Gene editing method for regulating and controlling growth of vibrio natrioryzae and synthesis of metabolite

Abstract

The invention relates to the technical field of gene engineering, in particular to a gene editing method for regulating and controlling vibrio natriticus growth-metabolite synthesis. The invention provides a temperature-sensitive growth-expression regulation plasmid system and a protein expression method. OriC replication is dynamically controlled through temperature, growth is accurately regulated and controlled, operation is easy and convenient, pollution is avoided, the method is suitable for rapid growth of strains, and the effect of improving products with central carbon metabolism intermediates as precursors is remarkable. In addition, cell division is regulated and controlled to lengthen cells, accumulation of intracellular storage substances is facilitated, and the yield and the separation efficiency are improved. Experiments show that the system can delay early-stage growth and improve the production capacity of the vibrio sodium-requiring vibrio, for example, the yields of lactic acid and PHB are respectively improved by 44% and 49%.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to a gene editing method for regulating the growth and metabolite synthesis of sodium-dependent Vibrio. Background Technology

[0002] Compared to traditional chemical synthesis methods, biosynthesis using microorganisms as cell factories offers advantages such as milder conditions, lower costs, and environmental friendliness. Metabolic engineering can promote biological metabolic processes and increase the yield of target products by modifying or genetically engineering microbial metabolic pathways. However, since both bacterial growth and the synthesis of metabolites require energy, excessively rapid cell growth often leads to insufficient energy for the synthesis of target products. To alleviate competition for metabolic resources, a feasible strategy is to regulate the allocation of carbon flux during cell growth and metabolism. For example, cell growth can be inhibited by introducing inducible promoters and adding growth inhibitors (such as isopropyl-β-D-thiogalactoside) at specific growth stages to downregulate downstream gene expression. However, this method is not only costly but also introduces impurities. In recent years, researchers have proposed a self-regulating strategy that utilizes the quorum sensing effect of microorganisms to construct a dynamic regulatory switch, enabling microbial biomass to automatically switch from growth mode to production mode after reaching a certain population density. However, this method cannot be applied to scenarios where low-density cultivation is necessary, such as the low-nutrient environment of waste resource recycling production.

[0003] Sodium-dependent Vibrio is a highly promising biosynthetic chassis microorganism with significant advantages such as strong environmental adaptability and a broad substrate range. However, it is also one of the fastest-growing bacteria, making dynamic regulation of its growth and metabolism crucial for enhancing its biosynthetic energy. However, methods for dynamically regulating the growth and metabolism of this type of bacterium are still lacking. Previously reported regulatory methods applied to other bioengineered bacteria often fail to achieve good results when directly applied to sodium-dependent Vibrio. This is mainly due to the unique physiological and metabolic characteristics of sodium-dependent Vibrio, such as its sodium dependence and specialized gene regulatory network, making it difficult for traditional methods to effectively adapt to its complex intracellular environment. Furthermore, the response mechanism of sodium-dependent Vibrio to external inducers may differ significantly from other common engineered bacteria, leading to decreased regulatory precision and efficiency. Therefore, developing customized regulatory strategies to meet the specific needs of sodium-dependent Vibrio is particularly important. Summary of the Invention

[0004] In view of this, the technical problem to be solved by the present invention is to provide a gene editing method for regulating the growth and metabolite synthesis of sodium-dependent Vibrio.

[0005] This invention provides a plasmid system, including a temperature-sensitive plasmid and a recombinant editing plasmid;

[0006] The temperature-sensitive plasmid includes: nucleic acid encoding a temperature-sensitive repressor protein, a target promoter of the temperature-sensitive repressor protein, and nucleic acid encoding an integrase, wherein the integrase is at least one of PhiC31 integrase, PhiBT1 integrase, and TG1 integrase.

[0007] The recombinant editing plasmid comprises, in sequence, an upstream homologous arm, an integrase recognition cleavage site 1, an oriC-reverse fragment, an integrase recognition cleavage site 2, and a downstream homologous arm.

