Application of transcription factor TaNAC67 in regulating wheat disease resistance

By overexpressing the transcription factor TaNAC67 gene in wheat, the environmental hazards and pathogen virulence variations caused by chemical control were addressed, resulting in durable resistance to stripe rust in wheat and providing disease-resistant gene resources.

CN120888599BActive Publication Date: 2026-03-06SHENZHEN RESEARCH INSTITUTE OF NORTHWEST A & F UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511438088.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-10-10
Publication Date
2026-03-06
Estimated Expiration
2045-10-10

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively control wheat stripe rust. Chemical control is harmful to the environment and food safety, and the pathogen virulence mutates rapidly, lacking durable disease-resistant gene resources.

Method used

Using genetic engineering techniques, the transcription factor TaNAC67 gene was identified and overexpressed. It was then introduced into wheat materials using Agrobacterium-mediated transformation to enhance the disease resistance of wheat and construct TaNAC67 gene overexpressing plants.

Benefits of technology

It significantly enhances wheat's resistance to stripe rust, provides durable disease-resistant gene resources, and improves the disease resistance of wheat breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120888599B_ABST
    Figure CN120888599B_ABST
Patent Text Reader

Abstract

This invention belongs to the field of genetic engineering technology and discloses the application of the transcription factor TaNAC67 in regulating wheat disease resistance. The amino acid sequence of the TaNAC67 transcription factor is shown in SEQ ID NO: 1. This transcription factor can induce cell necrosis and plays a positive regulatory role in the interaction between wheat and stripe rust fungus. The gene encoding this transcription factor... TaNAC67 This is a disease resistance-related gene that is strongly induced by stripe rust infection in the incompatible interaction between plants and stripe rust fungi. Its nucleotide sequence is shown in SEQ ID NO: 2. Based on these characteristics, this invention further obtains an overexpressing gene. TaNAC67 The transgenic plants were tested and found to exhibit resistance to stripe rust. This invention provides genetic resources and technical support for the subsequent genetic improvement of wheat materials resistant to stripe rust.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology and relates to the breeding of plant disease-resistant materials in agricultural genetic engineering, specifically the application of transcription factor TaNAC67 in regulating wheat disease resistance. Background Technology

[0002] From the wheat-specific form of the rust fungus with striped stalks ( Puccinia striiformis f. sp. tritici , Pst Wheat stripe rust, caused by fungi, is a major fungal disease in wheat production. It is characterized by its wide range of occurrence, rapid spread, and significant damage. In years when the disease is prevalent, it can lead to reduced wheat yields, and in severe cases, it can even cause total crop failure. It is one of the most serious threats to wheat yield loss.

[0003] Chemical control is the primary method for treating wheat stripe rust, but the use of chemical pesticides is detrimental to the environment and food safety. Furthermore, the rapid mutation of the stripe rust fungus makes sustained control of the disease difficult. Therefore, the creation of resistant materials is the fundamental approach to controlling wheat stripe rust.

[0004] Plant disease resistance-related genes are key genetic factors that regulate immune responses and determine disease resistance. Enhancing their expression can effectively inhibit pathogen infection and colonization in plants, thereby improving plant resistance. Against this backdrop, systematically analyzing the pathogenic mechanism of stripe rust fungus and accurately identifying disease resistance-related genes in wheat using genetic engineering and other technologies will provide important theoretical support and genetic resources for creating broad-spectrum, durable disease-resistant wheat germplasm. This has profound significance for promoting breakthroughs in wheat breeding and also provides innovative strategies for cultivating new disease-resistant crops. Summary of the Invention

[0005] Breeding disease-resistant varieties is the most effective method for controlling wheat stripe rust. This invention aims to identify wheat stripe rust resistance genes, providing directly usable gene resources for molecular breeding and contributing to the innovation of disease-resistant germplasm resources.

[0006] To achieve the above objectives, the present invention first provides the application of transcription factor TaNAC67 in regulating wheat disease resistance, the amino acid sequence of transcription factor TaNAC67 is shown in SEQ ID NO:1.

