mL, 0.175 mg / mL, 0.2 mg / mL, 0.225 mg / mL, 0.25 mg / mL, 0.275 mg / mL, or 0.3 mg / mL.

[0077] According to some embodiments of the present invention, when the analyte reacts with the first reagent, the volume ratio of the analyte to the first reagent is 1:(1-10). For example, it can be 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9 or 1:10.

[0078] According to some embodiments of the present invention, the reaction temperature between the analyte and the first reagent is 35°C-40°C.

[0079] According to some embodiments of the present invention, the reaction time between the analyte and the first reagent is 3 min to 20 min. For example, it can be 3 min, 4 min, 5 min, 6 min, 7 min, 8 min, 9 min, 10 min, 11 min, 12 min, 13 min, 14 min, 15 min, 16 min, 17 min, 18 min, 19 min or 20 min.

[0080] According to some embodiments of the present invention, the analyte is prepared by mixing the test serum and serum diluent at a volume ratio of 1:(0-40). For example, the ratio can be 1:0, 1:2.5, 1:5, 1:7.5, 1:10, 1:12.5, 1:15, 1:17.5, 1:20, 1:22.5, 1:25, 1:27.5, 1:30, 1:32.5, 1:35, 1:37.5, or 1:40.

[0081] According to some embodiments of the present invention, the method for separating the magnetic particles is magnetic separation.

[0082] According to some embodiments of the present invention, the washing solution for washing the magnetic particles is a 0.005 M-0.05 M PBS buffer containing 0.01% v / v-0.1% v / v Tween-20 and 0.05% v / v-0.2% v / v Proclin 300. The pH of the PBS buffer is 6.0-7.0. For example: Tween-20 concentrations can be 0.01%v / v, 0.02%v / v, 0.03%v / v, 0.04%v / v, 0.05%v / v, 0.06%v / v, 0.07%v / v, 0.08%v / v, 0.09%v / v, or 0.1%v / v; Proclin 300 concentrations can be 0.05%v / v, 0.075%v / v, 0.1%v / v, 0.125%v / v, 0.15%v / v, 0.175%v / v, or 0.2%v / v; PBS buffer concentrations can be 0.005 M, 0.01 M, 0.02 M, 0.03 M, 0.04 M, or 0.05 M; PBS buffer pH can be 6.0, 6.2, 6.4, 6.6, 6.8, or 7.0.

[0083] According to some embodiments of the present invention, the mass ratio of the magnetic microparticles to the acridine ester-labeled anti-pig antibody is 1 mg: (0.1-10) μg. For example, it can be 1 mg: 0.1 μg, 1 mg: 0.2 μg, 1 mg: 0.3 μg, 1 mg: 0.4 μg, 1 mg: 0.5 μg, 1 mg: 0.6 μg, 1 mg: 0.7 μg, 1 mg: 0.8 μg, 1 mg: 0.9 μg, 1 mg: 1 μg, 1 mg: 2 μg, 1 mg: 3 μg, 1 mg: 4 μg, 1 mg: 5 μg, 1 mg: 6 μg, 1 mg: 7 μg, 1 mg: 8 μg, 1 mg: 9 μg, or 1 mg: 10 μg.

[0084] According to some embodiments of the present invention, the reaction time between the separated magnetic particles and the second reagent is 3 min to 20 min. For example, it can be 3 min, 4 min, 5 min, 6 min, 7 min, 8 min, 9 min, 10 min, 11 min, 12 min, 13 min, 14 min, 15 min, 16 min, 17 min, 18 min, 19 min or 20 min.

[0085] According to some embodiments of the present invention, the reaction temperature between the separated magnetic particles and the second reagent is 35°C-40°C.

[0086] According to some embodiments of the present invention, the volume-to-mass ratio of the chemiluminescent substrate A solution, the chemiluminescent substrate B solution, and the magnetic microparticles is 3 mL: (0.9-1.1) mL: (0.05-0.5) mg. Attached Figure Description

[0087] Figure 1 This is an SDS-PAGE image of the protein induced by recombinant BL21 / pET-28a-PRRSV-N expression bacteria in an embodiment of the present invention.

[0088] Figure 2 This is a graph showing the screening results of magnetic microparticle-coupled protein concentration in the screening examples of this invention;

[0089] Figure 3 This is a graph showing the screening results of acridine ester-labeled antibody dilution factor in the screening examples of the present invention;

[0090] Figure 4 This is a graph showing the screening results of serum dilution ratios in the screening examples of this invention;

[0091] Figure 5 This is a graph showing the screening results of the sample dosage of the analyte in the screening examples of this invention;

[0092] Figure 6 This is a graph showing the screening results of the superparamagnetic microparticle working solution addition amount in the screening examples of this invention;

[0093] Figure 7 This is a graph showing the screening results of the reaction time in one step of the screening example of the present invention;

[0094] Figure 8 This is a graph showing the screening results of the two-step reaction time in the screening example of the present invention;

[0095] Figure 9 This is a graph showing the standard curve fitting results for the sensitivity and specificity detection of the detection examples of the present invention;

[0096] Figure 10 This is a ROC curve for the detection of sensitivity and specificity in the detection examples of the present invention;

[0097] Figure 11 This is a monitoring chart of the 40-day quality control results for in-system stability evaluation in the test examples of this invention. Detailed Implementation

[0098] The following will describe the concept and technical effects of the present invention clearly and completely with reference to embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.