[0008] The origin of replication (oriC) is a specific DNA sequence segment on a chromosome. Replication is initiated by the recognition and binding of the DnaA protein to this sequence. If oriC is cleaved, cell division can be prevented, thereby inhibiting bacterial growth. The plasmid system provided by this invention includes two plasmids, one of which is a temperature-sensitive plasmid carrying an integrase whose expression is controlled by a temperature-sensitive repressor protein, the activity of which is temperature-regulated. The recombinant editing plasmid replaces the original oriC region of the host chromosomal DNA with an oriC-reverse, introducing specific recognition sites upstream and downstream. When the temperature rises to 37 °C, the temperature-sensitive repressor protein is inactivated, inducing transposase expression to specifically cleave the oriC-reverse, thereby effectively controlling bacterial replication and growth, and indirectly promoting the synthesis of the target product. After the two plasmids work together to edit the host cell, they can precisely control the frequency of DNA replication initiation and inhibit cell growth and reproduction, directing more metabolic energy to biosynthetic pathways when needed, thus promoting the synthesis of the target product.

[0009] In the temperature-sensitive plasmid described in this invention:

[0010] The temperature-sensitive repressor protein is cI857(ts), a temperature-sensitive mutant of the λ phage transcriptional repressor protein cI. This protein functions by binding to the operator gene of phage DNA, repressing the expression of lysis-related genes, and maintaining the phage lysogenic state. Its activity is temperature-regulated: high temperatures inactivate the cI protein, releasing the repression. Its target promoter is the λ phage PL promoter. Because its transcription is negatively regulated by cI857, downstream genes are subject to temperature-sensitive regulation. Its sequence characteristics are: -35 region sequence: TTGACA, -10 region sequence: GATACT. In specific embodiments, the nucleic acid encoding the λ phage transcriptional repressor protein has the nucleic acid sequence shown in SEQ ID NO:1, or has more than 80% identity with the nucleic acid sequence shown in SEQ ID NO:1 and encodes the λ phage transcriptional repressor protein.

[0011] Integrases can recognize specific sites, thereby enabling efficient recombination between those sites. In this invention, the integrase is at least one of PhiC31 integrase, PhiBT1 integrase, and TG1 integrase; preferably, the integrase is PhiC31 integrase, whose recognition sites are attB and attP. In specific embodiments, the nucleic acid encoding the PhiC31 integrase has the nucleic acid sequence shown in SEQ ID NO:2, or has more than 80% identity with the nucleic acid sequence shown in SEQ ID NO:2, and encodes the PhiC31 integrase.

[0012] In some embodiments, the backbone vector of the temperature-sensitive plasmid further includes a selection marker, which includes an antibiotic resistance selection marker. As a feasible example, the antibiotic resistance selection marker includes, but is not limited to, the ampicillin resistance gene (amp). r ), kanamycin resistance gene (kan) r ), chloramphenicol resistance gene (cat), tetracycline resistance gene (tet) r ), spectinomycin resistance gene (spec) r Neomycin resistance gene (neo) r Hygromycin B resistance gene (hyg r ) and / or puromycin resistance gene (puro r ).

[0013] In some specific embodiments, the backbone vector of the temperature-sensitive plasmid described in this invention is pUC57, and the spectrum of the temperature-sensitive plasmid described in this invention is as follows: Figure 4 As shown.

[0014] In the recombinant editing plasmid described in this invention, the upstream and downstream homologous arms are homologous arms upstream and downstream of the oriC region of *Vibrio natriureticis*. These arms are used to precisely target the origin of replication region on the *Vibrio natriureticis* chromosome, replacing oriC with oriC-reverse (the reverse sequence of oriC) through homologous recombination. This invention explored different lengths of the upstream and downstream homologous arms, but found low recombination efficiency with other lengths (e.g., 300bp, 400bp, 500bp, etc.). However, good homologous recombination results were obtained after using homologous recombination with 1000bp homologous arms. In a specific embodiment, the upstream homologous arm has the nucleic acid sequence shown in SEQ ID NO:3; the downstream homologous arm has the nucleic acid sequence shown in SEQ ID NO:5.

[0015] In a specific embodiment, the integrase recognition cleavage site 1 is attP or attB, and the integrase recognition cleavage site 2 is attP or attB; and the integrase recognition cleavage site 1 and the integrase recognition cleavage site 2 are different.

[0016] The oriC-reverse fragment is the reverse fragment of oriC, and its function is to replace the original oriC fragment in the genome. In a specific embodiment, the oriC-reverse fragment has the nucleic acid sequence shown in SEQ ID NO:4.