[0007] Furthermore, in the above applications, the transcription factor TaNAC67 positively regulates wheat disease resistance.

[0008] Furthermore, in the above applications, the transcription factor TaNAC67 is... TaNAC67 Gene encoding, TaNAC67 The nucleotide sequence of the gene is shown in SEQ ID NO: 2.

[0009] Furthermore, in the above applications, the disease resistance includes resistance to stripe rust.

[0010] In a second aspect, the present invention claims protection for a method for breeding wheat material resistant to stripe rust, the method comprising: transferring a recombinant vector containing a transcription factor TaNAC67 encoding gene into wheat material and overexpressing it, wherein the recombinant vector regulates wheat disease resistance by controlling the expression level of the transcription factor TaNAC67 encoding gene; the nucleotide sequence of the transcription factor TaNAC67 encoding gene is shown in SEQ ID NO: 2.

[0011] Furthermore, among the methods described above, the method for transferring recombinant vectors into wheat materials includes Agrobacterium-mediated transformation.

[0012] To ensure a complete and unambiguous understanding of the technical solution of this invention, it should be noted that the gene encoding the transcription factor TaNAC67 described in this invention is indicated by italicized text. TaNAC67 The transcription factor TaNAC67 is indicated by the non-italicized font "TaNAC67". Of course, those skilled in the art can clearly and completely understand the meaning of the relevant expressions based on the description in this invention.

[0013] Compared with the prior art, the present invention "Application of transcription factor TaNAC67 in regulating wheat disease resistance" has the following beneficial effects or advantages.

[0014] 1) This invention reveals for the first time the role of wheat NAC transcription factor TaNAC67 in disease resistance during the interaction between stripe rust fungus and wheat. By elucidating its disease resistance mechanism, this invention provides a basis for utilizing the encoding gene of the transcription factor (i.e., TaNAC67 This study lays the theoretical foundation for the creation of disease-resistant wheat materials through gene therapy, and is of great significance for breeding wheat varieties that are resistant to stripe rust for a long time.

[0015] 2) This invention utilizes reverse genetics to analyze the function of transcription factor TaNAC67. TaNAC67 TaNAC67 was induced to express the gene by infection with stripe rust fungus. Wheat lines overexpressing TaNAC67 were constructed using Agrobacterium-mediated genetic transformation technology, and the expression was determined. TaNAC67 The gene is a positive regulator of disease resistance and plays a role in disease resistance during the interaction between stripe rust fungus and wheat.

[0016] 3) This invention is of great significance in improving wheat disease resistance. By utilizing genetic engineering technology, it enhances... TaNAC67 The gene expression level significantly enhances wheat resistance to stripe rust, and this invention provides a new solution for breeding wheat stripe rust-resistant varieties from a molecular biology perspective.

[0017] 4) This invention also provides a method for breeding wheat varieties resistant to stripe rust. This method utilizes Agrobacterium-mediated genetic transformation technology to construct… TaNAC67 Wheat plants overexpressing the gene. Verification showed that the resulting transgenic plants exhibited significant resistance to the dominant stripe rust race CYR31. Attached Figure Description

[0018] Figure 1 This is a preferred technical roadmap of the present invention.

[0019] Figure 2 The results of the identification experiment of cell death induced by transcription factor TaNAC67 are shown. Left figure: This illustrates the treatment methods for tobacco leaves at corresponding locations, clearly labeling each treatment group. BAX (pro-apoptotic gene) is the positive control; GFP (green fluorescent protein gene) is the negative control; acetylsuccinone buffer is the blank control; TaNAC67 represents the Agrobacterium tumefaciens treatment group containing the target gene (referred to as the TaNAC67 group). Right figure: This includes two parts: first, the direct phenotypic observation results of the TaNAC67 group and each control group; second, the comparison results of cell necrosis phenotypes in each group after leaf decolorization.