[0099] In the description of this invention, the use of terms such as "first," "second," etc., is for the purpose of distinguishing technical features only and should not be construed as indicating or implying relative importance, or implicitly indicating the number of technical features indicated, or implicitly indicating the order of the technical features indicated.

[0100] "And / or" is used to indicate that one or both of the described situations may occur, for example, A and / or B includes (A and B) and (A or B).

[0101] Unless otherwise specified, "Porcine reproductive and respiratory syndrome virus N antibody" in this article refers to an antibody against the porcine reproductive and respiratory syndrome virus N protein.

[0102] PRRSV is a single-stranded, positive-sense, unsegmented RNA virus with a genome of approximately 15,500 bases. Based on its genome sequence, PRRSV can be divided into two genotypes: the European type, represented by Lelystad virus (LV), and the American type, represented by VR-2332. The PRRSV genome sequence consists of a 5' untranslated region (5'UTR), 10 open reading frames (ORFs), a 3' untranslated region (3'UTR), and a poly(A) sequence. The open reading frames are similar to protein-coding sequences, encoding both non-structural and structural proteins. The M and N proteins are the most conserved structural proteins in PRRSV. During infection with wild-type PRRSV strains, the body produces antibodies against the N protein approximately one week later, and these antibodies can persist in the body for up to six months. Sequence alignment has revealed that the N protein exhibits excellent conservation between strains and different subtypes, making it the optimal choice for early detection or diagnosis of viral infection.

[0103] PRRSV N protein coated on magnetic microparticles can be used to specifically recognize PRRSV N protein antibodies, binding with PRRSV N protein antibodies in samples (e.g., serum) to form immune complexes. The reactants are washed using magnetic separation technology, followed by the addition of acridine ester-labeled antibodies. Unbound acridine ester-labeled antibodies are washed away. Hydrogen peroxide and sodium hydroxide solutions are then added, causing the acridine ester molecules to be attacked by hydrogen peroxide ions, forming unstable ethylene dioxide. This ethylene dioxide subsequently decomposes into CO2 and electronically excited N-methylacridone. When N-methylacridone returns from the excited state to the ground state, it releases photons with a maximum emission wavelength of 470 nm, enabling the quantitative detection of PRRSV N protein antibodies.

[0104] Preparation Example

[0105] This preparation example provides a method for preparing the N protein of porcine reproductive and respiratory syndrome virus, as follows:

[0106] The PRRSV-N gene sequence was compared with the porcine reproductive and respiratory syndrome virus (PRRSV) N protein gene sequence (as shown in SEQ ID NO: 1) by searching the Gene Bank database (MK333180.1). The PRRSV-N gene sequence was obtained by double enzyme restriction sites. EcoR I and Sal I The plasmid pET28a was cloned into the recombinant plasmid pET28a-PRRSV-N. The recombinant plasmid was then transformed into BL21(DE3) competent cells, and the bacterial culture was plated on cells containing kanamycin. +Transformants were identified by incubating the bacteria overnight at 37°C (inverted) for 12–16 h on resistant LB agar plates. In a 50 mL centrifuge tube, 10 mL of LB medium and 10 μL of kanamycin (50 μg / mL) were added. Single colonies (BL21 / pET-28a-PRRSV-N expression bacteria) showing positive transformant identification were picked and incubated in the medium at 37°C and 180 rpm for approximately 5–6 h. In a 250 mL LB medium solution, 250 μL of kanamycin (50 μg / mL) was added, and 2.5 mL of the rejuvenated bacterial culture was inoculated. The culture was incubated at 37°C and 180 rpm for approximately 3.5 h. Then, 2.5 mL of 10 mM IPTG (final concentration 0.1 mM) was added to the bacterial culture, and the culture was incubated at 18°C ​​and 180 rpm for approximately 16 h to obtain the whole bacterial culture. After induction, the bacterial cells were collected by centrifugation at 4500 r / min and 4°C for 30 min. Wash once with 10 ml PBS (enough to cover the bacterial sludge), discard the supernatant, and resuspend the bacterial sludge in 25 mL PBS at a 10-fold concentration volume. Sonicate the cells in an ice bath (300 W, 20 kHz, 3 s working, 6 s interval, sonication for 30 min). Centrifuge the cell lysate at 6000 r / min, 4℃ for 5 min, and collect the supernatant. Resuspend the lysate in 8M urea and 1×PBS to verify whether the inclusion bodies express the target protein. SDS-PAGE confirmed that PRRSV-N protein was expressed in both the lysate supernatant and the lysate. However, inclusion body expression requires renaturation, a complex process. Therefore, the lysate supernatant was purified by nickel affinity chromatography and gel filtration chromatography to obtain soluble PRRSV N protein.