[0017] The recombinant editing plasmid of this invention also includes SacB, I-SceI, and a marker gene. SacB expression converts sucrose into lethal fructan for negative screening on sucrose plates to eliminate suicide plasmids and further improve screening efficiency. I-SceI improves recombination and screening efficiency by linearizing the vector through enzyme digestion. The backbone of the recombinant editing plasmid of this invention is R6k γ ori. R6k γ ori is a replication origin on plasmid R6K, and its core characteristic is that replication is strictly dependent on the π protein (encoded by the pir gene) expressed by the host bacterium. It can only replicate autonomously in strains carrying the pir gene (such as DH5α λpir, S17-1 λpir, etc.). Therefore, this invention constructs the recombinant editing plasmid in Escherichia coli Wm3064 containing the γ factor, utilizing its characteristic that copying must be initiated by the γ factor to improve the screening efficiency of plasmid-free sodium-dependent Vibrio bacteria (without the γ factor).

[0018] The recombinant editing plasmid of this invention comprises, in sequence, R6k γ ori, an upstream homologous arm, an integrase recognition cleavage site 1, an oriC-reverse fragment, an integrase recognition cleavage site 2, a downstream homologous arm, I-SceI, SacB, and CmR. The map of the temperature-sensitive plasmid of this invention is shown below. Figure 3 As shown.

[0019] The present invention also provides the application of the plasmid system described above in the construction of sodium-dependent Vibrio bacteria with regulated growth-metabolite synthesis.

[0020] In this embodiment of the invention, some nucleic acids in the plasmid system are codon-optimized to enable them to work better in sodium-dependent Vibrio, thereby achieving a good modification of sodium-dependent Vibrio.

[0021] Furthermore, the present invention also provides a sodium-dependent Vibrio species capable of regulating the synthesis of growth-metabolites, which is obtained by editing sodium-dependent Vibrio species using the plasmid system described above.

[0022] Furthermore, the present invention also provides a method for constructing a sodium-dependent Vibrio with regulated growth-metabolite synthesis, comprising: introducing wild-type sodium-dependent Vibrio into a recombinant edited plasmid in the plasmid system as described above, and then transferring it into a temperature-sensitive plasmid to obtain a sodium-dependent Vibrio with regulated growth-metabolite synthesis.

[0023] In the construction method of this invention, the genomic DNA needs to be edited by first introducing a recombinant editing plasmid, then the plasmid is eliminated, and finally, a temperature-sensitive plasmid is introduced. This invention does not limit the transformation method; for example, it can be chemical transformation, electrotransformation, conjugation transfer, etc.

[0024] In the construction method described in this invention, the wild-type sodium-dependent Vibrio is Vibrio natriegens ATCC14048.

[0025] Furthermore, the present invention also provides a protein expression method, which includes constructing the target gene into the sodium-dependent Vibrio as described above or the sodium-dependent Vibrio constructed by the construction method described above, first culturing at 30±0.5 ℃ to obtain a seed culture, and after transfer, expressing the integrase at 37±0.5 ℃ for a period of time, and then switching back to 30±0.5 ℃ for synthase expression.

[0026] In this invention, the target gene can be constructed into *Vibrio natriureticis* using any method well known in the art. In a specific embodiment, the constructed plasmid includes p15A ori and the marker gene CmR, wherein the promoter of the target gene is P. J23119 or P ara .

[0027] This invention provides a temperature-sensitive growth-expression regulated plasmid system and a protein expression method. Experimental verification shows that the plasmid system and method provided by this invention have at least one of the following advantages:

[0028] (1) Taking the biosynthesis of lactic acid (metabolite) and polyhydroxybutyrate (PHB, an intracellular storage product) as examples, the introduction of the above-mentioned regulatory system can significantly improve the biosynthetic capacity of sodium-dependent Vibrio during the production period under the condition of delaying growth in the early stage. The yields of lactic acid and PHB increased by about 44% and 49%, respectively.

[0029] (2) Traditional metabolic engineering typically improves product synthesis efficiency by regulating the expression of key enzymes. This method, by dynamically controlling the oriC-mediated DNA replication system through temperature changes, enables more precise regulation of the cell growth process. Moreover, compared to methods that inhibit cell growth, such as adding growth inhibitors, this method is simple to operate and produces no secondary pollution. Furthermore, this system is particularly suitable for rapidly growing strains such as Natriuretic Vibrio, and exhibits a more significant gain effect on products for which the central carbon metabolism intermediate is a precursor.

[0030] (3) The regulation of cell division by this method will indirectly affect cell morphology, resulting in longer cells after the removal of oriC, which is conducive to the accumulation of intracellular storage substances, thereby increasing the yield and the efficiency of subsequent product extraction and separation. Attached Figure Description

[0031] Figure 1A schematic diagram of the replication control system of *Vibrio natriureticis*.

