Method for gene editing in vibrio

Abstract

The invention discloses an application of an endogenous CRISPR (clustered regularly interspaced short palindromic repeats)-Cas system in saltwater vibrio in vibrio natriureticus and photobacterium. The invention provides a gene editing method in vibrio natrio and photobacterium, which comprises the following steps: respectively integrating I-F type and I-E type CRISPR-Cas systems of saltwater vibrio into the vibrio natrio and the photobacterium, introducing plasmids with crRNA and homologous repair fragments into the successfully integrated vibrio natrio and photobacterium, and carrying out gene editing to obtain the gene editing gene in the vibrio natrio and the photobacterium. And culturing to obtain the gene editing strain of the target gene. According to the invention, I-F type and I-E type CRISPR-Cas systems from saltwater vibrio still have activity in vibrio natriephalus and photobacterium, so that a gene editing system in the vibrio natriephalus and photobacterium is developed based on the activity, and single gene deletion is accurately realized.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of molecular biology, genetic engineering and synthetic biology, and relates to application of two CRISPR / Cas systems of Vibrio alginolyticus in Vibrio gene editing, in particular, in application in Vibrio natriegens and Photobacterium phosphoreum. BACKGROUND

[0002] CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) was first discovered in bacterial and archaeal genomes, and is an adaptive immune defense mechanism against foreign nucleic acid invasion. Based on its outstanding specificity, high efficiency and accuracy, the technology has been widely used. The type I CRISPR / Cas system depends on the effector complex (Cascade complex), which is composed of multiple Cas protein subunits. At present, the type I system is divided into seven subtypes, I-A to I-G. There are mechanism differences between different subtypes. In the I-F subtype, the Cas1 protein located at the starting position of the Cascade complex inhibits the activity of the core effector nuclease Cas3; while when the complex successfully binds to the target DNA, the activity of Cas3 is inhibited and activated. Unlike the I-E type, the Cascade complex does not contain Cas1 protein, and Cas3 is directly located at the starting end of the complex.

[0003] By transferring artificially designed crRNA into bacteria, Cas3 nuclease is induced to cut the target DNA sequence downstream of PAM, producing double-strand breaks, which can be repaired by natural DNA repair mechanism or homologous directed repair mechanism. Since homologous directed repair provides a homologous repair template, gene editing can be more accurately achieved.

[0004] Given that type I is the most abundant CRISPR / Cas system in most bacteria, in recent years it has become an effective alternative method in the field of bacterial genetic engineering. Compared with type II CRISPR / Cas system, the type I system has a multi-subunit structure and binding mechanism of the Cascade complex, which greatly increases its targeting specificity when it binds to the target DNA by verifying the complete match of the PAM sequence and the target DNA through conformational changes. In addition, when Cas3 is recruited to the target DNA, it exhibits dual activity of helicase and nuclease, and continuously cuts along the target DNA, so Cas3 causes large-scale, irreversible degradation of the target DNA. These characteristics make it unique in large fragment editing, molecular diagnosis, anti-pathogen therapy and synthetic biology. Therefore, developing an efficient gene editing tool based on the type I CRISPR / Cas system in bacteria has broad practical prospects.

[0005] Salinivibrio as a high salt-adapted microorganism, can grow efficiently in high salt environment, and has high value in biotechnology and extreme environment microbial research. The strain contains two I-F type and I-E type CRISPR-Cas systems, which has obvious advantages in the field of molecular biology gene manipulation technology.

[0006] Vibrio natriegens is the fastest growing non-pathogenic bacteria reported so far, and the doubling time in complex medium is very short, less than 10 min. Because Vibrio natriegens has the characteristics of short division time, wide substrate utilization, easy cultivation and safety, it is regarded as an alternative chassis organism to Escherichia coli, but at present the efficient CRISPR gene editing technology in Vibrio natriegens is still relatively lacking, and it is urgent to develop a high-efficiency and precise genome editing tool suitable for Vibrio natriegens.

[0007] Photobacterium is a large family of gram-negative, facultative aerobic, motile bacteria, widely distributed in marine environments. Some Photobacterium strains can synthesize poly(3-hydroxybutyrate) (PHB) using a variety of carbon sources, showing their potential to produce degradable plastics. They are also used as biosensors in food and environmental monitoring. At present, the efficient CRISPR gene editing technology in Photobacterium is still relatively lacking, so it is urgent to develop a high-efficiency and precise genome editing tool suitable for Photobacterium.

[0008] The above-mentioned Vibrio natriegens and Photobacterium belong to the family of Vibrio. Ideally, a high-efficiency and precise genome editing tool suitable for Vibrio strains including Vibrio natriegens and Photobacterium is developed. SUMMARY

[0009] The present application integrates the I-F type and I-E type CRISPR-Cas systems from Salinivibrio into the two chromosomes of Vibrio natriegens and Photobacterium, respectively, and successfully knocks out the capsular polysaccharide gene wbfF of Vibrio natriegens and the PHA synthase gene phaC of Photobacterium, successfully applying the CRISPR-Cas system of Salinivibrio to Vibrio natriegens and Photobacterium, and developing a high-efficiency CRISPR-Cas gene editing tool in Vibrio natriegens and Photobacterium.

