Rhodotorula mucilaginosa TGy002 and application thereof in enriching and converting selenium at low temperature

Abstract

The invention discloses rhodotorula mucilaginosa TGy002 and application thereof in enrichment and selenium conversion at low temperature, and belongs to the technical field of microorganisms, the collection number of the rhodotorula mucilaginosa TGy002 is CCTCC NO: M 20251010, the collection site is China Center for Type Culture Collection, and the collection date is May 9, 2025. The rhodotorula mucilaginosa strain TGy002 developed by the invention can maintain the activity of thalli and the stability of metabolites under a low-temperature condition, improves the product quality and stability, not only can solve the problem of non-uniform distribution of selenium resources, but also can provide a safe and efficient organic selenium source for cold regions, and has a wide application prospect.

Description

Technical Field

[0001] This invention belongs to the field of microbial technology, specifically relating to a strain of Rhodotorula glutinis TGy002 and its application in enriching and converting selenium at low temperatures. This Rhodotorula glutinis has both cold resistance and high efficiency in selenium enrichment, and can be widely used in the food industry, agricultural feed, environmental remediation and biotechnology fields. Background Technology

[0002] Red yeast rice ( Rhodotorula mucilaginosa Rhodotorula glutinis is a widely distributed yeast in the natural environment, belonging to the phylum Basidiomycota and family Rhodotorulaceae. Its cells are oval or spherical and produce red or orange carotenoid pigments, hence its name "red yeast." Rhodotorula glutinis exhibits strong environmental adaptability, capable of growing and reproducing under extreme conditions such as low temperature, high salinity, and low pH, and displays rich metabolic diversity. This unique physiological characteristic makes it highly promising for applications in multiple fields. In the food industry, the extracellular polysaccharides produced by Rhodotorula glutinis possess antioxidant, antitumor, and immunomodulatory activities, and can be used to develop functional foods and dietary supplements. Furthermore, its natural pigments are safe and non-toxic, and can be used as colorants in food and cosmetics, meeting consumer demand for natural and healthy products. In the pharmaceutical field, the metabolites of Rhodotorula glutinis are being studied for drug development and disease treatment; for example, the potential of its extracellular polysaccharides in antitumor and immunomodulatory effects has attracted considerable attention. In the environmental field, Rhodotorula glutinis can degrade environmental pollutants such as petroleum hydrocarbons and polycyclic aromatic hydrocarbons, making it valuable for bioremediation and environmental protection.

[0003] Selenium is an essential trace element for the human body, possessing various physiological functions such as antioxidation, immune enhancement, and cancer prevention. However, selenium resources are unevenly distributed globally, and many regions suffer from selenium deficiency. Traditional selenium supplements primarily utilize inorganic selenium forms, such as sodium selenite and sodium selenate, but their bioavailability is low and they pose potential toxicity risks. Organic selenium, especially selenoamino acids and selenoproteins, has become a research hotspot due to its higher bioavailability and safety. Microbial transformation is one of the effective methods for converting inorganic selenium into organic selenium. Among these methods, yeast is an ideal subject for selenium-enriched microbial research due to its rapid growth rate, ease of cultivation, and high safety. Yeast can convert inorganic selenium into organic forms such as selenoamino acids and selenoproteins, significantly improving the bioavailability and safety of selenium. However, existing selenium-enriched yeast strains generally have low selenium enrichment efficiency under low-temperature conditions, limiting their application in cold regions.

[0004] Therefore, it is of great significance to develop Rhodotorula glutinis strains with high selenium enrichment capacity at low temperatures. Summary of the Invention

[0005] In view of the content in the background art, the purpose of the present application is to provide a strain of Rhodotorula TGy002 and its application in enriching and transforming selenium at low temperature. Through identification, the strain not only has the physiological and biochemical characteristics of Rhodotorula, but also has the ability of low-temperature high-efficiency selenium enrichment.

[0006] The present application provides a strain of Rhodotorula TGy002, which is classified and named as Rhodotorula mucilaginosa TGy002, the preservation number is CCTCC NO: M 20251010, the preservation place is China Center for Type Culture Collection, and the preservation date is May 9, 2025.

[0007] Further, the ITS base sequence of the Rhodotorula TGy002 is shown in SEQ ID NO: 3.