[0032] Figure 2 Schematic diagram of oriC excision and electrophoresis gel images of PCR amplification products before and after excision;

[0033] Figure 3 A schematic diagram of plasmids used for homologous recombination;

[0034] Figure 4 A schematic diagram of a plasmid used for temperature-sensitive control of integrase expression;

[0035] Figure 5 A schematic diagram of the plasmid used to express red fluorescent protein;

[0036] Figure 6 A schematic diagram of the plasmid used to express lactate dehydrogenase;

[0037] Figure 7 A schematic diagram of the plasmid used to express polyhydroxyalkanoate synthase;

[0038] Figure 8 The replication control system enhances protein expression levels;

[0039] Figure 9 The replication control system increases the production of lactic acid synthesized by cells;

[0040] Figure 10 The replication control system increases the mRNA expression level of lactate dehydrogenase;

[0041] Figure 11 The replication control system increases the production of PHB synthesized by cells;

[0042] Figure 12 TEM image of a cell section from which PHB was synthesized. Detailed Implementation

[0043] This invention provides a gene editing method for regulating the growth and metabolite synthesis of sodium-dependent Vibrio. Those skilled in the art can refer to this document and appropriately modify the process parameters to achieve the desired result. It is particularly important to note that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to implement and apply the technology of this invention.

[0044] Unless otherwise defined in this invention, the scientific and technical terms associated with this invention shall have the meanings understood by one of ordinary skill in the art.

[0045] The terms “comprising,” “including,” and “having” are used interchangeably to indicate the inclusiveness of a scheme, meaning that the scheme may contain elements other than those listed. It should also be understood that the use of “comprising,” “including,” and “having” herein also provides for schemes “consisting of…”.

[0046] The term "and / or" describes the relationship between related objects, indicating that three relationships can exist. For example, A and / or B can mean: A exists alone, A and B exist simultaneously, or B exists alone. A and B can be singular or plural.

[0047] In this application, "at least one" means one or more, and "more than one" means two or more. "At least one of the following" or similar expressions refer to any combination of these items, including any combination of single or multiple items.

[0048] The numerical ranges and parameters involved in this invention have been presented as precisely as possible in the specific embodiments. However, any numerical value inevitably contains standard deviations due to individual test methods. Therefore, unless otherwise expressly stated, it should be understood that all numerical ranges or specific data used in this disclosure may have a reasonable deviation within a certain range, such as ±10%, ±5%, ±1%, or ±0.5%.

[0049] The test materials used in this invention are all commercially available products. It should be understood that in the various embodiments of this application, the sequence numbers of the above processes do not imply a specific order of execution. Some or all steps can be executed in parallel or sequentially. The execution order of each process should be determined by its function and internal logic, and should not constitute any limitation on the implementation process of the embodiments of this application. The invention is further illustrated below with reference to embodiments:

[0050] Example 1

[0051] Components of culture medium for sodium-dependent Vibrio:

[0052] The strain used in this embodiment is Vibrio natriegens ATCC 14048, and the basic culture medium used for its cultivation is LBv2 medium, which is based on LB (Luria-Bertani) broth medium (formulation of 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride) with the addition of v2 salt (204 mM NaCl, 23.14 mM MgCl2 and 4.2 mM KCl).

[0053] The modified MR medium for lactic acid production is formulated as follows: 21.92 g / L NaCl, 6.67 g / L KH2PO4, 4 g / L (NH4)2HPO4, 0.8 g / L MgSO4·7H2O, 0.8 g / L citric acid, 2.5 g / L yeast extract. After adjusting the pH to approximately 7.0, the medium is sterilized. Following sterilization, a filtered and sterilized trace metal stock solution (10 g / L FeSO4·7H2O, 2.2 g / L ZnSO4·7H2O, 2 g / L CaCl2, 1 g / L CuSO4·5H2O, 0.5 g / L MnSO4·4H2O, 0.1 g / L (NH4)6Mo7O) is added at a ratio of 0.5% (v / v). 24 ·4H2O, 0.02 g / L Na2B4O7·10H2O).

[0054] The culture medium formula used to produce PHB is: natural seawater that has undergone sedimentation and filtration treatment and 25 g / L molasses.

[0055] Example 2

[0056] Methods for constructing a sodium-dependent Vibrio replication control system:

[0057] (1) Construction of EX strain: The EX strain was constructed by amplifying the fragment and ligating it into the Wm3064 strain, which contains the γ factor and can copy the R6k γ plasmid. Figure 3 The plasmids shown are used for homologous recombination and specifically include:

[0058] ① Constructing plasmids for recombination editing. First, specific sequences are synthesized: this includes reversing the oriC sequence from the *Vibrio natans* genome to create an oriC-reverse fragment, inserting cleavage sites attP and attB, which can be recognized by the PhiC31 site-specific integrase, upstream and downstream of this fragment, and inserting a kanamycin resistance gene downstream of the synthesized sequence.

