Rapid nucleic acid detection method based on LAMP (loop-mediated isothermal amplification) technology and application thereof
By mixing positively charged PEI-CDs with LAMP nucleic acid reagents to form a fluorescent precipitate for visual detection in LAMP nucleic acid detection, the problem of rapid and accurate nucleic acid detection in emergency medical environments, especially for point-of-care detection of Group B Streptococcus, has been solved.
Patent Information
- Application Number
- CN202510979305.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-16
- Publication Date
- 2025-11-04
AI Technical Summary
Existing nucleic acid testing methods are difficult to implement rapid, accurate and sensitive point-of-care testing in emergency medical settings, especially for the detection of Group B Streptococcus (GBS) infection. LAMP technology lacks a reliable signal output method.
The method involves mixing positively charged PEI-CDs with LAMP nucleic acid reagents and using fluorescent carbon dot indicators to quickly determine the detection results after isothermal amplification. No special instruments or equipment are required; the method achieves visual detection by forming fluorescent precipitates through electrostatic adsorption.
It enables rapid, accurate, and convenient nucleic acid testing in emergency medical settings, especially for pregnant women screening and emergency diagnosis. The testing is fast, the results are reliable, and it is suitable for point-of-care testing of Group B Streptococcus.
Smart Images
Figure CN120888679A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of nucleic acid detection, and particularly relates to a nucleic acid rapid detection method based on LAMP technology and application thereof. BACKGROUND
[0002] Accurate detection and determination of infectious bacteria have an important technical guiding effect on clinical treatment.
[0003] For detection and determination of infectious bacteria, there are culture method, immunization method and nucleic acid detection method, etc. The culture method for detection of infectious bacteria has the technical characteristics of accuracy and reliability, but the operation steps are complicated and the process is time-consuming, which cannot meet the rapid detection technical requirements in emergency medical environment. The immunization method for detection of infectious bacteria has the technical characteristics of rapid detection, but the sensitivity is low, and the technical guiding value for clinical treatment is relatively low. The nucleic acid detection method for detection of infectious bacteria is relatively fast and has high sensitivity, and has a certain guiding value for clinical treatment in emergency medical environment, but the nucleic acid detection method has strong dependence on fluorescence quantitative PCR equipment, which makes the detection operation inflexible and cannot be applied to bedside detection with high technical requirements in emergency medical environment, which is especially prominent for detection of GBS infection of B streptococcus.
[0004] B streptococcus, also known as non-lactating streptococcus, is a kind of bacteria with high infectivity, which can cause intra-amniotic infection, neonatal pneumonia, septicemia and meningitis in perinatal period, and has serious harm to pregnant women and newborns. Although the global statistical data of GBS infection of pregnant women and newborns is not completely, the existing data shows that the detection rate of GBS infection in pregnant women is about 5-30%; among them, the vertical transmission from mother to newborn accounts for about 70% of the cases of GBS infection of newborns, which is one of the important reasons for high morbidity and mortality of newborns. Therefore, it is very important to detect GBS infection in late pregnancy and carry out prenatal antibiotic prevention to protect the safety of mother and infant. It can be seen that GBS detection has a wide range of clinical applications, especially in the aspects of pregnant woman screening, newborn infection monitoring and emergency diagnosis, etc.
[0005] Loop-mediated isothermal amplification technology, namely LAMP technology, is a technology that can amplify DNA in a short time (<1h) under the condition of isothermal environment (60-65℃) by using 4-6 specific primers and high-activity strand displacement DNA polymerase, which can complete nucleic acid sequence amplification under constant temperature condition without special instrument and equipment, and meets the technical requirements of on-site rapid detection. Although LAMP technology is very suitable for on-site rapid detection and bedside application scenarios in terms of operation simplicity, rapidity and equipment requirements, it still cannot meet the requirements of the above application scenarios only by relying on LAMP technology, mainly because it lacks a reliable and simple signal output method.
[0006] Therefore, it is of great significance to study how to apply the LAMP technology to the above medical scenarios to realize bedside detection. SUMMARY
[0007] The technical purpose of the present application is to provide a simple and intuitive nucleic acid rapid detection method based on LAMP technology to meet the technical needs of bedside detection in the above medical environment and overcome the shortcomings of the prior art.
