Primer, kit and method for detecting individualized medication gene polymorphism of diabetes mellitus
By designing specific amplification primers and introducing the recognition site of the rapid restriction endonuclease BamHI, combined with PCR-RFLP technology, the problems of cumbersome operation, high cost and low efficiency in the detection of gene polymorphisms for personalized diabetes medication in existing technologies have been solved, and rapid and accurate polymorphism detection has been achieved.
Patent Information
- Application Number
- CN202511290846.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-10
- Publication Date
- 2025-11-04
AI Technical Summary
Existing technologies for detecting gene polymorphisms related to personalized medicine for diabetes are cumbersome to operate, have high reagent costs, and low detection efficiency, making it difficult to achieve rapid and accurate detection of multiple gene loci.
Specific amplification primers were designed and the recognition site of the rapid restriction endonuclease BamHI was introduced. Combined with PCR-RFLP technology, restriction sites were created by mismatched primers to realize the detection of polymorphisms in the C11orf65, KCNJ11 and GLP1R genes.
It significantly reduces testing costs, improves testing efficiency, simplifies the operation process, and enables accurate identification of multiple gene loci, making it suitable for large-scale production of reagent kits.
Smart Images
Figure CN120888653A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of molecular biology detection, and particularly relates to a primer, a kit and a method for detecting genetic polymorphism of individualized medication of diabetes. BACKGROUND
[0002] Diabetes is a global high-incidence chronic metabolic disease, mainly divided into type 1 diabetes and type 2 diabetes. Among them, type 1 diabetes is caused by the absolute deficiency of insulin secretion due to the failure of islet beta cells, and patients need to rely on insulin treatment for a lifetime; type 2 diabetes accounts for more than 90% of the total number of diabetes patients, and its pathogenesis is related to insulin resistance (decreased sensitivity of target tissues to insulin) and relative insulin secretion deficiency of islet beta cells, and clinical blood glucose is usually controlled by oral hypoglycemic drugs combined with lifestyle intervention. The typical symptoms of diabetes are polyuria, polydipsia, polyphagia, weight loss, and if long-term blood glucose control is poor, it will cause multiple organ complications such as kidney, eye, cardiovascular system, and nervous system, seriously affecting the quality of life of patients and increasing the risk of death.
[0003] The currently clinically commonly used oral hypoglycemic drugs mainly include biguanides (such as metformin), glinides (such as repaglinide), sulfonylureas (such as glimepiride), thiazolidinediones (such as pioglitazone), dipeptidyl peptidase-IV (DPP-4) inhibitors, etc., which play a role in promoting insulin secretion, increasing the sensitivity of target tissues to insulin, delaying glucose absorption, and promoting the excretion of glucose by the kidney.
[0004] However, there are significant individual differences in the efficacy of oral hypoglycemic drugs and GLP-1 receptor agonists: when the same drug and the same dose are used for different type 2 diabetes patients, some patients have a significant blood glucose control effect, and some patients have poor efficacy and even adverse reactions (such as hypoglycemia and gastrointestinal reactions). Studies have shown that this difference in efficacy is closely related to the genetic heterogeneity of patients - single nucleotide polymorphisms (SNPs) at gene loci can affect the metabolism of drugs in the body, the binding ability of target sites, or the activity of signal pathways, thereby leading to differences in drug reactions. Among them, the polymorphisms of the following three gene loci have been verified in the Chinese population in relation to the efficacy of specific hypoglycemic drugs:
[0005] C11orf65 gene rs11212617 locus (C>A): the polymorphism of this locus is directly related to the efficacy of metformin. The liver glucose output inhibition efficiency and peripheral tissue insulin sensitivity improvement effect of type 2 diabetes patients carrying the C allele are significantly better than those of patients carrying the A allele, and the hypoglycemic efficacy of metformin is better;
[0006] KCNJ11 gene rs5219 site (T>C): this site encodes the ATP-sensitive potassium channel (KATP channel) subunit on the membrane of pancreatic beta cells, and its polymorphism affects the stimulation of sulfonylurea drugs (such as gliclazide) on pancreatic beta cells. When the T→C mutation occurs in the site, the sensitivity of the KATP channel to sulfonylurea drugs increases, the amount of insulin secretion of the patient using gliclazide treatment is improved, and the blood glucose control effect is more significant;
[0007] GLP1 R gene rs10305420 site (C>T): GLP1 R is the target of GLP-1 receptor agonists (such as liraglutide), and the polymorphism of the site affects the binding affinity of the receptor to the drug and the efficiency of downstream signal transduction. Compared with patients with CC genotype or CT genotype, patients with TT genotype have a greater decrease in blood glucose (especially glycosylated hemoglobin) after liraglutide treatment, and the drug response effect is best.