[0010] Therefore, the present application provides the application of the I-F type or I-E type CRISPR-Cas system of Salinivibrio in gene editing in Vibrio natriegens or Photobacterium.

[0011] In one embodiment, the Cas gene cluster of the Type I-F or Type I-E CRISPR-Cas system is integrated into the chromosome or genome of the Vibrio natriqum or the Photobacterium phosphoreum, preferably wherein: the nucleic acid sequence of the Cas gene cluster from the Type I-F CRISPR-Cas system in the Halobacterium salinarum is integrated into chromosome 1 of the Vibrio natriqum to obtain a recombinant strain; the nucleic acid sequence of the Cas gene cluster from the Type I-E CRISPR-Cas system in the Halobacterium salinarum is integrated into chromosome 2 of the Vibrio natriqum to obtain a recombinant strain; the nucleic acid sequence of the Cas gene cluster from the Type I-F CRISPR-Cas system in the Halobacterium salinarum is integrated into chromosome 1 of the Photobacterium phosphoreum to obtain a recombinant strain; or the nucleic acid sequence of the Cas gene cluster from the Type I-E CRISPR-Cas system in the Halobacterium salinarum is integrated into chromosome 2 of the Photobacterium phosphoreum to obtain a recombinant strain.

[0012] In one embodiment, the Type I-F CRISPR-Cas system comprises 5 Cas protein coding genes, preferably the GenBank accession number of the included Cas gene cluster sequence is CP114584.1; and / or the Type I-E CRISPR-Cas system comprises 8 Cas protein coding genes, preferably the GenBank accession number of the included Cas gene cluster sequence is CP114585.1.

[0013] In one embodiment, the CRISPR-Cas system further comprises a plasmid expressing crRNA and a homologous repair template, which is introduced into the Vibrio natriqum or the Photobacterium phosphoreum.

[0014] In one embodiment, the crRNA comprises one or more (e.g. 1 to 10, such as 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10) spacer sequences targeting the gene of interest and a repeat sequence (e.g. 1 spacer sequence and 2 repeat sequences, 2 spacer sequences and 3 repeat sequences). Preferably, the spacer sequence targeting the gene of interest comprises a fragment of 30-40 bp (e.g. 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 bp) downstream of the PAM sequence in the gene of interest. Preferably, the repeat sequences of the two CRISPR-Cas systems (Type I-F and Type I-E) are: tttctaagctgcctgtgcggcagtgaac (SEQ ID No. 3); cggttcatccccgtgggcacggggaacac (SEQ ID No. 4), respectively.

[0015] In one specific embodiment, the homologous repair template comprises an upstream fragment and a downstream fragment of the fragment of the target gene to be edited (e.g. knockout, replacement, insertion), preferably the length of the upstream fragment and / or downstream fragment is 1000-1500 bp.

[0016] In one specific embodiment, the PAM sequence of the type I-F CRISPR-Cas system is 5'-CAT-3', and the PAM sequence of the type I-E CRISPR-Cas system is 5'-CGC-3'.

[0017] In one specific embodiment, the plasmid is a plasmid obtained by cloning the crRNA and the homologous repair template fragment into an expression vector, preferably the expression vector is pSEVA341-A4S3 (SEQ ID No. 1) or pSEVA341-ChIIArray (SEQ ID No. 2).

[0018] In one specific embodiment, the target gene is the capsular polysaccharide gene wbfF of Vibrio natriophilus or the PHA synthase gene phaC of Photobacterium phosphoreum.

[0019] In one specific embodiment, the Vibrio damsela is Vibrio damsela TGB10; the Vibrio natriophilus is Vibrio natriophilus ATCC04148; and / or the Photobacterium phosphoreum is Photobacterium phosphoreum TLY01.

[0020] The technical problem solved by the present application is how to use two type I-F and type I-E CRISPR-Cas systems from Vibrio damsela for gene editing in Vibrio, specifically for developing an editing tool in Vibrio natriophilus and Photobacterium phosphoreum.

[0021] To solve the technical problem, the present application integrates two type I-F and type I-E CRISPR-Cas systems from Vibrio damsela into Vibrio natriophilus and Photobacterium phosphoreum, respectively, and introduces a plasmid with crRNA and homologous repair fragments into the recombinant strain, achieving precise editing in Vibrio natriophilus and Photobacterium phosphoreum TLY01.