[0008] The technical purpose of the present application is achieved by the following technical solution: a nucleic acid rapid detection method based on LAMP technology, comprising the following process steps: Step 1. Add the sample to be tested to the LAMP reagent to obtain a LAMP nucleic acid reagent; Step 2. Perform isothermal amplification reaction on the LAMP nucleic acid reagent; Step 3. Add PEI-CDs with positive surface charge to the LAMP nucleic acid reagent after isothermal amplification reaction and mix uniformly; Step 4. Quickly determine the nucleic acid detection result by the fluorescence carbon dots in step 3.
[0009] As one of the preferred technical solutions, the PEI-CDs in step 3 are carbon dots with positive surface charge prepared by high-temperature treatment of amino-rich PEI.
[0010] Further, the synthesis and treatment of the PEI-CDs include the following specific process steps: S1. Dissolve 0.2g of PEI in 10mL of pure water to obtain a PEI solution; S2. Put the PEI solution of S1 into a hydrothermal reaction kettle; S3. React at a temperature of 180℃ for 6h to obtain PEI-CDs.
[0011] As one of the preferred technical solutions, in step 3, the addition of PEI-CDs to the LAMP nucleic acid reagent is based on the LAMP nucleic acid reagent, and the concentration of the added PEI-CDs is 1mg / mL.
[0012] As one of the preferred technical solutions, the mixing of the PEI-CDs in the LAMP nucleic acid reagent is performed by vortexing the reaction tube for 30s.
[0013] As one of the preferred technical solutions, in step 3, after the PEI-CDs are mixed uniformly in the LAMP nucleic acid reagent, the mixture is allowed to stand for 30s.
[0014] As one of the preferred technical solutions, in step 2, the temperature of the LAMP nucleic acid reagent for isothermal amplification reaction is 63℃, and the reaction time is 30min.
[0015] As one of the preferred technical solutions, in step 4, under the environment of ultraviolet lamp, the fluorescence carbon dots in step 3 are used to quickly judge the nucleic acid detection result.
[0016] The use of the above-mentioned nucleic acid rapid detection method is used for rapid detection of group B streptococcus.
[0017] As one of the preferred technical solutions, the LAMP reagent in the nucleic acid rapid detection method is optimized by using amplification primers with names F3, B3, FIP, BIP, LF and LB. Among them: The DNA sequence (5' to 3') of the F3 amplification primer is AAGACTTCATTGCGTGCC. The DNA sequence (5' to 3') of the B3 amplification primer is CCTTTACATCGTTAACTTGAGC. The DNA sequence (5' to 3') of the FIP amplification primer is TGAGTTGAAAAAGTGATTGCTTCAAATGATTTGAATTCTATTGGTAGTCG. The DNA sequence (5' to 3') of the BIP amplification primer is TATGGGATTTGGGATAACTAAGCTGTTGAATCAACTGAAGCAAATGG. The DNA sequence (5' to 3') of the LF amplification primer is CACATCTGTTAAGGCTTCTA. The DNA sequence (5' to 3') of the LB amplification primer is GTTATTCGCATTTTAGA. The reaction time of the F3, B3, FIP, BIP, LF and LB amplification primer optimization treatment of the LAMP reagent is 30min, and the reaction temperature is 63℃.
[0018] The beneficial technical effect of the present application is that the above technical measures are aimed at the technical requirements of bedside detection in the above medical environment, especially the technical requirements of pregnant woman screening and emergency diagnosis. Based on the LAMP technology, the synthesized PEI-CDs with positive charges are mixed with the LAMP nucleic acid reagents after isothermal amplification, so that the detection results of the LAMP technology are directly visualized, without relying on special instruments and equipment, and rapid detection can be realized on site, thereby reliably meeting the technical requirements of bedside detection in the above medical environment, especially reliably adapting to the technical requirements of GBS infection detection in the late pregnancy and emergency, and the entire detection process has the technical characteristics of simple operation, fast detection speed, short cycle, high accuracy of detection results.
[0019] The process parameters in the above technical measures are determined by repeated tests, which can reliably guarantee the accuracy of the detection results. BRIEF DESCRIPTION OF DRAWINGS
[0020] Figure 1 A process flow chart of the present application.
[0021] Figure 2 A process flow chart of PEI-CDs synthesis in Figure 1
[0022] Figure 3 A UV-Vis absorption spectrum characterization diagram of PEI-CDs.