[0008] In order to realize individualized drug use for diabetes, a polymorphism detection technology combining PCR amplification and restriction enzyme digestion is used by PCR-RFLP technology, and the core principle is: the polymorphic region of the target gene is amplified by PCR, if the region has a recognition site of a restriction enzyme, the PCR product can be cut into fragments of different lengths by enzyme digestion, and then separated by agarose gel electrophoresis, and the genotype of the sample can be judged according to the difference in fragment length. However, when detecting multiple SNP sites related to diabetes drugs by PCR-RFLP, multiple special primers and multiple restriction enzymes need to be designed, which leads to complicated operation, high reagent cost and low detection efficiency.
[0009] Therefore, the skilled in the art proposes primers, kits and methods for detecting genetic polymorphism of individualized drug use for diabetes, aiming to create a recognition site of a restriction enzyme by using a mismatch primer, and at the same time, combining the use of fast restriction enzyme BamHI, the polymorphism of multiple genes of the sample can be quickly detected. SUMMARY
[0010] In order to solve the above technical problems, the present application provides primers, kits and methods for detecting genetic polymorphism of individualized drug use for diabetes to solve the problems proposed in the background art.
[0011] According to a first aspect of the present disclosure, the purpose is to propose primers for detecting genetic polymorphism of individualized drug use for diabetes, the primers comprising three pairs of specific amplification primers for three genetic polymorphism sites:
[0012] an upstream primer 2617-F and a downstream primer 2617-R for amplifying the C11 orf65 gene SNP site rs11212617;
[0013] an upstream primer 5219-F and a downstream primer 5219-R for amplifying the SNP site rs5219 of the KCNJ11 gene;
[0014] an upstream primer 5420-F and a downstream primer 5420-R for amplifying the SNP site rs10305420 of the GLP1 R gene.
[0015] Preferably, the primers are mismatch primers for introducing a recognition site GGATCC of the restriction enzyme BamHI in the PCR amplification product.
[0016] According to a second aspect of the present disclosure, the purpose is to provide a kit for detecting genetic polymorphism of individualized medication for diabetes, comprising the primers for detecting genetic polymorphism of individualized medication for diabetes, the PCR amplification reaction solution and the rapid restriction enzyme system as described in the first aspect.
[0017] Preferably, the PCR amplification reaction solution comprises 10×PCR buffer and DNA polymerase, and the concentration of the DNA polymerase is 1U / μL.
[0018] Preferably, the rapid restriction enzyme system comprises the rapid restriction enzyme BamHI and 10×enzyme digestion buffer.
[0019] According to a third aspect of the present disclosure, the purpose is to provide a method for detecting genetic polymorphism of individualized medication for diabetes, comprising the following steps:
[0020] S1, using 3 pairs of specific amplification primers to perform separate tube PCR amplification on sample DNA, to obtain PCR amplification products for the SNP site rs11212617 of the C11orf65 gene, the SNP site rs5219 of the KCNJ11 gene and the SNP site rs10305420 of the GLP1 R gene;
[0021] S2, using the rapid restriction enzyme BamHI to perform enzyme digestion reaction on each of the PCR amplification products obtained in step S1, to obtain enzyme digestion products;
[0022] S3, performing agarose gel electrophoresis on the enzyme digestion products of step S2, and determining the genotypes of the 3 genetic polymorphism sites according to the presence or absence and size of the characteristic bands in the electrophoretogram.
[0023] Preferably, in step S1, the reaction system of the separate tube PCR amplification is prepared in the following amounts: 10×PCR buffer, 1U / μL DNA polymerase, 15μM of the corresponding upstream primer, 15μM of the corresponding downstream primer and sample DNA.