[0022] The first aspect of the present application provides a recombinant strain for constructing a CRISPR-Cas system, and the specific results are as follows:

[0023] Integrating the nucleic acid sequence of the Cas gene cluster (GenBank accession number: CP114584.1) of the type I-F CRISPR-Cas system from Vibrio damsela into the chromosome 1 of Vibrio natriophilus to obtain a recombinant strain VN::CasF;

[0024] Integrating the nucleic acid sequence of Cas gene cluster of type I-E CRISPR-Cas system of Vibrio natrigens (GenBank accession number: CP114585.1) into chromosome 2 of Vibrio natrium to obtain a recombinant strain VN::CasE;

[0025] Integrating the nucleic acid sequence of Cas gene cluster of type I-F CRISPR-Cas system of Vibrio natrigens (GenBank accession number: CP114584.1) into chromosome 1 of Photobacterium to obtain a recombinant strain TLY01::CasF;

[0026] Integrating the nucleic acid sequence of Cas gene cluster of type I-E CRISPR-Cas system of Vibrio natrigens (GenBank accession number: CP114585.1) into chromosome 2 of Photobacterium to obtain a recombinant strain TLY01::CasE;

[0027] The Cas gene cluster of the type I-F CRISPR-Cas system comprises six Cas proteins, and the Cas gene cluster of the type I-E CRISPR-Cas system comprises eight Cas proteins.

[0028] The Vibrio natrigens is Vibrio natrigens TGB10, the Vibrio natrium is Vibrio natrium ATCC04148, and the Photobacterium is Photobacterium TLY01.

[0029] In a second aspect, the present application provides a recombinant bacterium prepared by the method of the first aspect.

[0030] In a third aspect, the present application provides a method for editing a target gene, which comprises the following steps: introducing a plasmid expressing crRNA and a homologous repair fragment into the recombinant bacterium of the second aspect, and culturing to obtain a bacterium with the target gene edited, thereby realizing gene editing in Vibrio natrium and Photobacterium.

[0031] The crRNA comprises a repeat sequence repeat and a spacer sequence spacer.

[0032] The repeat sequences of the two CRISPR-Cas systems are respectively: tttctaagctgcctgtgcggcagtgaac (SEQ ID No. 3); cggttcatccccgtgggcacggggaacac (SEQ ID No. 4)

[0033] The spacer sequence spacer targeting the target gene is a fragment of 30-40 bp downstream of the PAM sequence of the target gene.

[0034] The PAM sequences of the two CRISPR-Cas systems are 5'-CAT-3' and 5'-CGC-3', respectively.

[0035] The homologous repair templates in the method are 1000-1500 bp fragments upstream of the gene editing (e.g., knockout, replacement or insertion) fragment of the target gene and 1000-1500 bp fragments downstream of the knockout fragment of the target gene.

[0036] The expression plasmids in the method are plasmids obtained by cloning the crRNA and the homologous repair template into an expression vector.

[0037] The expression vectors are pSEVA341-A4S3 (type I-F CRISPR-Cas system verification plasmid) and pSEVA341-ChIIArray (type I-E CRISPR-Cas system verification plasmid).

[0038] The nucleotide sequences of the two expression vectors are sequence 1 and sequence 2.

[0039] In the embodiments of the present application, for example, the target gene in Vibrio needs sodium is the capsule polysaccharide gene wbfF, the amino acid and gene sequence encoded by the gene are shown in GenBank accession number: CP009977.1 (update: 21-NOV-2014); and the target gene in Photobacterium is the PHA synthase gene phaC, the gene sequence in the genome is shown in GenBank accession number: CP090365.1 (update: 20-DEC-2021).

[0040] The gene editing plasmids for expressing the crRNA and the homologous repair fragment are pSEVA341-A4S3-ΔwbfF, pSEVA341-ChIIArray-ΔwbfF, pSEVA341-A4S3-ΔphaC and pSEVA341-ChIIArray-ΔphaC, respectively.

[0041] The gene editing of the target gene in the embodiments of the present application is the knockout of the target gene, and the target gene editing strain obtained in Vibrio needs sodium is ΔwbfF, the only difference between the gene editing strain and the wild type Vibrio needs sodium is that the gene wbfF is absent. The wbfF is a gene encoding a capsule polysaccharide, and inactivating the gene makes the expression of the high molecular weight polysaccharide lost, so that a transparent colony is formed on an agar plate.

[0042] The gene editing strain of the target gene obtained in the photogenic bacillus is ΔphaC, and the only difference between the gene editing strain and the wild type photogenic bacillus is that the gene phaC is absent. PhaC is a gene encoding PHA synthase, and inactivation of the gene makes PHA synthesis blocked, thereby rapidly reducing PHA production.

[0043] The above-mentioned target gene can also be an unknown gene, or a gene with a theoretically known function.

[0044] The present application integrates two I-F type and I-E type CRISPR-Cas systems of Vibrio natriophilus and Vibrio photogenicus into the genomes of Vibrio natriophilus and Vibrio photogenicus, respectively, develops CRISPR / Cas systems in Vibrio natriophilus and Vibrio photogenicus, and edits the endogenous genes of Vibrio natriophilus and Vibrio photogenicus through the system to accurately delete single genes. BRIEF DESCRIPTION OF DRAWINGS

[0045] Figure 1 The I-F type CRISPR-Cas system plasmid map is verified in Vibrio natriophilus.

