Endophyte Schizophyllanthus commune CY01-1H for increasing jasmonic acid hormone content and dendrobine content of dendrobium nobile and application of endophyte Schizophyllanthus commune CY01-1H

By co-culturing Dendrobium nobile with the endophytic fungus Schizophyllum commune CY01-1H, the problem of insignificant quality in the semi-wild cultivation of Dendrobium nobile was solved, and the contents of jasmonic acid and dendrobine were significantly increased, thus improving the quality and yield of Dendrobium nobile.

CN120888412APending Publication Date: 2025-11-04ZUNYI MEDICAL UNIVERSITY
View PDF 0 Cites 1 Cited by

Patent Information

Application Number
CN202510959581.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-11
Publication Date
2025-11-04

AI Technical Summary

Technical Problem

Existing technologies for the semi-wild cultivation of Dendrobium nobile suffer from problems such as insignificant quality, long cycle, and poor sustainability, resulting in poor accumulation of active ingredients in Dendrobium nobile.

Method used

The endophytic fungus *Schizophyllum commune* CY01-1H was co-cultured with *Dendrobium nobile*. The accumulation of jasmonic acid and dendrobine was promoted by inoculating the fungal culture in 1/2 MS medium and co-culturing under greenhouse conditions.

Benefits of technology

It significantly increased the jasmonic acid and dendrobine content of Dendrobium nobile, improved its quality, and provided broad application prospects for high-yield and high-quality cultivation of Dendrobium nobile.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120888412A_ABST
    Figure CN120888412A_ABST
Patent Text Reader

Abstract

The invention discloses endophyte Schizophyllanthus commune CY01-1H for improving synthesis of jasmonic acid and dendrobine of dendrobium nobile seedlings and application of the endophyte Schizophyllanthus commune CY01-1H, and belongs to the technical field of plant secondary metabolism regulation and control and microorganisms. The preservation number of the endophyte CY01-1H is CGMCC (China General Microbiological Culture Collection Center) No.42003; the strain is preserved in China General Microbiological Culture Collection Center on May 12, 2025, and the address is No.3, Yard 1, Beichen West Road, Chaoyang District, Beijing; the endophytic fungus CY01-1H obtained through separation comes from a healthy dendrobium nobile plant, the content of jasmonic acid of dendrobium nobile and accumulation of dendrobine can be increased by planting the endophytic fungus CY01-1H in dendrobium nobile, the normal growth state of the plant is not affected, and wide application prospects are brought for improving the quality of the dendrobium nobile medicinal material.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of plant secondary metabolism regulation and microbial technology, and is a kind of Dendrobium nobile Lindl. Endophytic fungus Schizophyllum commune CY01-1H (Schizophyllum commune CY01-1H) and its application in promoting the accumulation of Dendrobium nobile Lindl. Loline content. BACKGROUND

[0002] Dendrobium nobile Lindl. is a perennial herb of Orchidaceae Dendrobium. The 2025 edition of Chinese Pharmacopoeia records that Dendrobium nobile Lindl. tastes sweet and cold, and belongs to stomach and kidney channels, and is used to benefit stomach, produce saliva, nourish yin and clear heat, and is used for heat disease with damaged body fluid, dry mouth and thirst, stomach yin deficiency, poor appetite and vomiting, post-disease heat, yin deficiency and fire, dim eyesight, and flaccid muscles and bones. Modern medical research shows that the active ingredient loline in Dendrobium nobile Lindl. has the effects of lowering blood lipids, anti-tumor and neuroprotection, etc.

[0003] Chishui in Guizhou is the original producing area of Dendrobium nobile Lindl. Due to the gradual decrease of wild resources, large-scale imitated wild planting has been carried out, which inevitably brings the problem of the original quality of medicinal materials. At present, although there are many ways to improve the quality of Dendrobium nobile Lindl. and promote the accumulation of active ingredients, the period is long, the effect is not significant, and there are problems such as poor sustainability and soil compaction.