[0024] Preferably, in the step S2, the enzyme cutting reaction system comprises the PCR amplification product, the fast restriction endonuclease BamHI and 10x enzyme cutting buffer.
[0025] Preferably, in the step S3, the voltage of the agarose gel electrophoresis is 120V, and after the electrophoresis is completed, the electrophoretogram is photographed and the band is analyzed by using a gel imaging analysis system.
[0026] Preferably, in the step S3, the judgment standard of the genotype of the three genetic polymorphic sites is as follows:
[0027] For the C11 orf65 gene rs11212617 site: if there is no 309bp band and there is a 250bp band in the electrophoretogram, the genotype is wild type homozygote CC; if there is a 309bp band and there is no 250bp band, the genotype is mutant homozygote AA; if there are both 309bp band and 250bp band, the genotype is heterozygote CA;
[0028] For the KCNJ11 gene rs5219 site: if there is a 311bp band and there is no 252bp band in the electrophoretogram, the genotype is wild type homozygote TT; if there is no 311bp band and there is a 252bp band, the genotype is mutant homozygote CC; if there are both 311bp band and 252bp band, the genotype is heterozygote TC;
[0029] For the GLP1 R gene rs10305420 site: if there is no 310bp band and there is a 259bp band in the electrophoretogram, the genotype is wild type homozygote CC; if there is a 310bp band and there is no 259bp band, the genotype is mutant homozygote TT; if there are both 310bp band and 259bp band, the genotype is heterozygote CT.
[0030] Compared with the prior art, the present application has the following beneficial effects:
[0031] The present application detects the rs11212617 site of the C11 orf65 gene, the rs5219 site of the KCNJ11 gene and the rs10305420 site of the GLP1 R gene based on the PCR-RFLP method, and three groups of primers are designed based on the recognition site GGATCC of the fast restriction endonuclease BamHI; by designing mismatch primers on the upstream and downstream of the amplified target fragment to create the enzyme cutting site of the restriction endonuclease, the distinguishing degree of the enzyme cutting product characteristic band is enhanced, the three sites can be identified quickly and accurately, the detection cost is significantly reduced, and the detection efficiency is improved; in addition, a certain site can be detected alone according to actual needs; the present application has low detection cost, high accuracy, simple operation and is suitable for the scale production of the kit. BRIEF DESCRIPTION OF DRAWINGS
[0032] Figure 1 The electropherogram of sample No. 1 was detected; wherein the hole marked M was marker, the hole marked 1 was rs11212617 site of C11 orf65 gene, the hole marked 2 was rs5219 site of KCNJ11 gene, and the hole marked 3 was rs10305420 site of GLP1 R gene.
[0033] Figure 2 The electropherogram of sample No. 2 was detected; wherein the hole marked M was marker, the hole marked 1 was rs11212617 site of C11 orf65 gene, the hole marked 2 was rs5219 site of KCNJ11 gene, and the hole marked 3 was rs10305420 site of GLP1 R gene.
[0034] Figure 3 The electropherogram of sample No. 3 was detected; wherein the hole marked M was marker, the hole marked 1 was rs11212617 site of C11 orf65 gene, the hole marked 2 was rs5219 site of KCNJ11 gene, and the hole marked 3 was rs10305420 site of GLP1 R gene.
[0035] Figure 4 The electropherogram of sample No. 4 was detected; wherein the hole marked M was marker, the hole marked 1 was rs11212617 site of C11 orf65 gene, the hole marked 2 was rs5219 site of KCNJ11 gene, and the hole marked 3 was rs10305420 site of GLP1 R gene.
[0036] Figure 5 The electropherogram of sample No. 5 was detected; wherein the hole marked M was marker, the hole marked 1 was rs11212617 site of C11 orf65 gene, the hole marked 2 was rs5219 site of KCNJ11 gene, and the hole marked 3 was rs10305420 site of GLP1 R gene.
[0037] Figure 6 The sequencing peak chart of sample No. 1 was detected, and the detected gene sites were shown in the frame.
[0038] Figure 7 The sequencing peak chart of sample No. 2 was detected, and the detected gene sites were shown in the frame.