[0008] The present application also provides a culture method of the above-mentioned Rhodotorula TGy002, comprising: 1) inoculating the Rhodotorula TGy002 into a selenium-free YPD culture medium on a shaker for fermentation culture, the fermentation temperature is 26-30 DEG C, and the fermentation time is 20-28 h; 2) after the fermentation is completed, inoculating the seed liquid into a YPD culture medium with different selenium concentrations on a shaker for fermentation culture, the fermentation temperature is 4-28 DEG C, and the fermentation time is 12-72 h.

[0009] Further, the raw materials for preparing the YPD culture medium are as follows: 20 g of tryptone, 10 g of yeast extract, 20 g of glucose, 15 g of agar, and 1000 mL of water.

[0010] Further, the inoculation amount of the seed liquid in step 2) is 8%-12%, preferably 10%.

[0011] Further, the different selenium concentrations in step 2) include 25 μg / mL, 50 μg / mL, 100 μg / mL, 150 μg / mL, and 200 μg / mL, preferably 100 μg / mL.

[0012] The present application also provides the application of the above-mentioned Rhodotorula TGy002 in enriching and transforming selenium at low temperature. Under the condition of 4 DEG C, the selenium enrichment amount of the Rhodotorula TGy002 is 5737.38 μg / g, and the organic selenium transformation ratio is 88.79%.

[0013] Compared with the prior art, the present application has the following beneficial effects: 1、The gelidium TGy002 can efficiently enrich and transform selenium at low temperature, and the low-temperature culture condition can reduce energy consumption, reduce production cost, and improve economic benefit. In cold climate areas, traditional selenium-rich yeast strains are difficult to produce efficiently, but the gelidium TGy002 can break through this limitation, expand the production area, and meet the selenium supplement demand of more areas. The gelidium TGy002 can maintain the activity of the bacterial body and the stability of the metabolic product at low temperature, improve the product quality and stability, and prolong the product shelf life.

[0014] 2、The low-temperature and high-efficiency selenium-rich gelidium TGy002 developed in the application can not only solve the problem of uneven distribution of selenium resources, but also provide a safe and efficient source of organic selenium for cold regions, and has a broad application prospect. BRIEF DESCRIPTION OF DRAWINGS

[0015] Figure 1 It is the growth state of the gelidium TGy002 on the plate with different selenium contents.

[0016] Figure 2 It is a strain phylogenetic tree.

[0017] Figure 3 It is a colony morphology diagram of the gelidium TGy002.

[0018] Figure 4 It is a growth plate diagram of TGy002 and the control strain on the selenium-containing plate at different temperatures.

[0019] Figure 5 It is the selenium-rich dynamic change of TGy002 in the fermentation process. DETAILED DESCRIPTION

[0020] In order to make the purpose, technical scheme and advantages of the present application clearer, the technical scheme of the present application will be described clearly and completely in combination with examples. The specific conditions are not indicated in the examples, and the conventional conditions or the conditions suggested by the manufacturer are used. The reagents or instruments used are not indicated by the manufacturer, and are conventional products that can be purchased on the market.

[0021] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used in the description of the application only for the purpose of describing specific embodiments and is not intended to limit the application. The term "and / or" used herein includes any and all combinations of one or more related listed items.

[0022] Example 1 1、The strain was isolated from the Wen Tang hot spring water in Mingyueshan, Jiangxi.

[0023] 2. Preparation of YPD medium: weigh 20 g of tryptone, 10 g of yeast extract (obtained by decomposing yeast cells), and 20 g of glucose, add water to 1000 mL, stir until uniform, then add 15 g of agar, heat to dissolve, and then store after sterilization at 121°C for 20 min.

[0024] Sodium selenite stock solution: accurately weigh 2.1902 g of sodium selenite, dissolve in deionized water, and dilute to 100 mL in a volumetric flask to obtain a selenium solution with a concentration of 10 g / L, sterilize at 121°C for 20 min, and add to the sterilized medium as needed.