[0020] Figure 3 This is a graph showing the VIGS (virus-induced gene silencing) phenotype results of transcription factor TaNAC67. Among them, the Mock group: blank control group (inoculated with FES buffer only, without virus inoculation); BMSV: TaPDS Group: Wheat albinism gene PDS The VIGS treatment group was used to verify whether BSMV virus inoculation was successful. PDS After gene silencing, wheat leaves will exhibit whitish, striped chlorosis); BMSV: GFP Group: GFP The VIGS-treated group of the gene served as a negative control; BMSV: TaNAC67 -as1 group: TaNAC67 VIGS treatment group for gene-specific fragment 1; BMSV: TaNAC67 -as2 group: TaNAC67 VIGS treatment group with gene-specific fragment 2.

[0021] Figure 4 For overexpression TaNAC67 Agarose gel electrophoresis results for positive identification of transgenic plants of the gene. Among them, OE6: TaNAC67 Gene overexpression line (TaNAC67-OE6); OE14: TaNAC67 Gene overexpression line (TaNAC67-OE14); P: plasmid positive control (containing TaNAC67Gene expression vector); Feilder: wild-type wheat control (recipient material, negative control); ddH2O: blank control; M: molecular weight standard.

[0022] Figure 5 Transgenic wheat lines TaNAC67 -OE6 TaNAC67 Gene sequencing comparison results.

[0023] Figure 6 Transgenic wheat lines TaNAC67 -OE14 TaNAC67 Gene sequencing comparison results.

[0024] Figure 7 For overexpression TaNAC67 Phenotypic results of transgenic wheat lines inoculated with stripe rust fungus race CYR31. Among them, Fielder: recipient wild-type wheat control (not transgenic). TaNAC67 (Gene); TaNAC67-OE6: TaNAC67 overexpression homozygous line; TaNAC67-OE14: TaNAC67 overexpression homozygous line. Detailed Implementation

[0025] The technical solution of the present invention will be described below with reference to the embodiments. However, the present invention is not limited to the following embodiments.

[0026] Unless otherwise specified, the experimental and detection methods in the following embodiments are conventional methods; the reagents and materials mentioned are commercially available unless otherwise specified; and the index data are measured using conventional methods unless otherwise specified.

[0027] Figure 1 A preferred technical route diagram of the present invention is provided, in which wheat is used as an example to represent the host plant infected with stripe rust. The technical routes used for other host plants of stripe rust are similar. Figure 1 The methods may be identical or slightly different in technique. Embodiments of this invention provide a method for functional verification of the transcription factor TaNAC67, comprising:

[0028] S101, using pGR107-mediated gene function verification experiments, to verify the cell death-inducing function of transcription factor TaNAC67;

[0029] S102, using virus-induced gene silencing (VIGS) technology to transiently silence TaNAC67, clarified its disease resistance function;

[0030] S103 was created using genetic engineering technology. TaNAC67 Gene overexpression plants were identified, and positive transgenic lines were screened using molecular detection.

[0031] S104, TaNAC67 Plants overexpressing the gene were inoculated with the predominant stripe rust race CYR31 for phenotypic identification to clarify their disease resistance characteristics.

[0032] Figure 1 The invention clearly constructs a complete technical process from gene function verification to disease resistance identification of transgenic plants, providing clear operational guidelines for the orderly conduct of subsequent experiments, ensuring the logic, operability, and reproducibility of the experimental steps, and serving as the framework supporting the implementation of the entire invention's technical solution.

[0033] Furthermore, embodiments of the present invention provide a method for identifying the disease resistance function of wheat NAC transcription factor TaNAC67, specifically including:

[0034] The wheat transcription factor TaNAC67 was specifically and transiently silenced using virus-induced gene silencing (VIGS) technology. The wheat was inoculated with the virus at the two-leaf stage. On day 10 post-inoculation, the control group (inoculated with the wheat albinism gene) was tested. TaPDS The wheat leaves were examined for bleaching; if so, the inoculation was successful. Fresh spores of wheat stripe rust were inoculated at the four-leaf stage. On day 14 after inoculation, the number of spore masses on the leaf surface was measured, and necrosis of the inoculated leaves was checked. Transgenic wheat plants overexpressing TaNAC67 were obtained using Agrobacterium-mediated genetic transformation, and the resistance of the transgenic plants to stripe rust CYR31 was verified.