[0107] Porcine reproductive and respiratory syndrome virus (PRRSV) N protein gene sequence:

[0108] ATGCCAAATAACAACGCCAGACAGCAAAATAAAAAGAAGGGGAATGGCCAGCCAGTCAATCAGTTGTGCCAGATGTTGGGTAAGATCATCGCCCAACAGAGCCAGTCCAGAGGCAAGGGACCGGGAAAGAAGAACAAGAATAGAAACCCGGAGAAGCCCCATTTTCCTCTAGCGACTGAAGATGACGT CAGACATCACTTTACCCCTAGTGAGCGACAATTGTGTCTGTCGTCAATCCGGACTGCCTTTAACCAAGGCGCTGGAACTTGCACCCTGTCAGATTCAGGGAGAATAAGTTATACTGTGGAGTTTAGTTTGCCTACTCATCATACCGTGCGCCTGATTCGCGCCACAGCGTCACCCTCAGCATGA (SEQ ID NO: 1).

[0109] The amino acid sequence of PRRSV-N is shown in SEQ ID NO: 2.

[0110] MPNNNGRQQNKKKGNGQPVNQLCQMLGKIIAQQSQSRGKGPGKKNKNRNPEKPHFPLATEDDVRHHFTPSERQLCLSSIRTAFNQGAGTCTLSDSGRISYTVEFSLPTHHTVRLIRATASPSA (SEQ ID NO: 2).

[0111] Identification image as shown Figure 1 As shown. From Figure 1 It can be seen that an expression band appeared at 15 kDa in the fragmented supernatant, and the size was as expected. Soluble expression of porcine reproductive and respiratory syndrome virus N protein was obtained through expression purification.

[0112] Example 1

[0113] This embodiment provides a fully automated chemiluminescent detection reagent for porcine reproductive and respiratory syndrome virus (PRRSV) N antibody, which consists of superparamagnetic microparticles coated with PRSV N protein, acrid ester-labeled anti-porcine IgG antibody, washing solution, and chemiluminescent substrate solution;

[0114] The chemiluminescent substrate solution consists of chemiluminescent substrate A solution and chemiluminescent substrate B solution.

[0115] (1) The preparation method of superparamagnetic microparticles coated with porcine reproductive and respiratory syndrome virus N protein is as follows:

[0116] Take 200 μL of carboxylated magnetic microparticles (10 mg / mL, catalog number: A1-P0150-C1, Suzhou Acaso Biotechnology, particle size 1.5 μm) into a 2 mL centrifuge tube. Add 400 μL of magnetic bead activation solution to the centrifuge tube, vortex to mix, and remove the supernatant by magnetic separation; repeat twice. After washing, resuspend the carboxylated magnetic microparticles with magnetic bead activation solution, and adjust the volume to 120 μL. Then add 20 μL of EDC solution and 20 μL of NHS solution, vortex to mix, and activate at 25℃ and 250 rpm for 30 min. After activation, wash twice with 400 μL of magnetic bead activation solution, remove the supernatant, resuspend the carboxylated magnetic microparticles with magnetic bead activation solution, and adjust the volume to 100 μL. Add 4 μg of porcine reproductive and respiratory syndrome virus N protein to the centrifuge tube, adjust the volume to 200 μL, and couple the reaction at 25℃ and 250 rpm for 4 h. The coupled magnetic microparticles were washed twice with magnetic bead activation solution, the supernatant was removed, and 400 μL of magnetic microparticle blocking solution was added. The mixture was blocked at 25℃ and 250 rpm for 1 h. After blocking, the microparticles were washed twice with 400 μL of magnetic microparticle preservation solution, the supernatant was removed, and 200 μL of magnetic microparticle preservation solution was added for preservation to obtain the superparamagnetic microparticle reagent.

[0117] The magnetic bead activation solution consists of the following components: 0.1 M MES buffer (pH 5.0) and 0.05% v / v Tween-20.

[0118] The EDC solution consists of the following components: 50 mg / mL EDC and magnetic bead activation solution.

[0119] The NHS solution consists of the following components: 50 mg / mL NHS and magnetic bead activation solution.

[0120] The magnetic microparticle blocking solution consists of the following components: 0.01M PBS buffer (pH 7.4), 1% w / v BSA, and 0.05% v / v Tween-20.

[0121] Under the coupling conditions described in the examples, the activated magnetic microparticles can be effectively coupled with the PRRSV N protein to the greatest extent, thereby improving the sensitivity of the detection reagent.

[0122] (2) The preparation method of acridine ester labeled antibody is as follows:

[0123] Take 50 μg of anti-pig IgG antibody (5 mg / mL, catalog number: ZKQ-008, Zhongke Jingjing (Huzhou) Biotechnology), add acridine ester at a molar ratio of antibody to acridine ester of 1:10, and add CB buffer to bring the volume to 200 μL. Crosslink at 25℃ and 250 rpm for 30 min. Add lysine (molar ratio of lysine to acridine ester of 150:1) for blocking, and block at 25℃ and 250 rpm for 30 min. After the reaction, dialyze using a 50 KD dialysis bag in 0.01M PBS buffer for a total of 4 dialyzes, each for 2-3 h. After dialysis, add 500 μL of glycerol to 500 μL of dialysate to bring the volume to 1 mL to obtain the acridine ester-labeled antibody stock solution, which is stored at -20℃ for later use.

[0124] By using the blocking conditions described in this embodiment, the resulting acridinium ester-labeled antibody can achieve optimal sensitivity and specificity.