[0059] First, we tried using the lambda Red recombination system for editing (using p15a as the plasmid backbone and 400 bp homologous arms). However, since we could not screen for strains that had undergone double crossover without plasmids, we switched to homologous recombination: inserting a longer 1000 bp homologous arm from the upstream and downstream of the oriC genome upstream and downstream of the fragment to be replaced, respectively, to improve the efficiency of homologous recombination.

[0060] Using R6kγori as the backbone, plasmids were constructed in Escherichia coli Wm3064 containing the γ factor. Leveraging the characteristic that copying must be initiated by the γ factor, the efficiency of screening for plasmid-free sodium-dependent Vibrio (without the γ factor) was improved. SacB and I-SceI were inserted into the backbone. The former's expression product converts sucrose into lethal fructan, which is used for negative screening on sucrose plates to eliminate suicide plasmids, further improving screening efficiency. The latter improves recombination and screening efficiency by linearizing the vector through enzyme digestion. Chloramphenicol resistance genes were used as marker genes.

[0061] ② Homologous recombination was achieved by introducing the plasmid from ① and selecting for resistance: After introducing the plasmid into the wild type via electroporation, positive clones that could grow were screened on kanamycin and chloramphenicol-resistant plates. The fragments were amplified by PCR and sequenced to verify whether homologous recombination was complete. The selected bacteria were then cultured under kanamycin monoclonal antibody conditions, and positive clones were spotted onto kanamycin and chloramphenicol monoclonal antibody plates, respectively, to screen for bacteria that could only grow on kanamycin-resistant plates. The recombinant strain was labeled EX. Because the oriC on the chromosome of this bacterium was replaced with the reverse sequence oriC-reverse, and cleavage sites attP and attB, which can be recognized by integrase, were introduced upstream and downstream, respectively, these sites could cleave at the two sites after integrase activation to form the attR fragment, which does not contain the intermediate oriC-reverse fragment.

[0062] (3) Construct a temperature-sensitive plasmid and introduce it into the EX strain. Amplify the gene encoding the λ phage transcriptional repressor protein, its target promoter, and the integrase fragment regulated by it, and link them to the pUC57 plasmid backbone containing the ampicillin resistance gene to obtain a plasmid that can initiate transposase expression by changing the temperature.

[0063] After co-culturing with wild-type *Vibrio natriureticis* for 1 day, positive clones were screened on DAP-free resistant plates, indicating successfully conjugated *Vibrio natriureticis*. Further colony PCR was used to verify fragment insertion. Single clones meeting the requirements were re-inoculated in kanamycin-only medium and cultured to plateau. Afterward, they were diluted and plated on kanamycin-resistant plates containing 10% (w / v) sucrose. The resulting positive clones were spotted onto kanamycin- and chloramphenicol-resistant monoclonal antibody plates, respectively. Bacteria that could only grow on kanamycin-resistant plates and not on chloramphenicol-resistant plates were identified as successfully edited strains (i.e., EX).

[0064] (2) Construction of EXP strains: EXP strains were constructed by amplifying fragments and ligating them. Figure 4The plasmid shown is used to express the integrase. The λ phage transcriptional repressor protein is a temperature-sensitive mutant that inhibits the expression of its target promoter at 30 °C, while the inhibitory effect is significantly weakened at 37 °C. This means that integrase expression is impossible at 30 °C but initiated at 37 °C. This plasmid was introduced into strain EX by electroporation at 2.5 kV. Similarly, positive single clones obtained from screening with ampicillin-containing resistant plates were validated, and this strain was labeled EXP.

[0065] The removal of oriC from the constructed replication control system was verified. Figure 2 ):

[0066] To verify the proper functioning of the replication control system in the constructed EXP strain, the EX strain was used as a control. Both EXP and the control group were cultured to the plateau phase as seed culture. After 1% inoculation, both were incubated at 37 °C, and samples were taken at 0, 0.5, 1, 2, and 5 h. Colony PCR was performed using 2× Rapid Taq Master Mix (Vazyme, Nanjing, China) to amplify the upstream and downstream fragments of the integrase activation site. The PCR reaction products were then subjected to 1% agarose gel electrophoresis, and the bands and their sizes were observed. It was observed that the fragment length at time 0 in the EXP group was the same as that of the control group at all time points, while the bands were shorter after incubation at 37 °C, demonstrating that the oriC-reverse fragment was excised after a period of incubation at 37 °C in the EXP group.