[0035] Wheat and stripe rust fungus used in the examples:

[0036] Wheat varieties used in the experiment: Mingxian 169, Shuiyuan 11, Fielder;

[0037] Wheat stripe rust fungi: CYR23 and CYR31, both of which were isolated in the laboratory.

[0038] Test reagents and materials used in the examples:

[0039] Acetyleugenol buffer: Take 4 mL of 0.5 M MES (pH=5.6), 666 μL of 3 M MgCl2, 200 μL of 150 mM acetylsyleugenol, and add ddH2O to make up to 200 mL.

[0040] FES buffer: 1.877 g glycine, 2.613 g dipotassium hydrogen phosphate, 0.5 g sodium pyrophosphate, 0.5 g bentonite, 0.5 g diatomaceous earth, bring to a final volume of 50 mL, autoclave for 15 min.

[0041] pMD™19 (Simple) vector: TaKaRa Corporation;

[0042] 2×Taq MasterMix (Dye) PCR premix: Vazyme;

[0043] Escherichia coli DH5α competent cells: Shanghai Weidi Biotechnology Co., Ltd.;

[0044] PrimeStar Mix (2×) PCR Premix Reagent: TaKaRa;

[0045] Gel recovery kit: Omega Bio-Tek;

[0046] 2×Scamless Cloning Mix: CWBIO Corporation;

[0047] RiboMAX TM Large Scale Production System-T7 Reagent Kit: Promega Corporation.

[0048] Experimental instruments used in the examples:

[0049] Incubator: Ningbo Jiangnan Instrument Factory, RXZ-500D;

[0050] RNA Extraction Kit: Beijing Huayueyang Biotechnology Co., Ltd.;

[0051] Recombinant reverse transcriptase M-MuLV RT: Thermo Scientific;

[0052] S1000 Thermal Cycler PCR instrument: Bio-Rad.

[0053] Example 1

[0054] This embodiment describes the gene encoding the wheat transcription factor TaNAC67 (i.e., TaNAC67 Isolation and cloning of genes.

[0055] Wheat seeds (water source 11) were planted in 10cm diameter flowerpots and cultured in an incubator with a 16 / 8h light / dark cycle and a temperature of 16℃. When the wheat seedlings grew to the two-leaf-one-heart stage, the two-leaf leaves were collected, and total RNA was extracted from the wheat leaves using an RNA extraction kit.

[0056] Total RNA from wheat leaves was reverse transcribed into the first strand of cDNA using recombinant reverse transcriptase M-MuLV RT. The synthesis was performed on an S1000 Thermal Cycler PCR instrument under the following conditions: 42℃ for 30 min; 75℃ for 5 min.

[0057] Designing amplifications using Primer 5.0 software TaNAC67 Gene-specific primers were used for PCR amplification, and the sequences are as follows:

[0058] TaNAC67-cDNA-F: ATGGTGATGGCGGCGGCGGAGC (SEQ ID NO: 3);

[0059] TaNAC67-cDNA-R: TCAGAAGAAGAATGGGCTGACGTCC (SEQ ID NO: 4).

[0060] Using cDNA first strand as a template, PCR amplification was performed in a PCR instrument according to the reaction system shown in Table 1. The reaction program was as follows: 95℃ pre-denaturation for 10 min; 95℃ for 30 sec, 56℃ for 30 sec, 72℃ for 30 sec, 40 cycles; 72℃ for 10 min.

[0061] Table 1. Reaction System

[0062]

[0063] Get containing TaNAC67 The DNA fragment of the full-length coding frame of the gene. The obtained PCR amplification product was constructed into the pMD™19 (Simple) vector via T-ligation, and the ligation system is shown in Table 2.

[0064] Table 2. Connection System

[0065]

[0066] The cells were then transformed into *E. coli* DH5α competent cells and cultured overnight at 37°C. Colony PCR was performed on single clones on the plates using universal primers M13-F and M13-R, where:

[0067] M13-F: TGTAAAACGACGGCCAGT (SEQ ID NO: 5)

[0068] M13-R: CAGGAAACAGCTATGACC (SEQ ID NO: 6).