[0023] Figure 4 A fluorescence excitation spectrum and emission spectrum characterization diagram of PEI-CDs.
[0024] Figure 5 A morphology and particle size characterization diagram of PEI-CDs.
[0025] Figure 6 An analysis diagram for exploring the potential response mechanism of PEI-CDs.
[0026] Figure 7 A Zeta potential distribution diagram of PEI-CDs.
[0027] Figure 8 A feasibility analysis diagram for visualizing the LAMP nucleic acid reaction results based on PEI-CDs.
[0028] Figure 9 A gel electrophoresis analysis result diagram of LAMP amplification products in the feasibility analysis.
[0029] Figure 10 A reaction temperature optimization analysis diagram of LAMP.
[0030] Figure 11 A dosage optimization analysis diagram of PEI-CDs.
[0031] Figure 12 Analysis chart for sensitivity of the detection method of the present application.
[0032] Figure 13 Analysis chart for specificity of the detection method of the present application.
[0033] Figure 14 Analysis chart for the results of agarose gel electrophoresis analysis of LAMP amplification products in sensitivity evaluation.
[0034] Figure 15 Analysis chart for the results of agarose gel electrophoresis analysis of LAMP amplification products in specificity evaluation. DETAILED DESCRIPTION
[0035] The present application relates to the technical field of nucleic acid detection, and specifically relates to a nucleic acid rapid detection method based on LAMP technology and the use of the nucleic acid rapid detection method. The main technical scheme of the present application will be specifically described below in combination with specific examples and test processes.
[0036] The nucleic acid rapid detection method of the present application is used for rapid detection of GBS infection of group B streptococcus at bedside.
[0037] Referring to Figure 1 The nucleic acid rapid detection method of the present application includes the following process steps: Step 1. The LAMP reagent is optimized by using the amplification primers shown in the following table:
[0038] The reaction time of the LAMP reagent optimized by the amplification primers shown in the above table is 30 min, and the reaction temperature is 63℃; The optimized LAMP reagent is added to the reaction tube, and the GBS sample to be detected is added to the reaction tube, so that the GBS sample and the LAMP reagent are mixed in the reaction tube to obtain the LAMP nucleic acid reagent; Step 2. The LAMP nucleic acid reagent of step 1 is isothermally amplified at a reaction temperature of 63℃ for 30 min; Step 3. The LAMP nucleic acid reagent of step 1 is used as a reference, and PEI-CDs with a concentration of 1 mg / mL and a positive surface charge are added to the LAMP nucleic acid reagent after the isothermal amplification reaction is completed; The reaction tube is shaken for 30 s by using a vortex shaker, so that the PEI-CDs are uniformly mixed in the LAMP nucleic acid reagent; After standing for 30 s, Step 4. The fluorescence carbon dots of step 3 are used as an indicator to quickly determine the nucleic acid detection result in the environment of ultraviolet light, and bedside rapid detection is completed.
[0039] In the above nucleic acid rapid detection method, the PEI-CDs added in step 3 can be added to the cap of the reaction tube before the isothermal amplification reaction of step 2, without mixing with the LAMP nucleic acid reagent, and the PEI-CDs in the cap of the reaction tube are mixed with the LAMP nucleic acid reagent at the bottom of the reaction tube by vortexing.
[0040] The above PEI-CDs are carbon dots with positive charges on the surface prepared by high-temperature treatment of PEI rich in amino groups, as shown in Figure 2 .