[0067] Example 3

[0068] The effect of the replication control system on the expression of the target protein.

[0069] Construct an expression plasmid containing the red fluorescent protein mCherry regulated by the constitutive promoter J23119. Figure 5 The EX and EXP strains constructed in Example 2 were introduced into the culture medium, with the former serving as the control group. One day prior to incubation, both strains were transferred to LBv2 medium and cultured at 30 °C until the plateau phase to serve as seed culture. Using 96-well microplates, 200 μL of the medium was inoculated into each well at a 1% inoculum size in LBv2 medium. After culturing at 37 °C for 3 hours, the culture was switched to 30 °C for a total inoculum of approximately 45 hours. Microplate readers were used for detection: absorbance at 600 nm was used to characterize changes in bacterial population density; an excitation wavelength of 587 nm and an emission wavelength of 610 nm were set to detect the fluorescence value of the red fluorescent protein. The OD values ​​of the experimental and control groups were found to be... 600 The differences were not significant, but the fluorescence values ​​at the plateau phase were higher in the experimental group than in the control group. Figure 8This indicates that such a switching mode can, to some extent, control the bacterial population density and improve the expression of individual bacterial proteins.

[0070] Example 4

[0071] The impact of replication control systems on lactic acid synthesis.

[0072] Construct an expression plasmid containing the lactate dehydrogenase lacLDH from Lactococcus cremoris regulated by the constitutive promoter J23119. Figure 6 The EX and EXP strains constructed in Example 2 were introduced into the culture medium, with the former serving as the control group. One day prior to inoculation, both strains were transferred to LBv2 medium and cultured at 30 °C until the plateau phase to serve as seed culture. In MR modified medium, the inoculum was 1% and cultured at 37 °C for 4 or 8 hours, followed by 2 days of culture at 30 °C. Lactic acid production was measured using the Elabscience® L-lactic acid colorimetric assay kit, following the instructions. Standard concentrations of 0, 1, 2, 3, 4, 5, 6, and 7 mmol / L of L-lactic acid were measured, and absorbance at 530 nm was used to plot a concentration standard curve. After centrifugation at 8000 g for 5 min, the supernatant was used to determine the OD value. 530 Lactic acid production was calculated based on the standard curve. The experimental group's lactic acid production was found to be 2.4 g / L, significantly higher than the control group's 1.7 g / L. Figure 9 ).

[0073] The effect of the replication control system on the transcriptional expression level of key enzymes in lactate synthesis ( Figure 10 Two mL of bacterial culture from the experimental and control groups, which produced lactate, was taken after 2 days of culture. The bacterial cells were washed with PBS, and RNA was extracted from both groups of bacteria using RNAiso Plus (Takara, Shanghai, China). After removing genomic DNA, the corresponding cDNA was obtained using the PrimeScript™ RTMaster Mix reverse transcription kit (Takara, Shanghai, China). Subsequently, real-time quantitative PCR was performed using a fluorescent reaction system prepared with designed RT primers and the TB GreenPremix Ex Taq II kit (Takara, Shanghai, China). The Ct value was read, and the mRNA expression level of lactate dehydrogenase in the experimental and control groups was calculated using the relative quantification method. It was found that the expression level increased by about 5 times.

[0074] Example 5

[0075] The impact of the replication control system on PHB synthesis.

[0076] Construct a polyhydroxyalkanoate synthase phaC derived from Chromobacterium sp. USM2, regulated by an arabinose promoter. CS expression plasmids ( Figure 7 The EX and EXP strains constructed in Example 2 were introduced into the culture medium, with the former serving as the control group. One day prior to the culture, both strains were transferred to LBv2 medium and cultured at 30 °C until the plateau phase to serve as seed culture. They were then cultured in seawater molasses medium at an inoculum of 1% at 37 °C for different durations, followed by 2 days of culture at 30 °C. PHB yield was detected as follows: Cells in the culture medium were extracted by centrifugation, washed, and freeze-dried to obtain bacterial powder. 2 mg of the powder was added to 1 mL of esterification solution (methanol:sulfuric acid = 97:3, v / v) and 1 mL of chloroform, with 0.5 g / L benzoic acid added as an internal standard. After reaction in a 100 °C water bath, the organic phase was analyzed by gas chromatography-mass spectrometry (GC-MS). It was found that when the switching time was 2 or 4 h, the PHB yield in the experimental group was significantly higher than that in the control group. Figure 11 ).