[0069] Reaction program: 95℃ pre-denaturation for 10 min; 95℃ for 30 sec, 56℃ for 30 sec, 72℃ for 30 sec, 35 cycles; 72℃ for 10 min. The reaction system is shown in Table 3.

[0070] Table 3. Reaction System

[0071]

[0072] Single colonies with the correct band size were selected and cultured overnight using a shaking incubator. The plasmid was extracted and named T-TaNAC67. Sequencing was performed (Qingke Biotechnology Co., Ltd.). After sequence alignment and removal of the vector sequence, the following results were obtained: TaNAC67 The gene nucleotide sequence is shown in SEQ ID NO: 2, and the amino acid sequence it encodes is shown in SEQ ID NO: 1.

[0073] Example 2

[0074] This embodiment describes a functional verification experiment of transcription factor TaNAC67 inducing cell necrosis.

[0075] 1. Construction of recombinant plasmid pGR107-TaNAC67

[0076] Based on the principle of one-step cloning, a homologous arm Small I was added to the 5' end of the designed forward primer pGR107-TaNAC67-F; and a homologous arm Not I was added to the 5' end of the reverse primer pGR107-TaNAC67-R, wherein:

[0077] Smal I: CTAGCATCGATTCCCGGG (SEQ ID NO: 7);

[0078] Not I: GTATGGGTACGCGGCCGC (SEQ ID NO: 8);

[0079] pGR107-TaNAC67-F: ctagcatcgattcccgggATGGTGATGGCGGCGGCGGAGC (SEQ ID NO: 9);

[0080] pGR107-TaNAC67-R:gtatgggtacgcggccgcGAAGAAGAATGGGCTGACGTCC (SEQ ID NO: 10, stop codon removed);

[0081] Using T-TaNAC67 as a template, PCR amplification was performed in a PCR instrument according to the reaction system in Table 4. The reaction program was: 98℃ for 10 sec, 58℃ for 15 sec, 72℃ for 5 sec, 40 cycles; 72℃ for 10 min.

[0082] Table 4. Reaction System

[0083]

[0084] The PCR products were subjected to 1% agarose gel electrophoresis. The agarose gel containing the target band was cut under UV light, and the target band was recovered according to the gel recovery kit procedure. The band was then ligated to the pGR107 vector under the following conditions: 50℃ for 15 min. The ligation system is shown in Table 5.

[0085] Table 5. Connection System

[0086]

[0087] The product was transformed into E. coli DH5α competent cells, positive clones were screened and cultured overnight, and sequenced (Qingke Biotechnology Co., Ltd.). Plasmids with correct sequencing results were selected for the next step of the experiment. The extracted plasmid was named pGR107-TaNAC67.

[0088] pGR107-TaNAC67 was transformed into Agrobacterium tumefaciens GV3101. After culturing at 28°C for 1–2 days, single colonies were picked and multiplied overnight at 28°C and 200 rpm in 5 mL of liquid medium containing Kanamycin and rifampin. The bacterial culture was collected once in 2 mL EP tubes, centrifuged at 8000 rpm for 1 min, and the cells were resuspended in 10 mmol MgCl3 solution, washed three times. 100 μL of the bacterial culture was then transferred to 1.9 mL of 10 mmol MgCl3 solution (diluted 10-fold), and the OD value was measured. The OD value of the bacterial culture was then determined using acetylsyleugenone buffer. 600 Dilute the solution to 0.4–0.6 and incubate in the dark for 1 hour. Treat Agrobacterium tumefaciens containing BAX (pro-apoptotic gene) or GFP (green fluorescent protein gene) using the same method described above, and inject the incubated bacterial solution into the underside of tobacco leaves using a 1 mL syringe. Simultaneously, inject 1 mL of acetylsuccine buffer into the same tobacco leaf. Observe and photograph the cell necrosis in the tobacco leaves after 3–5 days. Repeat the experiment three times.