[0039] Figure 8 The sequencing peak chart of sample No. 3 was detected, and the detected gene sites were shown in the frame.
[0040] Figure 9 The sequencing peak chart of sample No. 4 was detected, and the detected gene sites were shown in the frame.
[0041] Figure 10The sequencing peak chart of sample No. 5 is shown in the frame, and the detected gene site is shown. DETAILED DESCRIPTION
[0042] The embodiments of the present application are further described in detail below with reference to the accompanying drawings and examples. The following examples are used to illustrate the present application, but cannot be used to limit the scope of the present application.
[0043] Example 1
[0044] The primers for detecting the rs11212617 site of C11 orf65 gene, the rs5219 site of KCNJ11 gene and the rs10305420 site of GLP1 R gene are amplification primers specifically designed for the rs11212617 site of C11 orf65 gene, the rs5219 site of KCNJ11 gene and the rs10305420 site of GLP1 R gene;
[0045] The kit for detecting the rs11212617 site of C11 orf65 gene, the rs5219 site of KCNJ11 gene and the rs10305420 site of GLP1 R gene comprises a PCR amplification reaction solution and a rapid restriction endonuclease system. The PCR amplification reaction solution comprises: 10×PCR buffer; DNA polymerase (1 U / μL); upstream primer (15 μM); downstream primer (15 μM);
[0046] The sequences of the upstream primer 2617-F and the downstream primer 2617-R for detecting the rs11212617 site of C11 orf65 gene are as follows:
[0047] 2617-F: TACATATACCAATTACAAAGGGCAGATCGGATC
[0048] 2617-R: ATTGGAGTGCAGTGGTGTCATAATGGGTCGGATCC
[0049] The sequences of the upstream primer 2617-F and the downstream primer 2617-R for detecting the rs5219 site of KCNJ11 gene are as follows:
[0050] 5219-F: AGCGGGCCCTCCGCTGGCGGGCACGGTACCTGGATC
[0051] 5219-R: TGAGGCTGGTATTAAGAAGTGAAGTGGGATCC
[0052] The sequences of the upstream primer 5420-F and the downstream primer 5420-R for detecting the rs10305420 site of GLP1 R gene are as follows:
[0053] 5420-F: ACTCCCCGCCATGGCCGGCGCCCCGGATC
[0054] 5420-R: CGCTGGGGTTGGGGGGAATCCTCTGGGATCC
[0055] Fast restriction endonuclease system includes: fast restriction endonuclease BamHI, 10x enzyme digestion buffer.
[0056] Example two:
[0057] Operating method of reagent kit for detecting SNP site of hypoglycemic drug gene based on PCR-RFLP method
[0058] PCR amplification reaction reagent preparation for detecting rs11212617 site of C11 orf65 gene, the amount of each component is as follows:
[0059] Reagent Name Amount 10 x PCR buffer 2.0 μL DNA polymerase (1 U / μL) 2.5 μL 2617-F (15 μM) 0.5 μL 2617-R (15 μM) 0.5 μL DNA template 2 μL DEPC water up to 20 μL
[0060] PCR amplification reaction reagent preparation for detecting rs5219 site of KCNJ11 gene, the amount of each component is as follows:
[0061] Reagent Name Amount 10 x PCR buffer 2.0 μL DNA polymerase (1 U / μL) 2.5 μL 5219-F (15 μM) 0.5 μL 5219-R (15 μM) 0.5 μL DNA template 2 μL DEPC water up to 20 μL
[0062] PCR amplification reaction reagent preparation for rs10305420 site of GLP1 R gene, the amount of each component is as follows:
[0063] Reagent Name Amount 10 x PCR buffer 2.0 μL DNA polymerase (1 U / μL) 2.5 μL 5420-F (15 μM) 0.5 μL 5420-R (15 μM) 0.5 μL DNA template 2 μL DEPC water up to 20 μL
[0064] The prepared PCR amplification reaction reagent is amplified on a common PCR instrument, and the reaction conditions are as follows:
[0065]
[0066] Preparation of fast restriction endonuclease system, the amount of each component is as follows:
[0067]
[0068]
[0069] The prepared fast restriction endonuclease system is digested, and the reaction conditions are as follows:
[0070] Temperature Time 37℃ 10 min 80℃ 2 min
[0071] The digested sample is subjected to agarose gel electrophoresis at 120V voltage, photographed and analyzed by gel imaging analysis system, and the genotypes of the three gene SNP sites are judged.