[0125] The magnetic microparticle preservation solution consists of the following components: 0.01M PBS buffer (pH 7.4), 1% w / v BSA, 2% w / v trehalose, 0.05% v / v Tween-20, and 0.1% v / v Proclin 300.

[0126] The acridinium ester preservation solution consists of the following components: 0.01 M PBS buffer (pH 6.5), 0.5% w / v casein, 0.05% v / v Tween-20, and 0.1% v / v proclin 300.

[0127] (3) The washing solution consists of the following components: 0.05% v / v Tween-20, 0.1% v / v proclin 300 and 0.01 MPBS buffer (pH 6.5).

[0128] (4) The chemiluminescent substrate A solution consists of the following components: 1.32% v / v hydrogen peroxide concentration and 0.1 M nitric acid aqueous solution.

[0129] The chemiluminescent substrate B solution consists of the following components: 0.25% w / v CTAC and 0.35 M sodium hydroxide aqueous solution.

[0130] The method of using this test reagent is as follows:

[0131] The superparamagnetic microparticle reagent was mixed thoroughly, and the concentration of magnetic microparticles was adjusted to 0.2 mg / mL with magnetic microparticle preservation solution to obtain the superparamagnetic microparticle working solution. The acridine ester-labeled antibody stock solution (acidine ester-labeled antibody concentration of 50 μg / mL) was diluted 1000 times with acridine ester preservation solution to obtain the acridine ester-labeled antibody working solution.

[0132] Add 10 μL of the analyte and 50 μL of superparamagnetic microparticle working solution to a reaction vessel and incubate at 37±0.5℃ for 5 min. After magnetic separation and washing with 0.1 M PBST buffer at pH 6.5, add 100 μL of acridinium ester-labeled antibody working solution to the reaction vessel and incubate for 5 min. After magnetic separation and washing with washing buffer, add 150 μL of chemiluminescent substrate A solution and 50 μL of chemiluminescent substrate B solution to the reaction vessel and measure the relative light intensity (RLU).

[0133] Example 2

[0134] This embodiment provides a fully automated chemiluminescent detection reagent for detecting porcine reproductive and respiratory syndrome virus (PRRSV) N antibody, which is basically the same as that in Example 1, except that the reagent also includes a serum diluent and the method of use differs. Details are as follows:

[0135] (1) The serum diluent consists of the following components: 0.01M PBS buffer (pH 7.4), 0.5% w / v hydroxypropyl-β-cyclodextrin, 0.4% w / v casein, 2% w / v trehalose, 2 mM EDTA, 0.05% v / v Tween-20, and 0.1% v / v proclin300.

[0136] (2) The usage method is as follows:

[0137] The superparamagnetic microparticle reagent was thoroughly mixed, and the concentration of magnetic microparticles was adjusted to 0.2 mg / mL using magnetic microparticle preservation solution to obtain the superparamagnetic microparticle working solution. The acridine ester-labeled antibody stock solution (acrididine ester-labeled antibody concentration of 50 μg / mL) was diluted 1000-fold with acridine ester preservation solution to obtain the acridine ester-labeled antibody working solution. The serum diluent and the test serum were mixed thoroughly at a dilution ratio of 1:10 to obtain the analyte.

[0138] Add 10 μL of the analyte and 50 μL of superparamagnetic microparticle working solution to a reaction vessel and incubate at 37±0.5℃ for 10 min. After magnetic separation and washing with 0.1 M PBST buffer at pH 6.5, add 100 μL of acridinium ester-labeled antibody working solution to the reaction vessel and incubate for 10 min. After magnetic separation and washing with washing buffer, add 150 μL of chemiluminescent substrate A solution and 50 μL of chemiluminescent substrate B solution to the reaction vessel and measure the relative light intensity (RLU).

[0139] Filtering example

[0140] This example screens the preparation conditions and reaction conditions of the fully automated chemiluminescent detection reagent for porcine reproductive and respiratory syndrome virus N antibody. Except for the change in screening factors, all other conditions are the same as in Example 1.

[0141] 1. Screening factor: Concentration of magnetic microparticle-coupled protein. When preparing superparamagnetic microparticles coated with porcine reproductive and respiratory syndrome virus (PRRSV) N protein, the amount of PRSV N protein used was limited to 2 μg, 4 μg, 8 μg, and 12 μg, respectively.

[0142] Negative and positive sera identified by the porcine reproductive and respiratory syndrome virus (PRRSV) antibody detection kit (IDEXX PRRS 2XR) (product code: 99-0016411) were used as test substances. The fully automated chemiluminescent detection reagent for PRRSV N antibody, prepared in this screening example, was used according to the usage instructions provided in Example 1. Each sample was tested three times, and the P / N ratio was calculated.

[0143] The results are as follows Figure 2 As shown, the detection reagents prepared with 2 μg, 4 μg, 8 μg, and 12 μg of porcine reproductive and respiratory syndrome virus (PRRSV) N protein all achieved good detection results. The optimal concentration of the magnetic microparticle-coupled protein was 4 μg / 200 μL, or 20 μg / mL.

[0144] 2. Screening factor: dilution factor of acridine ester labeled antibody. When preparing the working solution of acridine ester labeled antibody, the stock solution of acridine ester labeled antibody was diluted 500, 1000, 2000, and 4000 times with acridine ester preservation solution, respectively.