[0004] Endophytic fungus is a fungus that lives in the tissues and organs of healthy plants at certain stages or all stages, and exists universally in higher plants. Studies have found that the mutual relationship between endophytic fungus and host plants is an important way to promote plant growth and secondary metabolism, and endophytic fungus can promote the growth of host plants and the accumulation of secondary metabolic components, which has important research value. For example, the endophytic fungus Pantoea, Pseudomonas, Sphingomonas and Dothideomycetes of Salvia miltiorrhiza can promote the generation of tanshinone. The endophytic fungus of Echinacea purpurea affects the production of volatile organic compounds (VOCs), phenylalanine and alkanamide in the host plant. The endophytic fungus Azospirillum brasilense in Cannabis sativa promotes the accumulation of metabolic products Δ9-tetrahydrocannabinol (THC) and cannabidiol (CBD). Endophytic fungus and its host Festuca elata are symbiotic, which promotes the host to synthesize four types of alkaloids.

[0005] However, there are few reports on the application of endophytic fungi to improve the yield and quality of Dendrobium nobile, and therefore, it is of great significance to study the ecosystem composed of Dendrobium nobile and its endophytic fungi, to improve the yield and quality of Dendrobium nobile and accelerate the development of Dendrobium nobile industry. SUMMARY

[0006] The present application aims at the deficiencies of the prior art, and provides an endophytic fungus Schizophyllum commune CY01-1H of Dendrobium nobile and applications thereof.

[0007] In a first aspect, the present application provides an endophytic fungus, which is isolated and purified from stems of Dendrobium nobile Lindl. of Orchidaceae Dendrobium, and is classified and named as Schizophyllum commune CY01-1H. The strain has been preserved, and the strain preservation number is CGMCC No. 42003, the preservation date is May 12, 2025, and the preservation unit is China General Microbiological Culture Collection Center (CGMCC) located at No. 1, Beichen West Road, Haidian District, Beijing, China, with a postcode of 100101.

[0008] The endophytic fungus has the following solid culture characteristics: the colony is white, the aerial hyphae are abundant, long and dense, the surface has radial wrinkles, the edge is neat, and there is no intramural hypha, as shown in the accompanying drawings. Figure 1 .

[0009] The PDA medium has the following formula: 200 g of potatoes, 20 g of glucose, 1000 mL of distilled water, 15 g of agar, and natural pH.

[0010] The endophytic fungus has the following morphological characteristics under an optical microscope: the hyphae are colorless and transparent, have septa, and have many branches; the spores are colorless, smooth, and oval-shaped, as shown in the accompanying drawings. Figure 2 .

[0011] The endophytic fungus has the following morphological characteristics under a scanning electron microscope: closed junctions are generated at the separation sites, short and curved lateral peg-shaped protrusions and tear-drop-shaped spherical secretions can be seen on the surface of the hyphae, and no fruiting body and spore structure is seen, as shown in the accompanying drawings. Figure 2 .

[0012] The ITS amplified base sequence of the endophytic fungus of the present application is shown as SEQ ID NO. 1, and the sequencing result is subjected to sequence alignment on the NCBI website (http: / / blast.ncbi.nlm.nih.gov / Blast.cgi), and the homology with Schizophyllum commune strain J21L-7 (ON543238) reaches 99%. The sequence alignment is performed by using MEGA7.0 software, and the phylogenetic tree of the endophytic fungus is analyzed by using the neighbor-joining (NJ) method, and the phylogenetic tree of the endophytic fungus evolution is shown in the following figure. Figure 3 .

[0013] Another object of the present application is to provide a bacterial suspension comprising the endophyte CY01-1H described above.

[0014] Another object of the present application is to provide a fermentation liquor obtained by culturing the endophyte CY01-1H described above.

[0015] Further, the preparation method is as follows:

[0016] The CY01-1H single colony is inoculated into PD liquid medium, and cultured on a shaking table, the culture temperature is 28℃, the rotation speed is 220 rpm, the culture time is 48-72 h, and the culture is performed until the bacterial content in the solution is greater than 4.5x10 8 CFU / mL, and the fermentation liquor is obtained.