[0072] Example 3: 5 blood samples were detected by the nucleic acid detection kit of the application, the reagents were prepared and detected according to the method described in Example 2, 10 μL of enzyme digestion product was subjected to 1.5% agarose gel electrophoresis (120 V, 30 min), and the gel imaging system was photographed and analyzed, and the results were as follows:
[0073] The detection results of No. 1 sample were as shown in Figure 1 , the genotype of rs11212617 site of C11 orf65 gene was CC, the genotype of rs5219 site of KCNJ11 gene was CT, and the genotype of rs10305420 site of GLP1 R gene was CC.
[0074] The detection results of No. 2 sample were as shown in Figure 2 , the genotype of rs11212617 site of C11 orf65 gene was CA, the genotype of rs5219 site of KCNJ11 gene was TT, and the genotype of rs10305420 site of GLP1 R gene was CT.
[0075] The detection results of No. 3 sample were as shown in Figure 3 , the genotype of rs11212617 site of C11 orf65 gene was CC, the genotype of rs5219 site of KCNJ11 gene was CC, and the genotype of rs10305420 site of GLP1 R gene was CC.
[0076] The detection results of No. 4 sample were as shown in Figure 4 , the genotype of rs11212617 site of C11 orf65 gene was CC, the genotype of rs5219 site of KCNJ11 gene was TT, and the genotype of rs10305420 site of GLP1 R gene was TT.
[0077] The detection results of No. 5 sample were as shown in Figure 5 , the genotype of rs11212617 site of C11 orf65 gene was AA, the genotype of rs5219 site of KCNJ11 gene was TT, and the genotype of rs10305420 site of GLP1 R gene was CC.
[0078] DNA sequencing analysis: the DNA of 5 blood samples was sent to Shengong Bioengineering (Shanghai) Co., Ltd. for Sanger sequencing (for 3 SNP sites), and the sequencing results were as follows:
[0079] Figure 6 The sequencing diagram of No. 1 sample, the sequencing results were consistent with the detection results of the method.
[0080] Figure 7The sequencing result of sample No. 2 is consistent with the detection result of the method.
[0081] Figure 8 The sequencing result of sample No. 3 is consistent with the detection result of the method.
[0082] Figure 9 The sequencing result of sample No. 4 is consistent with the detection result of the method.
[0083] Figure 10 The sequencing result of sample No. 5 is consistent with the detection result of the method.
[0084] The sequencing result is completely consistent with the detection result of the method, proving that the detection accuracy of the method is 100%.
[0085] Importantly, it should be noted that the construction and arrangement of the application shown in the various exemplary embodiments is illustrative only. Although only a few embodiments have been described in detail in this disclosure, those skilled in the art who review this disclosure will readily appreciate that many modifications are possible in the light of the novel teachings provided herein. Other substitutions, modifications, changes and omissions can also be made in the design, operating conditions and arrangement of the exemplary embodiments without departing from the spirit of the application as expressed in the appended claims. Therefore, this application is not intended to be limited to the particular embodiments disclosed, but it is intended to cover all modifications falling within the scope of the application as defined by the appended claims.
[0086] It will be appreciated that in the development of any actual implementation, numerous implementation-specific decisions can be made. These development efforts can be complex and time-consuming, but can also benefit from advancements in the art that adapt the synthetic procedures for applying biological materials. As such, those of ordinary skill in the art will recognize that the development of an actual implementation is a multi-faceted design, engineering and production effort, and will be a routine undertaking for those of ordinary skill in the art in light of this disclosure.
[0087] It should be noted that the above examples are only used to illustrate the technical solutions of the present application but not limit the present application, and although the present application has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present application can be modified or replaced by equivalents without departing from the spirit and scope of the present application, and all should be covered in the scope of the claims of the present application.