[0046] Figure 2 The I-E type CRISPR-Cas system plasmid map is verified in Vibrio natriophilus.

[0047] Figure 3 The I-F type CRISPR-Cas system plasmid map is verified in Vibrio photogenicus.

[0048] Figure 4 The I-E type CRISPR-Cas system plasmid map is verified in Vibrio photogenicus.

[0049] Figure 5 The I-F type CRISPR-Cas system is used to knock out the endogenous gene wbfF of Vibrio natriophilus, and the gel map is verified.

[0050] Figure 6 The I-F type CRISPR-Cas system is used to knock out the endogenous gene wbfF of Vibrio natriophilus, and the gel map is verified.

[0051] Figure 7 The I-E type CRISPR-Cas system is used to knock out the endogenous gene wbfF of Vibrio natriophilus, and the gel map is verified.

[0052] Figure 8 The I-F type CRISPR-Cas system is used to knock out the endogenous gene phaC of Vibrio photogenicus, and the gel map is verified.

[0053] Figure 9 The I-E type CRISPR-Cas system is used to knock out the endogenous gene phaC of Vibrio photogenicus, and the gel map is verified. DETAILED DESCRIPTION

[0054] The experimental methods used in the following examples are conventional methods, unless otherwise specified.

[0055] The materials, reagents, etc. used in the following examples can be obtained from commercial channels, unless otherwise specified.

[0056] Materials used in the following examples:

[0057] 1. Vibrio natriq ATCC04148: available from China General Microbiological Culture Collection Center (Beijing), with the number 1.8729.

[0058] 2. Vibrio damsela TGB10: available from China General Microbiological Culture Collection Center (Beijing), with the number CGMCC No.21104, which has been disclosed in CN113265357A.

[0059] 3. Photobacterium TLY01: available from China General Microbiological Culture Collection Center (Beijing), with the number CGMCC No.22976, which has been disclosed in CN113832070A.

[0060] 4. E. coli NEB 5-alpha: from NEB (New England Biolabs), with the number C2987I.

[0061] 5. E. coli S17-1 competent cells: from Biomed (Beijing), with the number BC129-01.

[0062] 6. pRE112: from Addgene, with the number 43828.

[0063] 7. pSEVA341-A4S3: synthesized by Biomed (Beijing).

[0064] 8. pSEVA341-ChIIArray: synthesized by Biomed (Beijing).

[0065] 9. Phanta Flash Master Mix (Dye Plus) DNA polymerase, Rapid Taq Master Mix DNA polymerase: purchased from Vazyme Biotech (Nanjing).

[0066] 10. DNA Marker, nucleic acid gel dye, etc.: purchased from Biomed (Beijing).

[0067] 11. Gel recovery kit, plasmid extraction kit: purchased from Biomed (Beijing).

[0068] 12. Seamless cloning kit: purchased from Shanghai Biyun Tian Biotechnology Co., Ltd.

[0069] 13. LB liquid medium: 10 g / L peptone, 10 g / L sodium chloride, 5 g / L yeast powder, and the balance is water.

[0070] 14. LB solid medium: 10 g / L peptone, 10 g / L sodium chloride, 5 g / L yeast powder, 18 g / L agar powder, and the balance is water.

[0071] 15. LB20 solid medium: 10 g / L peptone, 20 g / L sodium chloride, 5 g / L yeast powder, 18 g / L agar powder, and the balance is water.

[0072] 16. LB30 liquid medium: 10 g / L peptone, 30 g / L sodium chloride, 5 g / L yeast powder, and the balance is water.

[0073] 17. LB60 liquid medium: 10 g / L peptone, 60 g / L sodium chloride, 5 g / L yeast powder, and the balance is water.

[0074] 18. LB60 solid medium: 10 g / L peptone, 60 g / L sodium chloride, 5 g / L yeast powder, 18 g / L agar powder, and the balance is water.

[0075] 19. LB30 sucrose liquid medium: 10 g / L peptone, 30 g / L sodium chloride, 5 g / L yeast powder, 200 g / L sucrose, and the balance is water.

[0076] 20. LB30 sucrose solid medium: 10 g / L peptone, 30 g / L sodium chloride, 5 g / L yeast powder, 200 g / L sucrose, 18 g / L agar powder, and the balance is water.

[0077] 21. TYS40 liquid medium: 5 g / L peptone, 1 g / L yeast powder, 40 g / L sodium chloride, 0.7 g / L potassium chloride, 5.4 g / L magnesium chloride hexahydrate, 6.8 g / L magnesium sulfate heptahydrate, 1.4 g / L calcium chloride dihydrate, 0.2 g / L sodium bicarbonate, and the balance is water.