[0017] Another object of the present application is to provide a bacterial agent for increasing the jasmonic acid and the palmatine content of Dendrobium nobile Lindl. by using the colony culture, the bacterial suspension or the fermentation liquor of the endophyte Schizophyllum commune CY01-1H.

[0018] In the second aspect of the present application, the endophytic fungus Schizophyllum commune is used for increasing the jasmonic acid and the palmatine content of Dendrobium nobile Lindl.

[0019] The application for increasing the jasmonic acid and the palmatine content of Dendrobium nobile Lindl. can promote the increase of the jasmonic acid and the palmatine content of Dendrobium nobile Lindl. by co-culturing the CY01-1H bacterial liquid with Dendrobium nobile Lindl., and the co-culturing needs to inoculate the bacterial liquid into 1 / 2MS and co-cultivate with the tissue culture seedlings of Dendrobium nobile Lindl., and place in a greenhouse, the temperature is 25±1℃, the light / dark cycle is 12 / 12 h, and the relative humidity is 60-70%.

[0020] Further, the technical scheme is mainly achieved by the following: (1) taking the endophytic fungus strain, picking up a small amount of mycelium under sterile conditions with an inoculation needle, and inoculating into PDA culture medium (formula: potatoes 200 g, glucose 20 g, agar 15 g, distilled water 1000 mL, pH natural), dark culture at 25 DEG C and 65% humidity for 7 days; (2) under sterile conditions, punching into 10 mL of sterile water, washing the plate with a sterile inoculation ring, after washing completely, sucking the bacterial liquid into a sterile centrifugal tube, mixing, and obtaining CY01-1H bacterial liquid, and transferring the bacterial liquid to 1 / 2MS culture medium for co-culture with Dendrobium candidum tissue culture seedlings. The bacterial liquid is sucked into the bottom of the tissue culture bottle with a pipette gun. The inoculated Dendrobium candidum tissue culture seedlings are placed in a greenhouse for co-culture (cultured for 7 weeks) under the conditions of temperature 25 DEG C + / - 1 DEG C, light intensity 1500-2000 lx, light / dark cycle 12 / 12 h, and relative humidity 60-70%, which can significantly increase the contents of jasmonic acid and shihuchin in Dendrobium candidum. The formula of 1 / 2MS culture medium ( / L) is: potassium nitrate 1.9 g, ammonium nitrate 1.65 g, potassium dihydrogen phosphate 0.17 g, magnesium sulfate 0.18 g, calcium chloride 0.33 g, potassium iodide 0.83 mg, boric acid 6.2 mg, manganese sulfate 16.9 mg, zinc sulfate 8.6 mg, sodium molybdate 0.25 mg, copper sulfate 0.025 mg, myo-inositol 0.1 g, gaseous cobalt 0.025 mg, glycine 2.0 mg, sodium EDTA 37.26 mg, vitamin B1 0.1 mg, ferrous sulfate 15.2 mg, nicotinic acid 0.5 mg, vitamin B6 0.5 mg, sucrose 7.0 g, agar powder 7.0 g, distilled water 1000 mL, and pH 5.8-6.0.

[0021] The beneficial effects of the present application are:

[0022] The endophytic fungus CY01-1H (Schizophyllum commune) of the present application can significantly increase the contents of jasmonic acid and shihuchin in Dendrobium candidum by co-culture with Dendrobium candidum. The endophytic fungus of the present application has a significant effect on improving the quality of Dendrobium candidum, and brings broad application prospects for high-yield and high-quality cultivation of Dendrobium candidum. BRIEF DESCRIPTION OF DRAWINGS

[0023] Figure 1 Fig. 1 is a colony morphology diagram of the endophytic fungus Schizophyllum commune CY01-1H on PDA culture medium;

[0024] Figure 2 Fig. 2 is a mycelium morphology of the endophytic fungus Schizophyllum commune CY01-1H under an optical microscope and a scanning electron microscope;

[0025] Figure 3: DNL19 (Phyllosticta fallopiae) phylogenetic tree (NJ method) based on ITS3 and ITS4 primer amplification;