[0041] The technical principle of the reaction of PEI-CDs with positive charges on the surface with LAMP nucleic acid reagent is (as shown in Figure 1 ). It is found that the main amplification product of LAMP technology is DNA fragments of different sizes, and a large amount of dNTP is consumed in the amplification process. Each consumption of a dNTP molecule will produce a pyrophosphate, which will combine with magnesium ions to form magnesium pyrophosphate crystals. LAMP technology has higher amplification efficiency than PCR technology, and the technical requirements for sample processing and nucleic acid extraction are lower, further improving the convenience of its application; CDs are zero-dimensional carbon-based nanomaterials with a size usually less than 10 nanometers, which have unique fluorescence properties and excellent optical properties. They are composed of sp² and sp³ hybridized carbon skeleton, and the surface is rich in various functional groups such as carboxyl, hydroxyl and amine. These functional groups endow CDs with excellent water solubility and easy functionalization characteristics. In addition, CDs have the characteristics of non-toxicity, good biocompatibility, easy synthesis and low manufacturing cost, which make them perform well in the fields of biological imaging, biosensing and disease detection; Therefore, the applicant studies to use LAMP technology as a nucleic acid amplification method and CDs as a new visual fluorescent indicator to construct a visual sensor for rapid and high-sensitivity detection of GBS nucleic acid; The applicant finds that for positive LAMP nucleic acid reaction, the amplification of target DNA will produce a large amount of negatively charged DNA fragments and magnesium pyrophosphate crystals (byproducts of LAMP nucleic acid reaction), which interact with positively charged fluorescent PEI-CDs through electrostatic adsorption, forming large fluorescent precipitates, so that intuitive visualization can be achieved without other special instruments and equipment; For negative LAMP nucleic acid reaction (no target), PEI-CDs remain uniformly dispersed in the reaction mixture and cannot be directly visualized. By this visual distinction, the presence of the target is directly determined, i.e. using LAMP technology, the rapid amplification of the target nucleotide sequence at a constant temperature and the visual identification of the LAMP nucleic acid reaction result by fluorescent CDs to achieve rapid, high-sensitivity nucleic acid visual detection.
[0042] As shown in Figure 2 , the synthesis process of the above PEI-CDs adapted to the LAMP nucleic acid reagent includes the following specific process steps: S1. Dissolve 0.2 g of PEI in 10 mL of pure water to obtain a PEI solution; S2. Put the PEI solution of S1 into a hydrothermal reaction kettle; S3. React at a temperature of 180°C for 6 hours to obtain PEI-CDs.
[0043] The PEI-CDs synthesized by the above method were analyzed for particle size and charged state by dynamic light scattering instrument, and the morphology was analyzed by transmission electron microscope (TEM), and the characterization of PEI-CDs is shown in Figure 3 , Figure 4 and Figure 5 . Among them, Figure 3 reflects the UV-visible absorption spectrum of PEI-CDs, Figure 4 reflects the excitation spectrum and emission spectrum of PEI-CDs, Figure 5 reflects the morphology and particle size of PEI-CDs. Tests show that PEI-CDs have obvious fluorescence characteristics (blue-green emission), good dispersibility, and uniform particle size (about 3.5 nm).
[0044] Experimental research on the potential response mechanism of the above PEI-CDs was carried out, and the potential PEI-CDs reaction mechanism in the LAMP reaction was studied by using simulated LAMP samples.
[0045] Specifically: In order to simulate the positive LAMP reaction, Na4P2O7 was added to the reaction mixture, and for the simulated negative LAMP reaction, Na4P2O7 was omitted; In the TEM image, the Mg2P2O7 crystal shows an irregular cluster structure, as shown in Figure 6 A; When PEI-CDs are mixed with simulated negative LAMP samples, due to the electrostatic repulsion between PEI-CDs with positive charges on the surface, they are well dispersed in the mixture, as shown in Figure 6 B; In contrast, in the simulated positive LAMP sample, PEI-CDs accumulate at the bottom of the reaction tube, forming a blue-green fluorescent precipitate, as shown in Figure 6 C; TEM and EDS analysis showed that the blue-green fluorescent precipitate contained C, O, N, Mg and P elements, indicating the composition of PEI-CDs and Mg2P2O7, as shown in Figure 6 D; The ability of PEI-CDs to effectively bind with DNA products generated in LAMP amplification was studied, and a positive LAMP sample (containing target DNA; incubated at 63°C for 30 min) was prepared and centrifuged to remove Mg2P2O7 crystals. The supernatant containing DNA products was collected and mixed with PEI-CDs, and a bright blue-green fluorescent precipitate appeared at the bottom of the reaction tube, as shown in Figure 6 E, indicating that PEI-CDs also bind with DNA products.
[0046] In addition, the Zeta potential of Mg2P2O7, CDs, CDs + pyrophosphate samples at the pH value of the amplification system was also determined, as shown in Figure 7 The experiment showed that PEI-CDs were positively charged, and Mg2P2O7 was negatively charged.
[0047] Therefore, the experiment showed that the possible mechanism of PEI-CDs responding to LAMP reaction was through electrostatic interaction with LAMP products (DNA and Mg2P2O7 crystals).
[0048] In the above nucleic acid rapid detection method, the feasibility of visualization was tested and analyzed.