[0145] Negative and positive sera identified by the porcine reproductive and respiratory syndrome virus (PRRSV) antibody detection kit (IDEXX PRRS 2XR) were used as test substances. Following the usage method of the fully automated chemiluminescent detection reagent for PRRSV N antibody provided in Example 1, different concentrations of acrid ester-labeled antibody working solutions prepared in this screening example were used for detection. Each sample was tested three times, and the P / N ratio was calculated.

[0146] The results are as follows Figure 3 As shown, the acridine ester-labeled antibody working solutions obtained by 500-fold, 1000-fold, 2000-fold, and 4000-fold dilutions all achieved good detection results. Among them, the detection effect was best at a dilution factor of 1000.

[0147] 3. Screening factor: serum dilution ratio. The serum to be tested was diluted with serum diluent at volume ratios of 1:0, 1:5, 1:10, 1:20, and 1:40 before being used as the test substance for detection.

[0148] The serum diluent consisted of the following components: 0.5% w / v hydroxypropyl-β-cyclodextrin, 1% w / v casein, 2% w / v trehalose, 2 mM EDTA, 0.05% v / v Tween-20, and 0.1% v / v proclin 300.

[0149] Negative and positive sera identified by the porcine reproductive and respiratory syndrome virus (PRRSV) antibody detection kit (IDEXX PRRS 2XR) were diluted and used as test sera. The detection was performed according to the fully automated chemiluminescent detection reagent for PRRSV N antibody provided in Example 1. Each sample was tested three times, and the P / N ratio was calculated.

[0150] The results are as follows Figure 4 As shown, good detection results were obtained at dilution ratios of 1:5, 1:10, 1:20, and 1:40. Among them, the detection effect was best at a dilution ratio of 1:10.

[0151] 3. Screening factor: Sample volume. The sample volume of the analyte during detection was limited to 5 μL, 10 μL, 20 μL, and 30 μL, respectively.

[0152] Negative and positive sera identified by the porcine reproductive and respiratory syndrome virus (PRRSV) antibody detection kit (IDEXX PRRS 2XR) at different dosages were used as test substances, and the detection was performed according to the fully automated chemiluminescent detection reagent for PRRSV N antibody provided in Example 1. Each sample was tested three times, and the P / N ratio was calculated.

[0153] The results are as follows Figure 5 As shown, good detection results were obtained when the sample volume was 5 μL, 10 μL, 20 μL, and 30 μL. Among them, the detection effect was the best when the sample volume was 10 μL.

[0154] 4. Screening factor: Magnetic microparticle sample volume. The sample volume of the superparamagnetic microparticle working solution during detection was limited to 20 μL, 50 μL, and 100 μL, respectively.

[0155] Negative and positive sera identified by the porcine reproductive and respiratory syndrome virus (PRRSV) antibody detection kit (IDEXX PRRS 2XR) were used as test substances. Different amounts of superparamagnetic microparticle working solution were added for detection, following the usage instructions for the fully automated chemiluminescent detection reagent for PRRSV N antibody provided in Example 1. Each sample was tested three times, and the P / N ratio was calculated.

[0156] The results are as follows Figure 6As shown, good detection results were obtained when the sample loading volume of the superparamagnetic microparticle working solution was 20 μL, 50 μL, and 100 μL. Among them, the detection effect was best when the sample loading volume of the superparamagnetic microparticle working solution was 50 μL.

[0157] 5. Screening factor: One-step reaction time (the reaction time after the analyte is mixed with the superparamagnetic microparticle working solution). The one-step reaction time was set to 5 min, 10 min, 15 min, and 20 min respectively.

[0158] Negative and positive sera identified by the porcine reproductive and respiratory syndrome virus (PRRSV) antibody detection kit (IDEXX PRRS 2XR) were used as test substances. The detection was performed using the fully automated chemiluminescent detection reagent for PRRSV N antibody provided in Example 1, with different one-step reaction times set. Each sample was tested three times, and the P / N ratio was calculated.

[0159] The results are as follows Figure 7 As shown, good detection results were achieved when the one-step reaction time was 5 min, 10 min, 15 min, and 20 min. Among them, the detection effect was the best when the one-step reaction time was 10 min.

[0160] 6. Screening factor: Two-step reaction time (reaction time after adding acridine ester-labeled antibody working solution). The reaction time after adding acridine ester-labeled antibody working solution during detection was limited to 5 min, 10 min, 15 min, and 20 min, respectively.

[0161] Negative and positive sera identified by the porcine reproductive and respiratory syndrome virus (PRRSV) antibody detection kit (IDEXX PRRS 2XR) were used as test substances. The detection was performed using the fully automated chemiluminescent detection reagent for PRRSV N antibody provided in Example 1, with different two-step reaction times set. Each sample was tested three times, and the P / N ratio was calculated.

[0162] The results are as follows Figure 8 As shown, good detection results were achieved when the two-step reaction time was 5 min, 10 min, 15 min, and 20 min. Among them, the detection effect was best when the two-step reaction time was 10 min.