[0078] 22. Chemical transformation of Vibrio natriegens:

[0079] (1) E. coli S17-1 containing the plasmid of interest and Vibrio natriegens integrated with the CRISPR-Cas9 system were inoculated into LB and LB30 liquid medium containing antibiotics and incubated at 37°C overnight.

[0080] (2) The two bacterial solutions were separately inoculated and cultured to the logarithmic phase.

[0081] (3) Each part of E. coli S17-1 and Vibrio natriqum bacteria liquid was transferred to a sterile centrifuge tube, and the bacteria were collected after centrifugation at 5000 rpm, and then washed once with 1 mL of fresh LB medium.

[0082] (4) Each 500 μL of the washed bacteria liquid was centrifuged again, resuspended with 50 μL of fresh LB medium, and cultured overnight on LB20 solid plates.

[0083] (5) After 8-12 h of conjugation, part of the bacteria was picked from the plate, resuspended in LB30 medium, mixed, and then plated on LB60 solid plates containing antibiotics for culture.

[0084] 23. Chemical transformation of Photobacterium:

[0085] (1) E. coli S17-1 containing the plasmid of interest and Photobacterium requiring the integrated CRISPR-Cas9 system were inoculated into LB and TYS40 liquid medium containing antibiotics and cultured overnight at 37°C.

[0086] (2) The above two bacteria liquids were separately inoculated and cultured to the logarithmic phase.

[0087] (3) Each part of E. coli S17-1 and Photobacterium bacteria liquid was transferred to a sterile centrifuge tube, and the bacteria were collected after centrifugation at 5000 rpm, and then washed once with 1 mL of fresh LB medium.

[0088] (4) After centrifugation again, resuspend with 50 μL of fresh LB medium, and culture overnight on LB20 solid plates.

[0089] (5) After 7-10 h of conjugation, part of the bacteria was picked from the plate, resuspended in LB medium, mixed, and then plated on LB60 solid plates containing antibiotics for culture.

[0090] 24. Suicide plasmid-mediated gene integration

[0091] (1) Using the Cas gene cluster sequence of Vibrio natriqum as a template, the sequence fragment of 1000 bp upstream and downstream of the integration site was synthesized by the company, and the vector pRE112 was connected to complete the construction of the suicide plasmid.

[0092] (2) The above plasmid was transformed into Vibrio natriqum, and integrated into the specific position of the genome through the homologous arm, and plated on the plate containing the resistance for screening.

[0093] (3) The positive strain screened in the above step was inoculated into LB30 sucrose medium and cultured for 4-6 h, slightly turbid. The bacteria liquid was diluted and plated on sucrose plates.

[0094] (4) PCR verification of the monoclonal from (3). The correct monoclonal is verified as a suspected gene integrated bacteria, and the next step is verified by resistance. The gene integrated bacteria lose the resistance gene and have no chloramphenicol resistance. After resistance verification, sequencing verification is performed.

[0095] Table 1 is the primer sequence table used in the examples

[0096]

[0097]

[0098]

[0099] The I-F type CRISPR-Cas system of Vibrio natriophilus TGB10, the coding amino acid sequence and Cas gene cluster sequence of which are referred to GenBank accession number: CP114584.1 (update: 23-SEP-2022); the I-E type CRISPR-Cas system, the coding amino acid sequence and Cas gene cluster sequence of which are referred to GenBank accession number:

[0100] CP114585.1 (update: 23-SEP-2022).

[0101] Example 1, verification of I-F type CRISPR-Cas system in Vibrio natriophilus

[0102] 1, integration of I-F type CRISPR-Cas system on Vibrio natriophilus chromosome 1

[0103] (1) Using the Cas gene cluster sequence of Vibrio natriophilus chromosome 1 as a template, the sequence was synthesized by the company, and the 1000 bp sequence fragments on the integration site were amplified by PCR technology, and purified by agarose gel electrophoresis. The integration site is the replacement of Vibrio natriophilus PN96-14345 gene, the coding amino acid sequence and gene sequence of which are referred to GenBank accession number: CP009977.1 (update: 21-NOV-2014).

[0104] (2) Using Gibson technology to connect the homologous recombination template, Cas gene cluster sequence and vector pRE112, the construction of suicide plasmid is completed, and the plasmid is recorded as pRE112-CasF VN .

[0105] (3) The above plasmid is transformed into the recipient bacteria Vibrio natriophilus ATCC04148 by conjugation, and the Cas gene cluster sequence is integrated into Vibrio natriophilus at a specific position by suicide plasmid mediated gene integration, and Vibrio natriophilus with successfully integrated Cas is obtained, recorded as VN::CasF.

[0106] 2. Functional verification of type I-F CRISPR-Cas system in Vibrio natriq

[0107] (1) Using PCR technology, the wild type of Vibrio natriq was used as a template to clone the upstream and downstream 1500bp of the target gene (capsular polysaccharide gene wbfF) as a homologous recombination template, and the DNA fragments were purified by agarose gel electrophoresis.