[0049] The experimental process was as follows: PEI-CDs were added to the LAMP nucleic acid reagent after the completion of the isothermal amplification reaction, mixed uniformly and left standing.
[0050] The feasibility of LAMP nucleic acid reaction result visualization based on PEI-CDs is shown in Figure 8 and Figure 9 Among them, Figure 8 reflects the feasibility of LAMP nucleic acid reaction result visualization based on PEI-CDs, Figure 9 reflects the consistency of the visualization detection result with the agarose gel electrophoresis analysis result.
[0051] The experiment showed that LAMP nucleic acid reaction result visualization based on PEI-CDs was feasible.
[0052] In the above nucleic acid rapid detection method, the optimization of LAMP matching GBS samples was tested, and the reaction temperature optimization was determined.
[0053] The specific experimental process was as follows: Real-time monitoring of LAMP reaction was performed by a fluorescence quantitative PCR instrument to explore the optimal temperature of the reaction; LAMP fluorescent reaction system: 10 μL DNA template, 1x Isothermal Amplification Buffer, 1.4 mM dNTP, 8 mM MgSO4, 4 U Bst2.0 DNA polymerase, 0.5 μL LAMP fluorescent dye, 0.2 μM F3 / B3, 1.6 μM FIP / BIP, 0.4 μM LF / LB; Real-time monitoring of SYBR Green I channel fluorescence signal, reading fluorescence data every 1 min, forming LAMP real-time fluorescence amplification curve, determining the optimal reaction temperature; Reaction temperature setting: 59℃, 61℃, 63℃, 65℃ and 67℃.
[0054] The test results are shown in Figure 10 , Figure 10 The reaction temperature of LAMP is 63℃.
[0055] In the above nucleic acid rapid detection method, the concentration of PEI-CDs added is tested and analyzed.
[0056] The test process is: Select samples containing 10 4 copies / μL of group B streptococcus cfb gene as the experimental group, and pure water as the negative control group, and perform LAMP amplification on them respectively, mix and equally distribute the amplification products of each target gene to ensure that each sample contains an equal amount of amplification products; Gradient dilution of PEI-CDs, prepare a series of solutions with a final volume of 30 μL, with concentrations of 0.5 mg / mL, 1 mg / mL, 1.5 mg / mL, 2 mg / mL, 2.5 mg / mL and 3 mg / mL, to explore the PEI-CDs concentration corresponding to the best visual detection performance; Vortex the reaction tube for 30 s to mix the LAMP reaction mixture with PEI-CDs; Then place the reaction tube in a warm place for 30 s, and observe the sedimentation effect under the ultraviolet lamp; After the reaction is completed, transfer the supernatant to a new EP tube and measure its fluorescence intensity, and according to the fluorescence intensity ratio of the experimental group / control (F0 / F1), determine the optimal concentration.
[0057] The test results are shown in Figure 11 , Figure 11 reflecting the dosage optimization of PEI-CDs.
[0058] The test shows that when the volume of PEI-CDs is 30 μL, the optimal concentration for use is 1 mg / mL.
[0059] In the above nucleic acid rapid detection method, the detection performance of the GBS nucleic acid detection platform based on LAMP and CDs was tested and evaluated.
[0060] The test process was as follows: The detection specificity was evaluated by using five non-specific strains of Streptococcus pyogenes, Candida albicans, Streptococcus thermophilus, Escherichia coli and Listeria monocytogenes to evaluate the detection specificity of the detection platform. The detection sensitivity was evaluated by diluting GBS to a concentration gradient of 1×10 5 , 1×10 4 , 1×10 3 , 1×10 2 , 1×10 1 , 1×10 0 copies / μL, and using the constructed detection platform to detect each sample to obtain the minimum detection limit. The detection practicability was evaluated by collecting a number of clinical samples for double-blind experiments, comparing the experimental results with the gold standard detection results, and verifying the practicability.
[0061] The test evaluation of the detection performance is shown in Figure 12 , Figure 13 , Figure 14 and Figure 15 . Among them, Figure 12 reflects the detection sensitivity of the detection method, Figure 13 reflects the detection specificity of the detection method, Figure 14 reflects the results of agarose gel electrophoresis analysis of LAMP amplification products in sensitivity evaluation, Figure 15 reflects the results of agarose gel electrophoresis analysis of LAMP amplification products in specificity evaluation.