[0163] Example 1 (Detection of positive and negative cut-off values ​​and diagnostic sensitivity and specificity)

[0164] The cut-off values, diagnostic sensitivity, and specificity were determined using known background serum. The cut-off values, diagnostic sensitivity, and specificity were determined using the test reagent prepared in Example 2 and its usage method.

[0165] Highly immunogenic PRRSV-positive porcine serum was serially diluted using serum diluent. The maximum dilution factor for a positive ELISA test was determined to be 1:2048 using the IDEXX PRRS 2XR Porcine Reproductive and Respiratory Syndrome Virus Antibody Detection Kit. Standards were prepared at dilutions of 1:4096, 1:2048, 1:1024, 1:512, and 1:256, with antibody titers defined as 50 U, 100 U, 200 U, 400 U, and 800 U, respectively (antibody titers for other test samples were defined using the same method). Serum diluent without serum was defined as 0 U. Chemiluminescence values ​​were measured, and a standard curve was plotted with antibody titer on the x-axis and chemiluminescence value on the y-axis.

[0166] Standard curve such as Figure 9 As shown, the correlation coefficient of the main curve is 0.999897.

[0167] 265 porcine reproductive and respiratory syndrome virus (PRRSV) serum samples with clear backgrounds (131 PRRSV-negative sera and 134 PRRSV-positive sera) that had been tested with the IDEXX PRRS 2XR antibody detection kit were selected. The antibody levels in the negative and positive sera were measured using the detection reagent described in Example 2, following its usage instructions. Receiver operating characteristic (ROC) curves were plotted using SPSS 26.0 software to analyze the serum PRRSV N antibody levels.

[0168] ROC curve as follows Figure 10 As shown. The area under the curve (AUC) of the ROC curve is 0.985, with a significance level of [missing information]. P (Area = 0.5) < 0.0001. The maximum Youden index of 0.978 corresponds to a titer of 35.61 U. That is, when the PRRSV N antibody titer is greater than 35.61 U, the serum PRRSV N antibody is considered positive, and vice versa. Under these conditions, the diagnostic sensitivity is 100% and the specificity is 96.9%.

[0169] Example 2 (Blank Limit Detection)

[0170] Using the detection reagent prepared in Example 2 and its usage method, serum dilution was used as the sample, and the measurement was repeated 20 times to obtain the relative luminescence (RLU) values ​​of the 20 measurements. The mean X and standard deviation SD were calculated to obtain X±2SD. Based on the 0 U and 50 U relative luminescence (RLU) values ​​of the standard curve in Detection Example 1, a two-point regression fitting was performed to obtain a linear equation (y=0.0001214x-0.61). The RLU value corresponding to X+2SD was substituted into the linear equation to calculate the corresponding antibody efficacy value, which is the blank limit.

[0171] The results are shown in Table 1.

[0172] Table 1

[0173]

[0174] Example 3 (Intra-batch and Inter-batch Repeatability Testing)

[0175] Using the detection reagent prepared in Example 2 and its usage method, one PRRSV antibody-positive serum with a clear background, which had been tested by the IDEXX PRRS 2XR antibody detection kit, and one PRRSV antibody-negative serum were selected. In intra-batch experiments, the same batch of detection reagent was used, and the tests were repeated 10 times to calculate the coefficient of variation. In inter-batch experiments, three different batches of detection reagent were used, and each batch was tested 10 times under the same conditions to calculate the coefficient of variation.

[0176] Table 2 Intra-batch repeatability results

[0177]

[0178] Table 3. Results of inter-batch repeatability

[0179]

[0180] The results are shown in Tables 2 and 3. The detection reagent prepared in Example 2 showed good intra-batch and inter-batch reproducibility in detecting porcine reproductive and respiratory syndrome virus (PRRSV) N antibody.

[0181] Detection Example 4 (Linear Range)

[0182] Using the detection reagent prepared in Example 2 and its usage method, PRRSV-positive serum with a clear background, detected by the IDEXX PRRS 2XR antibody detection kit, was appropriately diluted with serum diluent to serve as a standard. The standard, close to the upper limit of the linear range, was diluted to at least five concentrations, with the lower concentrations close to the lower limit of the linear range. Each concentration was tested three times, and the average value was calculated. The linear correlation coefficient r was then calculated.

[0183] Table 4 Linear Range Results

[0184]

[0185] The results are shown in Table 4. When the titer of the porcine reproductive and respiratory syndrome virus N antibody was 0.35 U-811.32 U, the detection reagent prepared in Example 2 showed good linearity during detection.

[0186] Test Example 5 (Interference Immunity Test)

[0187] 1. Using the detection reagent prepared in Example 2 and its usage method, PRRSV serum (5 hemolyzed samples and 5 lipemic samples; observed visually) that had been detected by the Porcine Reproductive and Respiratory Syndrome Virus Antibody Detection Kit (IDEXX PRRS 2XR) was tested. Control Group 1 was basically the same as the detection reagent prepared in Example 2 and its usage method, except that the detection reagent did not contain serum diluent and the serum to be tested was not diluted during the test.

[0188] Table 5

[0189]

[0190] Note: Samples numbered 1-5 are hemolyzed samples, and samples numbered 6-10 are lipemic samples. + indicates positive; - indicates negative. When using the test reagent of Example 2 or control group 1 for testing, if the antibody titer is greater than 35.61 U, it is judged as a positive sample; otherwise, it is a negative sample.