[0025] 3. Plate screening of selenium-resistant strains: mix the sterilized sodium selenite solution and YPD medium according to the requirements of selenium concentrations of 25 μg / mL, 50 μg / mL, 100 μg / mL, 150 μg / mL, and 200 μg / mL, pour the mixture into plates, inoculate the strains into YPD medium without selenium at 28°C and 180 r / min on a shaker for 24 h, then inoculate the strains into plates with different concentrations of selenium, and observe the growth of the strains at 28°C.

[0026] 4. Test of selenium resistance: the colony morphology of the strains of the present application is different in different concentrations of selenium medium. In the absence of selenium ions in the medium, the colony morphology of the strain is pink, creamy, slightly shiny, sticky, entire, and relatively large. After adding selenium ions to the medium, the single colony of the strain in the plate becomes significantly smaller, the colony color changes from pink to brick red, and as the selenium concentration gradually increases, the colony color (brick red) also gradually deepens. This is because the strain can enrich and transform selenium elements in the medium, converting inorganic selenium into organic selenium, and reducing the unabsorbed selenium elements into almost non-toxic elemental selenium, which accumulates in the cells and makes the strain appear brick red in appearance, and the depth of red is positively correlated with the selenium concentration in the medium, which can also reflect the ability of the strain to enrich selenium elements, as shown in Figure 1 .

[0027] 5. Strain identification: CTAB method is used to extract the DNA of the strain of the present application, and ITS universal primers ITS4 (TCCTCCGCTTATTGATATGC, SEQ ID NO: 1) and ITS5 (GGAAGTAAAAGTCGTAACAAGG, SEQ ID NO: 2) are used to amplify the ITS gene of the strain. The PCR amplification product is sent to Qikang Biotechnology Co., Ltd. for sequencing, and the obtained sequencing results are analyzed by comparison in the NCBI database.

[0028] ITS sequence analysis: The strain was identified by determining its ITS sequence (the ITS sequence of the strain of this invention is shown in SEQ ID NO: 3); the sequencing results showed that the strain of this invention is similar to Rhodotorula glutinis (…). Rhodotorula mucilaginosa The similarity between SGM and other similarities was 99.84%, as shown in the results. Figure 2 As shown, Figure 2 This is a phylogenetic tree of the strains.

[0029] SEQ ID NO: 3 TTTTGATATGCTTAAGTTCAGCGGGTAGTCCTACCTGATTTGAGATCTAATCTTAAAATGTAGACATTCTGATTAGAAGCTTCCTTTAACCCAACCCGGCTCTAGTCCGAAGACTAGAATTCCTCAGCGAATAGTCTATTACGCCAAGTCAATCCGAA GTTCGATTGCGGATGCTAATGCATTACGAACGAGCTAGACCGTAAAGGCCAGCAGCGCTCAGAAACCAAACACCTCTTCAATCATTAAGAAAGAGGAGGGTTGAAGTATTCATGACACTCAAACAGGCATGCTCCACGGAATACCATGGAGCGCAAGG TGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGTTGAAAGTTTTATTTTGTTATAAAATTTAATACATTCATAGACTTTGTGTTTATAAGTG AATAGGAGTTCGCTTCTCTGCGAGAGTTACTATCCCAAACAAGTGCACAGGGTTAGAAAGTGAGAGTTCGGACTCCAAGTTAAGTTGGACGTCCTATATTCACTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGATTTTTACCCTTCA Colony morphology analysis: such as Figure 3 As shown, after culturing in YPD medium for 3 days, the colonies were round, pale yellow, wrinkled, and had hairy edges. Based on the combined colony morphology and ITS sequence analysis, the strain of this invention was identified as *Rhodotorula glutinis* (…). Rhodotorula mucilaginosa ), named red yeast ( Rhodotorula mucilaginosa) TGy002. The strain has been preserved in China Center for Type Culture Collection on May 9, 2025, and classified as Rhodotorula mucilaginosa TGy002; the preservation number is CCTCC NO: M 20251010.

[0030] Example 2 1. Selenium enrichment under low temperature conditions: the Rhodotorula mucilaginosa TGy002 strain was inoculated into a selenium-free YDP culture medium and cultured at 28°C and 180 r / min for 24 h, then inoculated into a plate with a selenium concentration of 100 µg / mL, and cultured at 4°C, 10°C, 15°C and 28°C, and the growth of the strain was observed.