[0077] Observation of ultrathin cell sections by transmission electron microscopy (TEM) Figure 12 Cells were extracted from the culture medium by centrifugation, washed three times with phosphate-buffered saline (PBS, pH 7.4), and fixed overnight with glutaraldehyde at 4 °C. After washing and fixing the cells three times with PBS, they were stained with osmium tetroxide and fixed overnight. After washing three times with PBS, the cells were dehydrated in a gradient with different concentrations of ethanol, and then washed three times with acetone to fix the cells. Finally, the cell samples were embedded in Spurr resin and sectioned for imaging observation. It was found that the cells in the experimental group were longer than those in the control group, and the volume occupied by the polyester particles contained in them was larger.

[0078] The above are merely preferred embodiments of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

[0079] The sequences involved in the embodiments are as follows:

[0080] The nucleic acid encoding the λ phage transcriptional repressor protein (SEQ ID NO:1):

[0081] atgagcacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttacaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagtgagtatgagtaccctgttttttctcatgttcaggcagggatgttctcacctaagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaaccaaaaaagccagtgattctgcattctggcttgaggttgaaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgatttctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggctga

[0082] Nucleic acid encoding PhiC31 integrase (SEQ ID NO:2)

[0083]

[0084] Upstream homologous arm (SEQ ID NO:3)

[0085] Ttctgtttatggtcgacggcaccacaactgatgcgaccgatccaaaggacatctggcccgactttgttgatcgcctgccagacagtattggtatgacggtgatccgcaacaaagccgatcaaaccggtgaagagatggggatctgtcatgtgaacaaccccactctgatccgcctgtcggcaaaaacagggactggtgttgacgccttacgtgcacatttgaaagagtgcatgggcttctcgggtaataccgagggtggctttatggctcgtcgccgtcatctggatgcattagaacgcgctgcacagcaccttcaaatcggtcaggagcagcttgaaggctatatggcgggtgagatactcgcagaagagctgcgcatcactcagcaacatctgaacgagattaccggggagttcagctcagacgacttgctcggccgtattttctcttcattctgtatcggcaaataatataacgcgcggtgttaagcttaggtttatcaccgcgtttctttttgtaccctcgctcatcgtacgagcgcaagtatggcttataaggaagataaatgatccacataattacaggcagtaccctgggtggcgctgaatacgtgggggatcacctgagtgatctacttatcgagaacggatttgaaaccacgatccacaaccaaccggaattggcgtcaattgacaatcacggcacctggctggtgatcacctctactcacggtgcaggtgaatacccagataacattcagccgtttattgccgcactacagaatacaccgccaaagatgacggatgttaggtttgctgtgattgcaattggtgactcaagctatgatacgttctgtgccgctggacagcatgcgtatgatttactggaagacatcggtgcaaccccaatcacagactgcttaaagattgatgtccttagccatgaagtgccagaagacgccgcagaagaatggctaaaagagaacatcgaacgattttaa。

[0086] Downstream homologous arm (SEQ ID NO:4)

[0087] Atgctttatcacgaaaattttgacgtcattgttgttggtggcggacatgctggaacggaagccgcactcgcatctgcacgtacaggacaaaaaacgcttctccttacccataacatcgatacattaggccaaatgtcttgtaatccggcgattggtggtattggtaaaggtcatttagttaaagaagtggatgcaatgggcggtttgatggcgcaagctattgaccatgcaggtattcaatttagaacgcttaatgcctctaaaggtccggcagtacgagcaactcgtgctcaagctgatcgtgccctttacaaagcctacgttcgcagcgcattagaaaatgcaccaaacctaacgctattccaacaatcggtagatgatctgattgttgaacaggatcatgtggttggtgtcgtgactcaaatgggtcttaaattccacgccaaatcggttgtattgacggttggtaccttcctgggtggtaagatccatatcggtatggaaagttcttctggtggccgtgcaggtgatccaccatcgatcgcacttgctgatcgtctacgtgaactgccattccgcgtggatcgtctcaaaacagggacaccaccacgtattgatgctcgcaccgttgatttctctgtactcgaagagcaacacggagataacccaacaccagtattctcatttctgggtaatcgtgagcaacatccacgtcaaattccgtgtttcatcactcacaccaacgaaagtacacacgatgtgatccgcgctaaccttgatcgcagtccgatgtacgctggcgttatcgaaggcattggtcctcgttactgtccatcgattgaagacaaagtgatgcgttttgctgacaaaaacagtcaccagatttttatcgagccagaaggcctgacaaccaacgagctgtacccgaatggtatttcgaccagcttgccgtttgatgttcaggtacaaattgttcgttcaatgaaaggttttgagaacg。