[0089] The experimental results are shown in Figure 2 , Figure 2 Divided into two parts, left and right: the left image shows the treatment methods of tobacco leaves at corresponding positions, clearly marking the treatment types of each group, where BAX is the positive control; GFP is the negative control; acetylsuccine buffer is the blank control; TaNAC67 is the Agrobacterium tumefaciens treatment group containing the target gene (referred to as the TaNAC67 group); the right image contains two parts: one is the direct phenotypic observation results of the TaNAC67 group and each control group, and the other is the comparison results of the cell necrosis phenotype of each group after leaf decolorization.

[0090] from Figure 2It was observed that tobacco leaves in the TaNAC67 group showed significant cell necrosis, with a necrosis phenotype similar to that of the positive control BAX group; while tobacco leaves in the negative control GFP group and Buffer group did not show obvious cell death. This result demonstrates that the transcription factor TaNAC67 has the function of inducing plant cell necrosis, providing direct experimental evidence for further confirmation that it "positively regulates disease resistance by promoting cell necrosis" in the interaction between wheat and stripe rust.

[0091] Example 3

[0092] This embodiment describes TaNAC67 Experiment on the effect of gene silencing on the pathogenicity of stripe rust fungi.

[0093] Through sequence alignment (http: / / blast.ncbi.nlm.nih.gov / Blast.cgi) and specificity analysis, TaNAC67 The gene has two highly specific gene segments, namely:

[0094] TaNAC67 -as1, TaNAC67 Gene-specific fragment 1, the nucleotide sequence of which is shown in SEQ ID NO: 11;

[0095] TaNAC67 -as2, TaNAC67 Gene-specific fragment 2, the nucleotide sequence of which is shown in SEQ ID NO: 12.

[0096] Based on these two specific gene fragments, and following the principle of one-step cloning, a homologous arm Pac I was added to the 5' end of the designed forward primers (VIGS-TaNAC67-as1-F and VIGS-TaNAC67-as2-F), and a homologous arm (Not I) was added to the 5' end of the reverse primers (VIGS-TaNAC67-as1-R and VIGS-TaNAC67-as2-R).

[0097] Pac I: TAGCTGATTAATTAA (SEQ ID NO: 13);

[0098] Not I: GCTAGCTGAGCGGCCGC (SEQ ID NO: 14);

[0099] VIGS-TaNAC67-as1-F: tagctgattaattaaAGTGGGAGAAGATGCAGCAG (SEQ ID NO: 15);

[0100] VIGS-TaNAC67-as1-R: gctagctgagcggccgcCACCTCCTCCTTTGGCAGTA (SEQ ID NO: 16);

[0101] VIGS-TaNAC67-as2-F: tagctgattaattaaCAACGACGACTGGCTAATGG (SEQ ID NO: 17);

[0102] VIGS-TaNAC67-as2-R: gctagctgagcggccgc ACGTCCTGCTCCATCTTCAT (SEQ ID NO: 18);

[0103] Build TaNAC67 The gene transient silencing vector was constructed according to Example 2.

[0104] The three parts of barley stripe mosaic virus (BSMV) assembled, namely α, β, and γ, as well as the recombinant γ plasmid γ- TaNAC67 γ- TaPDS The DNA fragments were linearized separately. The linearized DNA fragments were then transcribed into RNA in vitro using RiboMAX. TM The reaction program for the Large Scale Production System-T7 kit is: 37℃, 1h; 70℃, 5min.

[0105] During inoculation, in the control group: 10 µL each of α, β, and γ were added to 200–300 µL of FES buffer, and the liquid was inoculated onto the two leaves of wheat using the friction inoculation method, repeated three times; in the experimental group: α, β, and recombinant γ- TaNAC67 or recombined γ- TaPDS The same inoculation method was used. Then, the inoculated wheat seedlings were cultured at 25-28℃ for 10 days. If obvious striped chlorosis was observed on the inoculated leaves, it proved that the BSMV virus inoculation was successful.