Claims
1. Primers for detecting gene polymorphisms in personalized medication for diabetes, characterized in that, The primers include three pairs of specific amplification primers, each targeting one of the three gene polymorphism sites: The upstream primer 2617-F and the downstream primer 2617-R are used to amplify the SNP site rs11212617 of the C11 orf65 gene; The upstream primer 5219-F and the downstream primer 5219-R are used to amplify the SNP site rs5219 of the KCNJ11 gene; The upstream primer 5420-F and the downstream primer 5420-R are used to amplify the GLP1 R gene SNP site rs10305420.
2. The primers for detecting gene polymorphisms in personalized medicine for diabetes as described in claim 1, characterized in that: The primers are mismatched primers used to introduce the recognition site GGATCC of the restriction endonuclease BamHI into the PCR amplification product.
3. A kit for detecting gene polymorphisms in personalized diabetes medication, characterized in that, It includes the primers, PCR amplification reaction solution, and rapid restriction endonuclease system for detecting gene polymorphisms in personalized diabetes medication as described in claim 1.
4. The kit for detecting gene polymorphisms in personalized medicine for diabetes as described in claim 3, characterized in that: The PCR amplification reaction solution includes 10×PCR buffer and DNA polymerase, wherein the concentration of the DNA polymerase is 1 U / μL.
5. The kit for detecting gene polymorphisms in personalized medicine for diabetes as described in claim 3, characterized in that: The rapid restriction endonuclease system includes the rapid restriction endonuclease BamHI and 10× digestion buffer.
6. A method for detecting gene polymorphisms in personalized medication for diabetes, characterized in that, Includes the following steps: S1. Use three pairs of specific amplification primers to perform PCR amplification on sample DNA in separate tubes to obtain PCR amplification products targeting the C11 orf65 gene rs11212617 site, the KCNJ11 gene rs5219 site, and the GLP1 R gene rs10305420 site. S2. The PCR amplification products obtained in step S1 were digested with the rapid restriction endonuclease BamHI to obtain the digested products. S3. Perform agarose gel electrophoresis on the enzyme digestion products of step S2, and determine the genotypes of the three gene polymorphism sites based on the presence and size of characteristic bands in the electrophoresis pattern.
7. The method for detecting gene polymorphisms in personalized medicine for diabetes as described in claim 6, characterized in that: In step S1, the reaction system for the tube PCR amplification is prepared according to the following amounts: 10×PCR buffer, 1U / μL DNA polymerase, 15μM of the corresponding upstream primer, 15μM of the corresponding downstream primer, and sample DNA.
8. The method for detecting gene polymorphisms in personalized medicine for diabetes as described in claim 6, characterized in that: In step S2, the enzyme digestion reaction system includes PCR amplification products, rapid restriction endonuclease BamHI, and 10× digestion buffer.
9. The method for detecting gene polymorphisms in personalized medicine for diabetes as described in claim 6, characterized in that: In step S3, the voltage for agarose gel electrophoresis is 120V. After electrophoresis, a gel imaging analysis system is used to photograph the electrophoretic pattern and analyze the bands.
10. The method for detecting gene polymorphisms in personalized medicine for diabetes as described in claim 6, characterized in that: In step S3, the criteria for determining the genotype of the three gene polymorphism sites are as follows: For the C11 orf65 gene rs11212617 locus: if there is no 309bp band but a 250bp band in the electrophoresis pattern, the genotype is wild-type homozygous CC; if there is a 309bp band but no 250bp band, the genotype is mutant homozygous AA; if there are both 309bp and 250bp bands, the genotype is heterozygous CA. For the KCNJ11 gene rs5219 locus: if the electrophoresis pattern shows a 311bp band but no 252bp band, the genotype is wild-type homozygous TT; if there is no 311bp band but a 252bp band, the genotype is mutant homozygous CC; if both 311bp and 252bp bands are present, the genotype is heterozygous TC. For the GLP1 R gene rs10305420 locus: if there is no 310bp band but a 259bp band in the electrophoresis pattern, the genotype is wild-type homozygous CC; if there is a 310bp band but no 259bp band, the genotype is mutant homozygous TT; if there are both 310bp and 259bp bands, the genotype is heterozygous CT.