[0108] (2) Gibson was used to link the DNA purified fragments with the vector pSEVA341-A4S3.

[0109] (3) According to the PAM (5'-CAT-3') sequence, a suitable spacer was selected

[0110] (caggcgaagccctccctcctccatacggcgct), which was cloned into the plasmid for homologous recombination template to complete the construction of the knockout plasmid, and the plasmid map is shown in Figure 1 , which is recorded as pSEVA341-A4S3-ΔwbfF.

[0111] (4) The pSEVA341-A4S3-ΔwbfF was transformed into VN::CasF by conjugation, and the Vibrio natriq with the plasmid was screened on the appropriate resistance plate and cultured at 37℃ overnight, which was recorded as VN::CasF (pSEVA341-A4S3-ΔwbfF).

[0112] (5) The method of colony PCR was used for preliminary verification, according to the PCR results, as shown in Figure 5 , compared with the wild type (WT) band, 1-10 lanes showed double bands, that is, the strain with type I-F CRISPR-Cas system verification plasmid (pSEVA341-A4S3-ΔwbfF) failed to knock out wbfF.

[0113] In order to knock out wbfF, one of the single clones was transferred once again, and the colony PCR method was used for verification. As shown in Figure 6 , the results showed that the band of 1-10 lanes was single, that is, the strain with type I-F CRISPR-Cas system verification plasmid (pSEVA341-A4S3-ΔwbfF) successfully knocked out wbfF.As shown, i.e. compared with the 1250bp band of the wild type (WT), the band amplified by the control strains in lanes 1, 2, 3, 5, 6, 7, 8 and 10 is a single band, and is smaller than the band amplified by the wild type (WT) by about 690bp, i.e. the strains are successfully knocked out; the band amplified by the control strains in lanes 4 and 9 is a double band, i.e. the strains with the verification plasmid (pSEVA341-A4S3-ΔwbfF) of the I-F type CRISPR-Cas system fail to knock out wbfF, and the editing efficiency of the system reaches 80% by statistics of the above PCR results.

[0114] Example 2 Verification of the I-E type CRISPR-Cas system in Vibrio natriophilus

[0115] 1. Integration of the I-E type CRISPR-Cas system on chromosome 2 of Vibrio natriophilus

[0116] (1) Using the Cas gene cluster sequence of Vibrio natriophilus chromosome 2 as a template, the sequence of the 1000bp upstream and downstream of the integration site was amplified by PCR technology, and purified by agarose gel electrophoresis. The integration site is to replace the D-lactate dehydrogenase dld gene of Vibrio natriophilus, and the amino acid sequence and gene sequence are shown in GenBank accession number: CP009978.1 (update: 21-NOV-2014).

[0117] (2) The homologous recombination template, Cas gene cluster sequence and vector pRE112 were connected by Gibson technology to complete the construction of the suicide plasmid, which is denoted as pRE112-CasE VN .

[0118] (3) The above plasmid was transformed into the recipient bacteria Vibrio natriophilus ATCC04148 by conjugation, and the Cas gene cluster sequence was integrated into Vibrio natriophilus at a specific position by using the suicide plasmid-mediated gene integration, and the Vibrio natriophilus successfully integrated with Cas was obtained, denoted as VN::CasE.

[0119] 2. Function verification of the I-E type CRISPR-Cas system of Vibrio natriophilus

[0120] (1) The 1500bp upstream and downstream of the target gene (capsular polysaccharide gene wbfF) were cloned as a homologous recombination template by PCR technology using Vibrio natriophilus wild type as a template, and the DNA fragments were purified by agarose gel electrophoresis.

[0121] (2) The DNA purified fragments were connected with the vector pSEVA341-ChIIArray by Gibson.

[0122] (3) According to the PAM (5'-CGC-3') sequence, select a suitable spacer

[0123] (agctctagcgggaacgaatgtaattccagcaa), which is cloned into a plasmid for integrating homologous recombination template to complete the knockout plasmid construction, the plasmid map is shown as Figure 2 , recorded as pSEVA341-ChIIArray-ΔwbfF.

[0124] (4) Transform pSEVA341-ChIIArray-ΔwbfF into VN::casE by conjugation, and screen for sodium-dependent Vibrio with the plasmid on a suitable resistant plate, and incubate at 37°C overnight, recorded as VN::casE(pSEVA341-ChIIArray-ΔwbfF).

[0125] (5) Use colony PCR method for preliminary verification, according to the PCR result, as shown in Figure 7 , compared with the 1250bp band of the wild type (WT), the bands amplified by the control strains in lanes 1, 3, 4, 5, 7, and 10 are single bands, and are smaller than the band amplified by the wild type (WT) by about 700bp, which are the successfully knocked out strains, and the bands amplified by the control strains in lanes 2, 6, 8, and 9 are double bands, which are the strains that failed to knock out wbfF with the verification plasmid (pSEVA341-ChIIArray-ΔwbfF) of type I-E CRISPR-Cas system, and the editing efficiency of the system reaches 60% through the above PCR results.