[0088] oriC-reverse fragment (SEQ ID NO:5)

[0089] gaaccgacctcaggtattcaaaggatttattggacagataaaggagcagcattttacctgctttatgccacagagaaaatcgttttctcgctttatccattttaagctccaagtaatatatatataagatctatatatatgatcttttattagatctattattaggatcgaccgtttctgtggataaccgaaaaatgatcaacaagatcatggatcttctttggatcatatcttgtgatcttgcttggatctgatcgaggattagctgggatcaaaatgggtggttatacacaggggggggaaacgatcaaagttgttctttggataactaaaggaaagtaactggatattagcttacttatccacagtctggttgctcattttttaatcggttgattggctgcttggagaaaaagttattcacatcgggtaggacagagccgcaatgcgactctgtaagtaggataaagtggcag

[0090] Full-length sequence of temperature-sensitive plasmid

[0091]

[0092] Recombinant Edit Plasmid Full-Length Sequence

[0093]

Claims

1. A plasmid system, characterized in that, Including temperature-sensitive plasmids and recombinant editing plasmids; The temperature-sensitive plasmid includes: nucleic acid encoding a temperature-sensitive repressor protein, a target promoter of the temperature-sensitive repressor protein, and nucleic acid encoding an integrase, wherein the integrase is at least one of PhiC31 integrase, PhiBT1 integrase, and TG1 integrase. The recombinant editing plasmid comprises, in sequence, an upstream homologous arm, an integrase recognition cleavage site 1, an oriC-reverse fragment, an integrase recognition cleavage site 2, and a downstream homologous arm.

2. The plasmid system according to claim 1, characterized in that, In the temperature-sensitive plasmid: The temperature-sensitive repressor protein is a λ phage transcriptional repressor protein, and its encoded nucleic acid has the nucleic acid sequence shown in SEQ ID NO:1; The integrase is PhiC31 integrase, which encodes a nucleic acid with the nucleic acid sequence shown in SEQ ID NO:

2.

3. The plasmid system according to claim 1 or 2, characterized in that, Its carrier skeleton is pUC57.

4. The plasmid system according to claim 1, characterized in that, In the recombinant editing plasmid The upstream homologous arm has a nucleic acid sequence as shown in SEQ ID NO:3; The downstream homologous arm has a nucleic acid sequence as shown in SEQ ID NO:5; The integrase recognition cleavage site 1 is attP or attB, and the integrase recognition cleavage site 2 is attP or attB; and the integrase recognition cleavage site 1 and the integrase recognition cleavage site 2 are different. The oriC-reverse fragment has a nucleic acid sequence as shown in SEQ ID NO:

4.

5. The plasmid system according to claim 1 or 4, characterized in that, The recombinant editing plasmid also includes SacB, I-SceI and a marker gene, with the backbone being R6k γ ori.

6. The use of the plasmid system according to any one of claims 1 to 5 in constructing sodium-dependent Vibrio bacteria with regulated growth-metabolite synthesis.

7. A sodium-dependent Vibrio species capable of regulating the synthesis of growth-metabolites, obtained by editing sodium-dependent Vibrio species using the plasmid system described in any one of claims 1 to 5.

8. A method for constructing sodium-dependent Vibrio bacteria with controllable growth-metabolite synthesis, comprising: The recombinant editing plasmid in any one of the plasmid systems described in claims 1 to 5 is introduced into wild-type sodium-dependent Vibrio. After confirming successful recombination, the plasmid is eliminated and then transferred into a temperature-sensitive plasmid to obtain sodium-dependent Vibrio that can regulate the synthesis of growth and metabolites.

9. The construction method according to claim 8, characterized in that, The wild-type sodium-dependent Vibrio is Vibrionatriegens ATCC 14048.

10. A protein expression method, comprising: constructing the target gene into the sodium-dependent Vibrio of claim 7 or the sodium-dependent Vibrio obtained by the construction method of claim 8 or 9; first culturing at 30±0.5 °C to obtain a seed culture; after transfer, expressing the integrase at 37±0.5 °C for a period of time; and then switching back to 30±0.5 °C for synthase expression.

Images