[0191] The test results are shown in Table 5. Without the addition of serum diluent, false positives may occur when testing hemolyzed or lipemic samples.

[0192] 2. Using serum samples 3 and 9 from Experiment 1 as the subjects to be processed, the detection reagents prepared in Example 2 and their usage methods were used again for detection. The detection of control group 2 was basically the same as that of the detection reagents prepared in Example 2 and their usage methods, except that the control serum diluent was replaced with the serum diluent in Example 2. The control serum diluent consisted of the following components: 0.01 M PBS buffer (pH 7.4), 2% w / v trehalose, 0.05% v / v Tween-20, and 0.1% v / v Proclin 300.

[0193] Table 6

[0194]

[0195] Note: + indicates positive; - indicates negative. When using the test reagent of Example 2 or control group 2 for testing, if the measured antibody titer is greater than 35.61 U, it is judged as a positive sample; otherwise, it is a negative sample.

[0196] The test results are shown in Table 6. Without hydroxypropyl-β-cyclodextrin and EDTA in the serum diluent, it is difficult to accurately detect hemolyzed and lipemic samples, and false positive results are easily obtained.

[0197] 3. Using the serum diluent from Example 2, appropriately dilute the PRRSV-positive serum with a clear background detected by the IDEXXPRRS 2XR antibody detection kit (theoretical antibody titer: 80U) to obtain a sample. Using the detection reagent prepared in Example 2 and its usage method, analyze the interfering substances (triglycerides, hemoglobin, bilirubin, and protein) in the sample to confirm the detection reagent's limit concentration against these interfering substances. Test each concentration gradient of interfering substance sample three times consecutively, and take the average value. Use the average value of the low-concentration interfering substance sample as the standard to calculate the relative deviation of other samples from it. When the relative deviation exceeds ±10%, the corresponding interfering substance concentration is considered the limit concentration at which the interfering substance interferes with the reagent.

[0198] Table 7 Results of Hemoglobin Interference Resistance Test

[0199]

[0200] Table 8 Results of Triglyceride Interference Resistance Test

[0201]

[0202] Table 9 Results of Detection of Anti-bilirubin Interference Ability

[0203]

[0204] Table 10 Results of protein interference resistance test

[0205]

[0206] The results are shown in Tables 7-10. For hemoglobin concentrations ≤500 mg / dL, triglyceride concentrations ≤1000 mg / dL, bilirubin concentrations ≤20 mg / dL, and protein concentrations ≤10 g / dL, no interference was found with the detection reagents of this invention.

[0207] Example 5 (In-system stability evaluation)

[0208] The detection reagents prepared in Example 2 and their usage methods were used for quality control testing (the quality control samples were the corresponding serum samples with antibody titers of 100 U and 400 U in Detection Example 1), once a day for 40 consecutive days. The Z-score was calculated (Z-score = (detected value - target value) / (target value × 5%)).

[0209] Judgment criteria: If all quality control points are randomly distributed near the mean (Z score = 0), and the vast majority of points (approximately 95%) fall within the Z score range of ±2, the reagent is considered to have excellent in-system stability. If a single point exceeds Z score of ±2, any point exceeds Z score of ±3, two consecutive points on the same side exceed Z score of ±2, the difference in Z scores between high and low level quality control points within the same batch exceeds 4, four consecutive points on the same side exceed Z score of ±1, or ten consecutive points are located on the same side of the mean, the reagent is considered to have poor in-system stability.

[0210] The results are as follows Figure 11 As shown.

[0211] The test reagent remained under quality control for 40 days during in-system testing, indicating excellent in-system stability.

[0212] Example 6 (Accelerated Stability Evaluation)

[0213] The serum diluent from Example 2 was used to appropriately dilute PRRSV-positive serum with a clear background, which had been tested using the IDEXXPRRS 2XR antibody detection kit, to serve as a standard. The detection reagents prepared in Example 2 were incubated at 2-8°C (control) and 37°C for 7 days, respectively. After acceleration, the standards (with theoretical antibody titers of 0 U, 50 U, 100 U, 200 U, 400 U, and 800 U, respectively) were tested according to the instructions. Each sample was tested three times, and the mean luminescence value was calculated. The relative deviation of the mean luminescence value detected at 37°C for 7 days was calculated based on the mean luminescence value detected with the reagent at 2-8°C as the baseline.

[0214] Table 11

[0215]

[0216] The results are shown in Table 11. The detection reagent of this invention, after accelerated testing at 37℃ for 7 days, showed a decrease in the luminescence value of the standard sample within 15%, demonstrating excellent thermal stability and avoiding the impact of unexpected factors during transportation and use on performance.

[0217] Case 7 (Clinical Sample Testing)

[0218] Using the detection reagent prepared in Example 2 and its application method, 30 positive serum samples with clear backgrounds and 18 negative serum samples that had been tested with the porcine reproductive and respiratory syndrome virus antibody detection kit (IDEXX PRRS 2XR) were selected for testing. When using the detection reagent in Example 2, if the antibody titer was greater than 35.61 U, it was determined to be a positive sample; otherwise, it was a negative sample.