[0126] Example 3 Verification of type I-F CRISPR-Cas system in Vibrio harveyi

[0127] 1. Integrating type I-F CRISPR-Cas system on Vibrio harveyi chromosome 1

[0128] (1) Using the Cas gene cluster sequence of Vibrio natriophilus chromosome 1 as a template, the sequence was synthesized by the company, and the 1000bp sequence fragments of the upstream and downstream integration sites were amplified by PCR technology, and purified by agarose gel electrophoresis. The integration site is downstream of the lactate dehydrogenase gene ldhA1 of Vibrio harveyi, and the genomic gene sequence of the integration site is shown in GenBank accession number: CP090364.1 (update: 20-DEC-2021).

[0129] (2) Use Gibson technology to link the homologous recombination template, Cas gene cluster sequence and vector pRE112 to complete the construction of the suicide plasmid, and the plasmid is recorded as pRE112-CasF TLY01 .

[0130] (3) Use the conjugation method to transform the above-mentioned plasmid into the recipient bacterium Vibrio TLY01, use the suicide plasmid-mediated gene integration to integrate the Cas gene cluster sequence into a specific position in Vibrio, and obtain Vibrio with successfully integrated Cas, denoted as TLY01::CasF.

[0131] 2. Function verification of the Type I-F CRISPR-Cas system of Vibrio

[0132] (1) Using PCR technology, the 1500bp upstream and downstream of the target gene (PHA synthase gene phaC) are cloned as a homologous recombination template using Vibrio wild type as a template, and the DNA fragments are purified by agarose gel electrophoresis.

[0133] (2) Use Gibson to link the DNA purified fragments with the vector pSEVA341-A4S3.

[0134] (3) According to the PAM (5'-CAT-3') sequence, select a suitable spacer (cctgactatcacccgtcagagtgacgttctgc), and clone it into the plasmid integrated with the homologous recombination template to complete the construction of the knockout plasmid, and the plasmid map is shown in Figure 3 , denoted as pSEVA341-A4S3-ΔphaC.

[0135] (4) Use the conjugation method to transform pSEVA341-A4S3-ΔphaC into TLY01::CasF, and incubate at 37°C overnight on a suitable resistant plate to screen for Vibrio with plasmid, denoted as TLY01::CasF (pSEVA341-A4S3-ΔphaC).

[0136] (5) Use colony PCR method for preliminary verification, according to the PCR result, as shown in Figure 8 , compared with the 1300bp band of the wild type (WT), the bands amplified by the control strains in lanes 2, 3, 4, 6, 7, 8, 9 and 10 are single bands, and are smaller than the band amplified by the wild type (WT) by about 800bp, which are successful knockout strains, while the bands amplified by the control strains in lanes 2 and 5 are double bands, which are strains with unsuccessful knockout of phaC with the Type I-F CRISPR-Cas system verification plasmid (pSEVA341-A4S3-ΔphaC), and the editing efficiency of the system reaches 80% through the above-mentioned PCR results.

[0137] Example 4: Verification of Type I-E CRISPR-Cas system in Vibrio

[0138] 1. Integration of Type I-E CRISPR-Cas system on Vibrio qinghaiensis sp. Q67 chromosome 2

[0139] (1) Using the Cas gene cluster sequence of Vibrio qinghaiensis sp. Q67 chromosome 2 as a template, the sequence was synthesized by a company, and the 1000 bp sequence fragments upstream and downstream of the integration site were amplified by PCR technology, and purified by agarose gel electrophoresis. The integration site is downstream of the Vibrio qinghaiensis sp. Q67 lactate dehydrogenase gene ldhA2. The genomic gene sequence of the integration site is shown in GenBank Accession No. CP090365.1 (update: 20-DEC-2021).

[0140] (2) The homologous recombination template, Cas gene cluster sequence and vector pRE112 were connected by Gibson technology to complete the construction of the suicide plasmid, which is denoted as pRE112-CasE TLY01 .

[0141] (3) The above plasmid was transformed into the recipient bacteria Vibrio qinghaiensis sp. Q67 TLY01 by conjugation transformation, and the Cas gene cluster sequence was integrated into the specific position in Vibrio qinghaiensis sp. Q67 mediated by the suicide plasmid, and the Vibrio qinghaiensis sp. Q67 successfully integrated Cas was obtained, denoted as TLY01::CasE.

[0142] 2. Function verification of Type I-E CRISPR-Cas system of Vibrio qinghaiensis sp. Q67

[0143] (1) Using PCR technology, the wild type of Vibrio qinghaiensis sp. Q67 was used as a template to clone 1500 bp upstream and downstream of the target gene (PHA synthase gene phaC) as a homologous recombination template, and the DNA fragment was purified by agarose gel electrophoresis.