[0026] Figure 4 : Schizophyllum commune CY01-1H improves the content of jasmonic acid and bicullarin in Dendrobium nobile Lindl. result chart;

[0027] Figure 5 : Schizophyllum commune CY01-1H improves the bicullarin differential gene expression heat map of Dendrobium nobile Lindl.;

[0028] Figure 6 : Schizophyllum commune CY01-1H improves the key gene expression amount result chart of jasmonic acid and bicullarin in Dendrobium nobile Lindl.; DETAILED DESCRIPTION

[0029] The endophytic fungus of the present application is isolated and purified from the stems of Dendrobium nobile Lindl. of Orchidaceae Dendrobium. The technical solutions of the present application will be described clearly and completely in combination with the embodiments of the present application. Obviously, the described embodiments are part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the scope of protection of the present application.

[0030] Embodiment 1:

[0031] The endophytic fungus is isolated according to the following steps:

[0032] The collected stems of Dendrobium nobile Lindl. are washed with flowing clean water for 3-5 min to remove surface attachments, and then transferred to a clean bench and the surface moisture is absorbed with sterile filter paper. Then, surface disinfection treatment is performed, first, 75% ethanol is rinsed for 30-60 s, then sterilized distilled water is rinsed for 3-5 times, then 5% sodium hypochlorite solution is rinsed for 30-60 s, then sterile water is rinsed for 3-5 times, and finally the surface moisture is absorbed with sterile filter paper to avoid the influence of residual disinfectant on the growth of endophytic fungi. The stems that have been surface disinfected are cut into 0.5 cm sections with a sterile scalpel, and the cut sections are inoculated on the prepared potato dextrose agar (PDA) solid medium, and the cut surface of the tissue block is in contact with the medium during inoculation. After marking, the culture is incubated in a 28℃ constant temperature incubator for 3-7 d.

[0033] After the exogenous bud of Dendrobium devonianum W.W Smith grows mycelium in PDA culture medium, the color and morphology of the grown colony are preliminarily identified, and the colony edge growth point with typical difference is selectively separated by using a sterile inoculation needle, and then is moved to a new PDA plate, and is cultured in a 28°C constant temperature incubator for 3-7 days, and is observed and recorded every day, and the mycelium tip purification method is continuously used for purification until each colony is a single pure culture. Figure 1 As shown in the PDA culture medium, the strain grows uniformly, the mycelium is white, the texture is loose, the surface has radial wrinkles, and the edge is neat; under an optical microscope, the mycelium is colorless and transparent, has a septum, and has more branches. The scanning electron microscope observes that the closed joint is generated at the separation, the mycelium surface can see short and curved lateral peg-shaped protrusions and tear drop-shaped spherical secretions, and no fruit body and spore structure is observed (see Figure 2 ).

[0034] The PDA culture of the obtained strain CY01-1H is sent to Chengdu Luoning Biotechnology Co., Ltd. for molecular biology identification of the strain. The sequencing results are compared with the NCBI database by Blast, the highest scoring strain in the comparison results is selected for display, and the sequence length (Length), score (Score), E value (E value), identity (Identity) and gap (Gaps) are given for reference. At the same time, EzTaxon (prokaryote), RDP database (prokaryote) or UNITE database (fungi) are used for checking.

[0035] The result obtained is Schizophyllum commune. The sequence is shown as SEQ ID NO. 1.

[0036]

[0037] SEQ ID NO. 1:

[0038] TAGGTGTCTACCTGATTTGAGGTCAGTCAAAAGTTAGCGCACAAGTCGCTAGTCTCAGT

[0039] CAAGAGACGGTTAGAAGCAGA

[0040] CTCCTATTGAAACTGACTAGGTCAGCCCCGAGATGGTCAACGACGTAGAAATTATCACA

[0041] TCGGAGACGCGATCCCGCAAG

[0042] GGAAATCCGCTAATACATTTAAGAGGAGCTGGCTCCGTTAGGCTCCAGCAGACCTCCAC

[0043] TTCCAAGCCACTCTCGAGACC

[0044] GAAGTCAAAAGAGGGTTGATGGTATTTAATGACACTCAAACAGGCATGCCCCTCGGAA

[0045] TACCAAAGGGCGCAAGGTGCGT

[0046] TCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCG

[0047] TTCTTCATCGATGCGAGAGC

[0048] CAAGAGATCCGTTGTCGAAAGTTGTATTAACTTTTTAGGGTCTGTCAAGACCATGATTA

[0049] CATTCGTTAACATACTTTAAG

[0050] GTGTGAGGTAGACGTAGTCAACCGCCGCCCGTGAAGGCTTTGGGACTACATAAGGTGC

[0051] ACAGGATCAGAACAAGATGAAC

[0052] TTGTTTGATTCGTTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTAGTTTT

[0053] The obtained Dendrobium devonianum endophytic fungus is preserved in China General Microbiological Culture Collection Center on May 12, 2025, and is classified and named as Schizophyllum commune CY01-1H, and the preservation number is CGMCC No.42003.

[0054] Example 2:

[0055] The CY01-1H frozen tube was taken, and a small amount of mycelium was picked up with a sterile inoculation needle under sterile conditions, and was inoculated into PDA medium for strain activation, and was cultured at 25°C and 65% humidity until the flat plate was obtained. The flat plate was scraped with a sterile inoculation ring, and after the scraping was completed, the mycelium liquid was sucked into a sterile centrifuge tube, and was mixed, to obtain the CY01-1H mycelium liquid. The mycelium liquid was transferred to 1 / 2MS medium for co-culturing with the D. candidum tissue culture seedlings. The mycelium liquid was sucked into the bottom of the tissue culture bottle with a pipette gun. The inoculated D. candidum tissue culture seedlings were placed in a greenhouse, and were co-cultured at a temperature of 25±1°C, a light intensity of 1500-2000lx, a light / dark cycle of 12 / 12h, and a relative humidity of 60-70% (cultured for 7 weeks), and 20 repeats were arranged in parallel. After the culture was completed, 6 bottles of D. candidum tissue culture sterile seedlings were randomly selected for determination of jasmonic acid content and baihain content.

[0056] The GC-MS was used to determine the baihain content of the D. candidum, and the chromatographic conditions were as follows: a DB-1 capillary column, a stationary phase of 100% dimethylpolysiloxane, a column length of 30m, an inner diameter of 0.25mm, and a film thickness of 0.25μm. The initial temperature of the programmed temperature was 80°C, and was increased to 250°C at a rate of 10°C per minute, and was maintained for 5min; the injection amount was 1μL, and the split ratio was 100:1; the detection conditions were as follows: a detector temperature of 250°C, an air flow of 300mL / min, a hydrogen gas flow of 30mL / min, a tail gas flow of 25mL / min, and a carrier gas flow of 1mL / min. The baihain internal standard mixed control solution was prepared as follows: 2mL of a 50.00μg / mL baihain solution and 1mL of a 25.00μg / mL naphthalene solution were placed in a 5mL volumetric flask, and were diluted with methanol to serve as the baihain internal standard mixed control solution. The baihain was extracted as follows: 0.25g of D. candidum powder (passed through a No.3 sieve) was placed in a 100mL round-bottom flask, 25mL of a 0.05% formic acid-methanol solution was precisely added, the weight was determined, and the extraction was performed by refluxing in a water bath for 3h. After cooling to room temperature, the weight was determined again, the lost weight was made up with the 0.05% formic acid-methanol solution, and the mixture was shaken, filtered, and 2mL of the filtrate was precisely taken, which was placed in a 5mL volumetric flask, 1mL of the internal standard solution was precisely added, methanol was added to the mark, and the mixture was shaken to serve as the sample solution. The determination results are shown in Table 1. Figure 4