[0219] Table 12 Compliance Rate Test Results

[0220]

[0221] Note: + indicates positive; - indicates negative.

[0222] The results are shown in Table 12. The detection reagent in Example 2 showed consistent results with the porcine reproductive and respiratory syndrome virus antibody detection kit (IDEXX PRRS 2XR), indicating high detection accuracy.

[0223] The results of the above test examples show that the fully automated chemiluminescence detection reagent for porcine reproductive and respiratory syndrome virus N antibody provided by the present invention has high sensitivity, good specificity, high precision, short reaction time, simple operation, high throughput, and good anti-interference effect.

[0224] The embodiments of the present invention have been described in detail above with reference to the accompanying drawings. However, the present invention is not limited to the above embodiments, and various changes can be made within the scope of knowledge possessed by those skilled in the art without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof can be combined with each other unless otherwise specified.

Claims

1. A detection reagent for detecting antibody to N protein of porcine reproductive and respiratory syndrome virus, characterized by comprising a polypeptide having an amino acid sequence represented by SEQ ID NO: 1 or 2. The kit comprises: a serum diluent, a first reagent and a second reagent; the serum diluent is composed of components with the following concentrations: 0.005 M-0.05 M PBS buffer, 0.05%w / v-1%w / v casein, 0.05%w / v-1%w / v hydroxypropyl-β-cyclodextrin, 1 mM-5 mM EDTA, 1%w / v-3%w / v trehalose, 0.01%v / v-0.1%v / v Tween-20 and 0.05-0.2%v / v Proclin 300; the first reagent comprises magnetic microparticles coated with porcine reproductive and respiratory syndrome virus N protein; the second reagent comprises acridinium ester-labeled anti-swine antibodies.

2. The detection reagent according to claim 1, characterized by The preparation method of the magnetic microparticles coated with porcine reproductive and respiratory syndrome virus N protein comprises the following steps: After the coupling reaction of the magnetic microparticles with carboxyl active groups on the surface and the porcine reproductive and respiratory syndrome virus N protein, first blocking is performed; the mass ratio of the magnetic microparticles to the porcine reproductive and respiratory syndrome virus N protein is 1000: (1-3).

3. The detection reagent according to claim 2, characterized in that, The coupling reaction is performed at a temperature of 16-37°C for 2-6 hours; and / or, the first blocking is performed using a magnetic microparticle blocking solution comprising components with the following concentrations: 0.005 M-0.05 M PBS buffer, 0.1%w / v-2%w / v BSA and 0.01%v / v-0.1%v / v Tween-20; and / or, the first blocking is performed at a temperature of 16-37°C; and / or, the first blocking is performed for 0.5-4 hours; and / or, the first blocking is performed at a rotation speed of 100-1000 rpm.

4. The detection reagent according to claim 1, characterized by The preparation method of the acridinium ester-labeled anti-swine antibodies comprises the following steps: After the cross-linking of the anti-swine antibodies and acridinium ester, second blocking and purification are sequentially performed; when the cross-linking is performed, the molar ratio of the anti-swine antibodies to the acridinium ester is 1: (5-20).

5. The detection reagent according to claim 4, characterized in that The cross-linking is performed at a temperature of 16-37°C for 0.5-2 hours; and / or, the cross-linking is performed at a rotation speed of 100-1000 rpm; and / or, the second blocking is performed by using a blocking agent; the molar ratio of the blocking agent to the acridinium ester is (100-200): 1; and / or, the second blocking is performed at a temperature of 16-37°C.

6. The detection reagent according to claim 1, characterized by The detection reagent further comprises at least one of a standard, a quality control, a concentrated washing solution and a chemiluminescent substrate solution.

7. The detection reagent according to claim 6, characterized in that The chemiluminescent substrate solution comprises chemiluminescent substrate A solution and chemiluminescent substrate B solution; the chemiluminescent substrate A solution comprises 0.5%v / v-2%v / v hydrogen peroxide and 0.05 M-0.2 M nitric acid; and the chemiluminescent substrate B solution comprises 0.1 M-1 M sodium hydroxide and 0.1%w / v-1%w / v CTAC.

8. Use of the detection reagent according to any one of claims 1 to 7 in the preparation of a product for detecting N antibody of porcine reproductive and respiratory syndrome virus.

9. Use according to claim 8, characterized in that, The use method of the detection reagent comprises the following steps: After the to-be-tested substance is mixed with the first reagent, the magnetic microparticles are separated and washed; the separated magnetic microparticles are reacted with the second reagent, a chemiluminescence substrate liquid is added, and the relative light intensity is measured.

10. Use according to claim 9, characterized in that, When the to-be-tested substance is reacted with the first reagent, the volume ratio of the to-be-tested substance to the first reagent is 1: (1-10); and / or, the reaction temperature of the to-be-tested substance and the first reagent is 35-40℃; and / or, the reaction time of the to-be-tested substance and the first reagent is 3-20 min; and / or, the mass ratio of the magnetic microparticles to the acridinium ester-labeled anti-swine antibody is 1 mg: (0.1-10) μg; and / or, the reaction time of the separated magnetic microparticles and the second reagent is 3-20 min; and / or, the reaction temperature of the separated magnetic microparticles and the second reagent is 35-40℃.

Images