[0062] The test shows that the detection sensitivity of the detection method is 10 2 copies / μL, and has good detection specificity.
[0063] The above specific technical solutions are only used to illustrate the present application, but not to limit it.
[0064] Although the present application has been described in detail with reference to the above specific technical solutions, those skilled in the art should understand that they can still modify the above specific technical solutions, or make equivalent substitutions for part of the technical features, such as using other suitable LAMP technology for bacterial infection nucleic acid determination, etc.; and these modifications or substitutions do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the present application.
Claims
1. A method for rapid detection of nucleic acid based on LAMP technology, characterized in that, The nucleic acid rapid detection method comprises the following process steps: Step 1. The sample to be detected is added to the LAMP reagent to obtain a LAMP nucleic acid reagent; Step 2. The LAMP nucleic acid reagent is subjected to isothermal amplification reaction; Step 3. The PEI-CDs with positive charges on the surface are added to the LAMP nucleic acid reagent after the isothermal amplification reaction is completed, and are uniformly mixed; Step 4. The nucleic acid detection result is rapidly judged by the fluorescence carbon dots in step 3.
2. The method according to claim 1, wherein the LAMP-based nucleic acid rapid detection method is characterized by, The PEI-CDs in step 3 are carbon dots with positive charges on the surface, which are prepared by high-temperature treatment of PEI rich in amino groups.
3. The method according to claim 2, wherein the LAMP-based nucleic acid rapid detection method is characterized by, The synthesis and treatment of the PEI-CDs comprise the following specific process steps: S1. 0.2g of PEI is dissolved in 10mL of pure water to obtain a PEI solution; S2. The PEI solution in S1 is placed in a hydrothermal reaction kettle; S3. The reaction is carried out at a temperature of 180℃ for 6h to obtain PEI-CDs.
4. The method according to claim 1, wherein the LAMP-based nucleic acid rapid detection method is characterized by, In step 3, the PEI-CDs are added to the LAMP nucleic acid reagent at a concentration of 1mg / mL based on the LAMP nucleic acid reagent.
5. The method according to claim 1, wherein the LAMP-based nucleic acid rapid detection method is characterized by, The mixing of the PEI-CDs in the LAMP nucleic acid reagent is carried out by vortexing the reaction tube for 30s.
6. The method according to claim 1 or 5, wherein After the PEI-CDs are uniformly mixed in the LAMP nucleic acid reagent in step 3, the mixture is allowed to stand for 30s.
7. The method according to claim 1, wherein the LAMP-based nucleic acid rapid detection method is characterized by, In step 2, the LAMP nucleic acid reagent is subjected to isothermal amplification reaction at a temperature of 63℃ for 30min.
8. The method according to claim 1, wherein the LAMP-based nucleic acid rapid detection method is characterized by, In step 4, the nucleic acid detection result is rapidly judged by the fluorescence carbon dots in step 3 in the environment of an ultraviolet lamp.
9. Use of the method for rapid detection of nucleic acids according to any one of claims 1 to 8, characterized in that, The nucleic acid rapid detection method is used for rapid detection of group B streptococcus.
10. Use of the method for rapid detection of nucleic acid according to claim 9, characterized in that, The LAMP reagent in the nucleic acid rapid detection method is subjected to optimization treatment by using amplification primers with names F3, B3, FIP, BIP, LF and LB; Among them: The DNA sequence (5' to 3') of the F3 amplification primer is AAGACTTCATTGCGTGCC; The DNA sequence (5' to 3') of the B3 amplification primer is CCTTTACATCGTTAACTTGAGC; The DNA sequence (5' to 3') of the FIP amplification primer is TGAGTTGAAAAAGTGATTGCTTCAAATGATTTGAATTCTATTGGTAGTCG; The DNA sequence (5' to 3') of the BIP amplification primer is TATGGGATTTGGGATAACTAAGCTGTTGAATCAACTGAAGCAAATGG; The DNA sequence (5' to 3') of the LF amplification primer is CACATCTGTTAAGGCTTCTA; The DNA sequence (5' to 3') of the LB amplification primer is GTTATTCGCATTTTAGA; The reaction time for the optimization treatment of the LAMP reagent by the F3, B3, FIP, BIP, LF and LB amplification primers is 30min, and the reaction temperature is 63℃.