[0031] Comparison of selenium enrichment of Rhodotorula mucilaginosa TGy002 and the same strain under low temperature conditions: as shown in Figure 4 , the control strain Rhodotorula mucilaginosa BNCC336017 (purchased from Benabio), the Rhodotorula mucilaginosa TGy002 of the present application has stronger tolerance to low temperature, and also has stronger selenium enrichment capacity under low temperature conditions. The strain cultured at 4°C, 10°C and 15°C can still grow normally, and the colony color also changes from pink to brick red, indicating that the Rhodotorula mucilaginosa TGy002 also has strong selenium enrichment capacity under low temperature conditions. Although the control strain also has certain low temperature tolerance and selenium enrichment capacity, it is far weaker than TGy002.

[0032] 2. Biomass determination: the fermented seed liquid was inoculated into a YPD medium with a selenium concentration of 100 µg / mL at an inoculation amount of 10%, and cultured at 28°C and 180 r / min for 48 h. A certain volume of bacterial liquid was added to a weighed 50 mL centrifuge tube, centrifuged at 6000 r / min for 10 min, and the supernatant was discarded, then washed with deionized water for 3 times to remove free inorganic selenium, and after centrifugation, the precipitated bacterial cells were first frozen in a refrigerator, then placed in a freeze-drying box, dried to a constant weight, and after the centrifuge tube returned to room temperature, the total weight of the bacterial cells and the centrifuge tube was weighed. The bacterial cell dry weight calculation formula is as follows: Bacterial cell dry weight (g / L) = (bacterial cell tube weight (g) - empty tube weight (g)) / bacterial liquid volume (L) Total selenium content determination: A certain amount of bacterial precipitate was precisely weighed in a digestion tube, and 6 mL of digestion solution (volume ratio of nitric acid to hydrogen peroxide was 5:1) or (volume ratio of nitric acid to hydrogen peroxide was 2:1) was added. After standing at room temperature overnight, vortex mixing was performed, pre-digestion was performed at 65°C for 30 min, digestion was performed at 100°C for 60 min, and digestion was performed at 120°C for 60 min, and then the tube was naturally cooled. After the temperature of the liquid in the tube decreased to room temperature, deionized water was used to dilute to 50 mL, and a certain dilution multiple was used. The filtrate was obtained by filtering with a 0.22 μm microporous filter membrane, and the total content of elemental selenium in the filtrate was determined.

[0033] Organic selenium content determination method: A certain amount of selenium-rich strain was precisely weighed in 50 mL of deionized water and boiled in a water bath for 1 h, filtered to obtain a filtrate, diluted to 50 mL, and diluted by a certain multiple. The filtrate was obtained by filtering with a 0.22 μm microporous filter membrane, and the inorganic selenium content was determined, and the intracellular organic selenium content and organic selenium yield were calculated.

[0034] Selenium content determination method: According to the fluorescence spectrophotometric method of GB5009.93-2010, the intracellular inorganic selenium content, organic selenium content and organic selenium yield calculation formula are as follows: Inorganic selenium content (μg / g) = (determined value (μg / L) x 0.05 (L) x dilution multiple) / bacterial mass (g) Organic selenium content (μg / g) = total selenium content (μg / g) - inorganic selenium content (μg / g) Organic selenium yield (mg / L) = intracellular organic selenium content (μg / g) x biomass (g / L) / 1000 Selenium-rich Rhodotorula mucilaginosa ability verification Strong selenium tolerance is the premise of selenium enrichment, but strains with strong selenium tolerance do not necessarily have good selenium enrichment performance, so the selenium enrichment ability is further investigated on the basis of selenium tolerance. From the biomass (as shown in Table 1), under different selenium concentration plates, the growth of the test strains is different. The higher the concentration of Se 4+ , the worse the growth of the strain, indicating that inorganic selenium (sodium selenite) has a significant inhibitory effect on the growth of the strain, and the inhibitory effect gradually increases with the increase of selenium concentration. TGy002 has good selenium enrichment performance, and the selenium concentration is 100 mg / L, which is 6346.37 μg / g, and the ratio of organic selenium to total selenium content can reach 91.35%.