[0106] The successfully inoculated wheat seedlings were further inoculated with wheat stripe rust fungus CYR23: fresh wheat stripe rust urediniospores were diluted with electronic fluorination solution, and 10 μL of the diluted spore solution was pipetted and evenly applied to the wheat leaves; the inoculated wheat seedlings were then cultured in the dark at 16℃ for 36 hours, and then continued to be cultured under normal light conditions; the symptoms on the wheat leaves were observed after 14 days. The experiment was repeated 3 times.

[0107] The phenotypic results of wheat leaves after silencing TaNAC67 using VIGS technology are as follows: Figure 3As shown. The experimental results were observed in two parts, divided into "inoculation with BSMV virus" and "inoculation with CYR23 stripe rust fungus," respectively.

[0108] Mock group: Blank control group (inoculated with FES buffer only, without virus inoculation);

[0109] BMSV: TaPDS Group: Wheat albinism gene TaPDS The VIGS treatment group was used to verify whether BSMV virus inoculation was successful (wheat leaves will show white streaks of chlorosis after TaPDS silencing).

[0110] BMSV: GFP Group: GFP The VIGS-treated group of the gene served as a negative control;

[0111] BMSV: TaNAC67 -as1 group: TaNAC67 VIGS-treated group containing gene-specific fragment 1;

[0112] BMSV: TaNAC67 -as2 group: TaNAC67 VIGS treatment group with gene-specific fragment 2.

[0113] Figure 3 It is evident that 10 days after inoculation with BSMV virus culture, BMSV: TaPDS The leaves of the group showed obvious chlorosis, proving that BSMV virus successfully infected wheat and the VIGS system was effectively constructed; after 14 days of culture with CYR23 stripe rust fungus, the leaves of each group showed different stripe rust pathogenic phenotypes, among which BSMV: TaNAC67 -as1 group and BMSV: TaNAC67 The number of stripe rust spore masses on wheat leaves in group -as2 was significantly higher than that in BMSV. GFP In this group, the pathogenicity of stripe rust fungi was significantly enhanced. This result indicates that transient silencing... TaNAC67 After gene sequencing, wheat resistance to stripe rust fungus CYR23 was significantly reduced, thus confirming that transcription factor TaNAC67 plays a disease-resistant role in wheat's resistance to stripe rust infection.

[0114] Example 4

[0115] This embodiment describes an overexpression TaNAC67 Breeding and disease resistance identification of transgenic wheat.

[0116] by TaNAC67Based on genes and following the principle of one-step cloning, a homologous arm, BamHI-1, was added to the 5' end of the designed forward primer Cub-TaNAC67-F, and a homologous arm, BamHI-2, was added to the 5' end of the reverse primer Cub-TaNAC67-R.

[0117] BamH I-1: AGGTCGACTCTAGAGGATCC (SEQ ID NO: 19);

[0118] BamH I-2: TGATGGTGATGATGGGATCC (SEQ ID NO: 20);

[0119] Cub-TaNAC67-F: aggtcgactctagaggatccATGGTGATGGCGGCGGCGGAGC (SEQ ID NO: 21);

[0120] Cub-TaNAC67-R: tgatggtgatgatgggatccGAAGAAGAATGGGCTGACGTCC (with stop codon removed, SEQ ID NO: 22);

[0121] Build TaNAC67 The gene overexpression vector was constructed according to Example 2.

[0122] Genetic transformation induced by Agrobacterium-induced transformation TaNAC67 Gene overexpression vectors were introduced into wheat Fielder receptor material, and T0 generation transgenic plants were produced through screening, pre-regeneration, regeneration, and rooting of kanamycin-resistant callus. Selection... TaNAC67 Homozygous lines with overexpressed genes were used to identify resistance to stripe rust. Wheat stripe rust fungus CYR31 was used for subsequent resistance inoculation. The specific inoculation process of CYR31 fungus is described in Example 3.

[0123] TaNAC67 Positive identification results of wheat plants with gene overexpression are shown below. Figure 4 ,in:

[0124] OE6: TaNAC67 Gene overexpression line (TaNAC67-OE6);

[0125] OE14: TaNAC67 Gene overexpression line (TaNAC67-OE14).