[0057] ​LC-MS determination of jasmonic acid in Dendrobium nobile Lindl; Preparation of test sample solution: The leaves and roots of Dendrobium nobile Lindl were ground and broken by liquid nitrogen; 100 mg of each sample was weighed, and each sample was repeated three times. 0.6 mL of sample extraction solution (acetonitrile + 1% formic acid) was added, and ultrasonic extraction was performed for 30 min. After ultrasonic extraction, the sample was centrifuged at 12000 rpm for 10 min, and the supernatant was collected. Then, 0.4 mL of sample extraction solution was added to the precipitate and oscillated, and ultrasonic extraction was performed for 30 min. The sample was centrifuged at 12000 rpm for 10 min, and the supernatant was collected. The two supernatants were combined. The combined supernatant was dried by nitrogen blowing instrument, and 1 mL of methanol was used for dissolution. The centrifuge tube containing methanol was ultrasonically extracted for 30 min, and then dissolved. After ultrasonic extraction, the sample was centrifuged at 12000 rpm for 10 min, and the supernatant was collected. Chromatographic conditions: SCIEX liquid chromatography-API4000TM triple quadrupole mass spectrometry (HPLC-QqQ-MS / MS) was used to establish a method for determining the content of jasmonic acid in Dendrobium nobile Lindl. The chromatographic column was ACQUITY UPLC BEH C18 1.7 μm 2.1×50 mm Column. The temperature of the automatic sampler was 15°C, and the column temperature was 30°C. The mobile phase was composed of 0.1% formic acid water (A) and acetonitrile (B), and the injection volume and flow rate were 2 μL and 0.2 mL / min, respectively. The elution conditions of the mobile phase are shown in Table 6. Mass spectrometry conditions: API4000TM triple quadrupole mass spectrometry was used to collect mass spectrometry data in MRM negative mode by selecting electric spray ionization (ESI). The determination results are shown in FIG. 6. Figure 4

[0058] The preferred embodiments of the present application have been specifically described above, but the present application is not limited to the described embodiments, and those skilled in the art can make various equivalent modifications or replacements without departing from the spirit of the present application. These equivalent modifications or replacements are all included in the scope defined by the claims of the present application.​

Claims

1. An endophytic bacterium, *Schizophyllum commune* CY01-1H, that enhances the synthesis of jasmonic acid and dendrobine in *Dendrobium nobile* seedlings, characterized in that... The preservation number of this strain is CGMCC No.42003; it was deposited on May 12, 2025 at the China General Microbiological Culture Collection Center, located at No.3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

2. A colony culture, characterized in that, The endophytic fungus Schizophyllum commune CY01-1H described in claim 1 was inoculated into PDA medium and cultured at 28°C for 5–7 days. The colony surface was felt-like, white, and aerial hyphae covered the entire plate.

3. A bacterial suspension, characterized in that, The endophytic fungus Schizophyllum commune CY01-1H as described in claim 1.

4. A fermentation broth, characterized in that, It was obtained by culturing the endophytic fungus Schizophyllum commune CY01-1H as described in claim 1.

5. The fermentation broth according to claim 4, characterized in that, The preparation method is as follows: a single colony of CY01-1H is inoculated into PD liquid medium and cultured on a shaker at 28℃ and 220 rpm for 48–72 hours, until the bacterial count in the solution is greater than 4.5 × 10⁻⁶. 8 Fermentation broth was obtained at a concentration of CFU / mL.

6. A microbial agent, characterized in that, It includes the endophytic bacteria Schizophyllum communeCY01-1H as described in claim 1, the colony culture as described in claim 2, the bacterial suspension as described in claim 3, or the fermentation broth as described in claim 4 or 5.

7. The use of the endophytic fungus CY01-1H of claim 1, the solid culture of claim 2, the bacterial suspension of claim 3, the fermentation broth of claim 4 or 5, or the bacterial agent of claim 6 in increasing the content of jasmonic acid and the content of dendrobine synthesis in Dendrobium nobile.

8. A preparation for increasing the content of jasmonic acid and dendrobine in Dendrobium nobile, characterized in that, The active ingredients are the endophytic fungus CY01-1H as described in claim 1, the solid culture as described in claim 2, the bacterial suspension as described in claim 3, the fermentation broth as described in claim 4 or 5, or the bacterial agent as described in claim 6.

Citation Information

Cited By

  • Schizophyllum commune strains and uses thereof

    CN122128115A