[0035] Table 1 Influence of selenium ion concentration on TGy002 selenium enrichment

[0036] The selenium-enriching capacity of the strain at different temperatures: The fermented seed liquid was inoculated into YPD medium with a selenium content of 100 pg / mL at an inoculation amount of 10%, and cultured at 4°C, 10°C, 15°C and 28°C, 180 r / min on a shaking table for 72 h, and the biomass and selenium content of the strain in the selenium-enriching process were determined.

[0037] As shown in Table 2, although the biomass and selenium content of the strain cultured at low temperature were lower than those of the strain cultured at normal temperature, the experimental results fully proved that the strain had strong low-temperature resistance and could efficiently enrich selenium at low temperature. Specifically, under the culture condition of 4°C, the total selenium content of the strain could reach 5737.38 pg / g, and the proportion of organic selenium was as high as 88.79%. This result showed that even in a low-temperature environment, the strain could maintain a high selenium conversion efficiency and effectively convert inorganic selenium into organic selenium. This property not only embodied the adaptability of the strain in a low-temperature environment, but also provided an important basis for its practical application in cold regions.

[0038] Table 2 Influence of temperature on selenium-enriching capacity of TGy002

[0039] The selenium-enriching capacity of the strain at different fermentation times: The fermented seed liquid was inoculated into YPD medium with a selenium content of 100 pg / mL at an inoculation amount of 10%, and cultured at 28°C, 180 r / min on a shaking table. Every 12 h, the dynamic changes of the biomass and selenium-enriching capacity of the strain in the selenium-enriching process were determined.

[0040] Dynamic changes of selenium-enriching of Rhodotorula mucilaginosa TGy002: As shown in Table 3, it was found that the biomass of the strain after adding selenium ions was significantly lower than that without adding selenium ions. The results showed that after adding 100 pg / mL of selenium ions to the culture medium, the growth of the strain was inhibited, and the logarithmic growth phase was prolonged. In the 72-96 h, after 72 h of culture, the organic selenium concentration of the strain was about 6499.67 pg / g, and the proportion of organic selenium in the total selenium content was about 92.62%. Considering that the organic selenium yield decreased between 72-96 h, the most suitable fermentation time was 72 h. Figure 5 Figure 5

[0041] The above-described embodiments only express several preferred embodiments of the present application, which are described in a more specific and detailed manner, but are not used to limit the present application. It should be noted that the present application can also have various changes and modifications for those skilled in the art, and any modification, equivalent replacement, improvement, etc. made within the concept and principle of the present application shall be included in the protection scope of the present application.​​

Claims

1. A strain of Rhodotorula glutinis TGy002, characterized in that, This yeast is classified and named as Rhodotorula mucilaginosa TGy002, with accession number CCTCC NO: M 20251010, is deposited at the China Center for Type Culture Collection on May 9, 2025.

2. The Rhodotorula glutinis TGy002 according to claim 1, characterized in that, The ITS base sequence of the Rhodotorula glutinis TGy002 is shown in SEQ ID NO:

3.

3. The method for culturing Rhodotorula glutinis TGy002 according to claim 1, characterized in that, include: 1) Inoculate Rhodotorula glutinis TGy002 onto a selenium-free YPD culture medium and ferment it on a shaker. The fermentation temperature is 26-30℃ and the fermentation time is 20-28 h. 2) After fermentation, the seed liquid was inoculated onto YPD culture bases with different selenium concentrations and fermented on a shaker. The fermentation temperature was 4-28℃ and the fermentation time was 12-72 h.

4. The cultivation method according to claim 3, characterized in that, The YPD culture medium was prepared using the following ingredients: 20g tryptone, 10g yeast extract, 20g glucose, 15g agar, and 1000mL water.

5. The cultivation method according to claim 3, characterized in that, In step 2), the seed culture inoculation amount is 8%-12%.

6. The cultivation method according to claim 3, characterized in that, The different selenium concentrations in step 2) include 25 µg / mL, 50 µg / mL, 100 µg / mL, 150 µg / mL, and 200 µg / mL.

7. The application of the Rhodotorula glutinis TGy002 of claim 1 in the enrichment and conversion of selenium at low temperature, wherein at 4°C, the selenium enrichment of the Rhodotorula glutinis TGy002 is 5737.38 μg / g and the organic selenium conversion ratio is 88.79%.

Images