[0126] P: Plasmid positive control (containing TaNAC67 Gene expression vectors);

[0127] Feilder: Wild-type wheat control (receptor material, negative control);

[0128] ddH2O: Blank control;

[0129] M: Molecular weight standard.

[0130] Figure 4 The electrophoretic bands of each sample are shown in the image. Specific bands are visible in the positive control and the transgenic lines, while no specific bands are visible in the negative control and the blank control. This indicates that both the TaNAC67-OE6 and TaNAC67-OE14 lines can amplify specific bands consistent with the plasmid positive control, while the wild-type Feilder and the blank control do not show this band. This proves that the TaNAC67 gene has been successfully introduced into the two lines, and both lines are positive transgenic plants.

[0131] TaNAC67-OE6 and TaNAC67-OE14 strains TaNAC67 The gene sequencing alignment results are as follows: Figure 5 , Figure 6 As shown, the introduced strains in the two lines are presented. TaNAC67 The alignment of the gene sequence with the target sequence (SEQ ID NO: 2). The sequencing alignment results indicate that the introduced gene in both positive lines... TaNAC67 The gene sequence is completely identical to the target sequence (SEQ ID NO: 2, after removing the stop codon), with no sequence variation, ensuring that the transgenic plant contains... TaNAC67 The accuracy of the genes provided qualified experimental materials for subsequent disease resistance identification.

[0132] The results of the TaNAC67 overexpression transgenic wheat inoculated with the major prevalent stripe rust race CYR31 for disease resistance phenotype identification are shown below. Figure 7 This includes three experimental groups:

[0133] Fielder: Recipient wild-type wheat control (not transferred) TaNAC67 Gene);

[0134] TaNAC67-OE6: TaNAC67 Homozygous strains with gene overexpression;

[0135] TaNAC67-OE14: TaNAC67 Homozygous strains with gene overexpression.

[0136] from Figure 7 It is evident that the leaves of the wild-type control, Fielder, were covered with numerous stripe rust spore masses, with extensive lesion expansion and severe stripe rust symptoms. In contrast, the leaves of the two overexpression lines, TaNAC67-OE6 and TaNAC67-OE14, showed a significant reduction in the number and size of stripe rust spore masses, with lesion expansion strongly inhibited and stripe rust symptoms significantly alleviated. This result directly confirms that... TaNAC67 Transgenic wheat plants overexpressing the gene exhibited clear resistance to CYR31, the main prevalent race of stripe rust, further validating the... TaNAC67 The function of genes in enhancing wheat resistance to stripe rust provides a selectable genetic resource for the genetic improvement of stripe rust-resistant wheat materials.

[0137] The above embodiments can well illustrate the technical solution of the present invention, but they are only describing preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, all kinds of changes and improvements made by those skilled in the art to the technical solution of the present invention should fall within the protection scope defined by the present invention.

Claims

1. Use of overexpression of the transcription factor TaNAC67 in the improvement of disease resistance in wheat, characterized in that, The amino acid sequence of the transcription factor TaNAC67 is shown as SEQ ID NO: 1; The transcription factor TaNAC67 is encoded by TaNAC67 the gene, TaNAC67 the nucleotide sequence of the gene is shown as SEQ ID NO: 2; The transcription factor TaNAC67 positively regulates the disease resistance of wheat by promoting cell necrosis; The disease resistance is a stripe rust resistance; The stripe rust is caused by the dominant race CYR31 of Puccinia striiformis.

2. A method of breeding a material of wheat resistant to stripe rust, characterized in that, The method comprises: introducing a recombinant vector containing a gene encoding the transcription factor TaNAC67 into wheat material and overexpressing it; The construction of the recombinant vector requires adding a BamH I-1 and a BamH I-2 homologous arm at the 5' end of the primer, respectively, and the nucleotide sequences of the homologous arms are shown as SEQ ID NO: 19 and SEQ ID NO: 20, respectively; The nucleotide sequence of the gene encoding the transcription factor TaNAC67 is shown as SEQ ID NO: 2; The method for introducing the recombinant vector into wheat material comprises an Agrobacterium-mediated method; The stripe rust is caused by the dominant race CYR31 of Puccinia striiformis.