[0144] (2) The DNA purified fragment was connected with the vector pSEVA341-ChIIArray by Gibson.

[0145] (3) According to the PAM (5'-CGC-3') sequence, a suitable spacer (gctgccttgccggaatcaaactccttccacca) was selected and cloned into the plasmid integrated with the homologous recombination template to complete the construction of the knockout plasmid, and the plasmid map is shown in Figure 4 , denoted as pSEVA341-ChIIArray-ΔphaC.

[0146] (4) The pSEVA341-ChIIArray-ΔphaC was transformed into TLY01::CasE by conjugation, and the luminescent bacteria with plasmid were screened on the appropriate resistance plate and cultured overnight at 37°C, and were recorded as TLY01::CasE(pSEVA341-ChIIArray-ΔphaC).

[0147] (5) The preliminary verification was performed by colony PCR, and according to the PCR results, as shown in FIG. 6, compared with the 1300bp band of the wild type (WT), the bands amplified by the control strains in lanes 1, 3, 4 and 8 were single bands, and were smaller than the band amplified by the wild type (WT) by about 720bp, that is, the strains were successfully knocked out, while the bands amplified by the control strains in lanes 2, 5, 6, 7, 9 and 10 were double bands, that is, the strains with the verification plasmid (pSEVA341-ChIIArray-ΔphaC) of the I-E type CRISPR-Cas system were not successfully knocked out phaC, and the editing efficiency of the system reached 40% by counting the above PCR results. Figure 9 strains with the verification plasmid (pSEVA341-ChIIArray-ΔphaC) of the I-E type CRISPR-Cas system were not successfully knocked out phaC, and the editing efficiency of the system reached 40% by counting the above PCR results.

Claims

1. Application of the I-F or I-E CRISPR-Cas system of Salinivibrio in gene editing of Vibrionatriegens or Photobacterium.

2. The application according to claim 1, wherein the Cas gene cluster of the type I-F or type I-E CRISPR-Cas system is integrated into the chromosome of the sodium-dependent Vibrio or the luminescent bacillus, preferably, wherein: A recombinant strain was obtained by integrating the nucleic acid sequence of the Cas gene cluster from the I-F type CRISPR-Cas system in Vibrio salinae onto chromosome 1 of the sodium-dependent Vibrio. A recombinant strain was obtained by integrating the nucleic acid sequence of the Cas gene cluster from the type I-E CRISPR-Cas system in Vibrio salinae onto chromosome 2 of the sodium-dependent Vibrio salivarius. A recombinant strain was obtained by integrating a nucleic acid sequence from the Cas gene cluster of the type I-F CRISPR-Cas system in Vibrio salinae onto chromosome 1 of the luminescent bacillus; or The nucleic acid sequence of the Cas gene cluster from the type I-E CRISPR-Cas system in Vibrio salina was integrated into chromosome 2 of the luminescent bacillus to obtain a recombinant strain.

3. The application according to claim 1 or 2, wherein the type I-F CRISPR-Cas system comprises 5 Cas protein-coding genes, preferably the GenBank accession number of the Cas gene cluster sequence is CP114584.1; and / or the type I-E CRISPR-Cas system comprises 8 Cas protein-coding genes, preferably the GenBank accession number of the Cas gene cluster sequence is CP114585.

1.

4. The application according to claim 1 or 2, wherein the CRISPR-Cas system further comprises a plasmid expressing crRNA and a homologous repair template, the plasmid being introduced into the sodium-dependent Vibrio or the luminescent bacillus.

5. The application according to claim 4, wherein the crRNA comprises one or more spacer sequences and repeat sequences targeting the target gene, preferably the spacer sequence targeting the target gene comprises a fragment 30 to 40 bp downstream of the PAM sequence in the target gene, and / or preferably the repeat sequence is SEQ ID No. 3 or SEQ ID No.

4.

6. The application according to claim 4, wherein the homology repair template comprises an upstream fragment and a downstream fragment of the target gene to be edited, preferably the upstream fragment and / or the downstream fragment having a length of 1000 to 1500 bp.

7. The application according to claim 5, wherein the PAM sequence of the type I-F CRISPR-Cas system is 5'-CAT-3', and / or the PAM sequence of the type I-E CRISPR-Cas system is 5'-CGC-3'.

8. The application according to claim 4, wherein the plasmid is a plasmid obtained by cloning the crRNA and the homologous repair template into an expression vector, preferably the expression vector is pSEVA341-A4S3 (SEQ ID No. 1) or pSEVA341-ChIIArray (SEQ ID No. 2).

9. The application according to claim 5, wherein the target gene is the capsular polysaccharide gene wbfF of Vibrio natans or the PHA synthase gene phaC of Bacillus luminifera.

10. The application according to claim 1 or 2, wherein the saline Vibrio is saline Vibrio TGB10; the sodium-dependent Vibrio is sodium-dependent Vibrio ATCC04148; and / or the luminescent bacillus is luminescent bacillus TLY01.

Images