Compositions and methods for treating neurological disorders associated with glucosylceramidase beta1 deficiency

Abstract

The present disclosure relates to compositions and methods for altering, e.g., enhancing the expression of a GCase protein, in vitro and / or in vivo. Such compositions include delivery of adeno-associated virus (AAV) particles. The compositions and methods of the present disclosure may be used to treat a subject diagnosed with or suspected of having Parkinson's disease (PD), Gaucher Disease (GD), dementia with Lewy bodies (DLB), or a condition associated with a defect in the number and / or function of GBA1 gene products or associated with a reduction in the expression or protein level of GCase protein.

Description

Related Applications

[0001] This application claims the benefit of and priority to International Application No. PCT / US2023 / 061837, filed February 2, 2023, the contents of which are incorporated by reference in their entirety. SEQUENCE LISTING

[0002] The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. The Sequence Listing file name is 14640-0070-01304_SL.xml, created on January 31, 2024, and is 5,007,704 bytes in size. The information contained in the electronic format of the Sequence Listing is incorporated by reference herein in its entirety. TECHNICAL FIELD

[0003] Described herein are compositions and methods related to polynucleotides, such as polynucleotides encoding a glucosylceramidase beta 1 (GBA1) protein and peptides, for treating Parkinson Disease (PD) and other GBA-associated disorders, including Gaucher Disease and Dementia with Lewy Bodies (collectively “GBA-associated disorders”). In some embodiments, the compositions can be delivered in an adeno-associated virus (AAV) vector. In other embodiments, the compositions described herein can be used to treat a subject in need thereof, such as a human subject diagnosed with a GBA1 -associated disorder or other condition caused by a quantitative and / or functional deficiency in the GBA1 protein, or as a research tool for studying such diseases or conditions in a cellular or animal model of the disease or condition. BACKGROUND

[0004] Lysosomal acid glucosylceramidase, commonly referred to as glucocerebrosidase or Gcase, is a D-glucosyl-N-acylsphingoside glucosylhydrolase, a lysosomal membrane protein that plays an important role in glycolipid metabolism. The enzyme is encoded by the glucosylceramidase beta 1 (GBA1) gene (Ensembl Gene ID number: ENSG00000177628). This enzyme, along with Saposin A and Saposin C, catalyzes the hydrolysis of glucosylceramide to ceramide and glucose. See Vaccaro, Anna Maria, et al. Journal of Biological Chemistry 272.27 (1997): 16862-16867, the contents of which are incorporated by reference herein in their entirety.

[0005] GBA1 mutations are known to cause disease in human subjects. Homozygous or compound heterozygous GBA1 mutations cause Gaucher disease (“GD”). See Sardi, S. Pablo, Jesse M. Cedarbaum, and Patrik Brundin. Movement Disorders 33.5 (2018): 684-696, the contents of which are incorporated by reference in their entirety. Gaucher disease is one of the most common lysosomal storage diseases, with a standardized birth prevalence in the general population estimated to be between 0.4 and 5.8 per 100,000 individuals affected. Heterozygous GBA1 mutations can cause PD. In fact, GBA1 mutations occur in 7-10% of all PD patients, making GBA1 mutations the most important genetic risk factor for PD. PD-GBA1 patients have reduced levels of the lysosomal enzyme b-glucocerebrosidase (Gcase), leading to increased accumulation of the glycosphingolipid glucosylceramide (GluCer), which in turn is associated with exacerbation of a-synuclein aggregation and accompanying neurological symptoms. In some cases, Gaucher disease and PD, as well as other lysosomal storage diseases or Lewy body diseases (such as Lewy body dementia) and related diseases share a common etiology at the GBA1 gene. See Sidransky, E., and Lopez, G. Lancet Neurol. 2012 Nov; 11(11): 986-998, the contents of which are incorporated by reference in their entirety. For such diseases, there are limited treatment options.

[0006] Accordingly, there has long been a need to develop pharmaceutical compositions and methods for treating PD and other GBA1 -related disorders and to improve Gcase protein deficiency in patients suffering from GBA1 -related disorders. SUMMARY

[0007] The present disclosure addresses such challenges by providing AAV-based compositions and methods for treating Gcase deficiency in patients. Disclosed herein are compositions and methods for AAV-based gene delivery of Gcase to improve loss of function and improve intracellular lipid trafficking. The compositions and methods are useful for improving lysosomal glycolipid metabolism in subjects, e.g., subjects having GBA1 gene mutations, e.g., subjects having GBA1 gene mutations, and slowing, halting, or reversing neurodegenerative and other symptoms of PD and other GBA1 -related disorders, e.g., Lewy body dementia (DLB), Gaucher disease (GD), in subjects, e.g., subjects having GBA1 gene mutations, e.g., subjects having GBA1 gene mutations. Unless otherwise specified, GBA1 protein, GBA1 protein, and Gcase protein are synonymous terms and are used interchangeably to refer to the protein encoded by the GBA1 gene.

[0008] In some embodiments, the disclosure provides a nucleotide sequence encoding a wild-type GBA1 protein, wherein the nucleotide sequence encoding GBA1 comprises an altered GC content and / or a reduced number of CpG motifs (e.g., lacks all CpG motifs) compared to a wild-type GBA1 coding sequence (e.g., comprising the nucleotide sequence of SEQ ID NO: 1776 or 1777). In some embodiments, the nucleotide sequence encoding GBA1 surprisingly provides high GBA1 expression in the brain (e.g., cortex, striatum, and brainstem), high GBA1 activity in the brain (e.g., high clearance of glucosylceramide and glucosylsphingosine substrates), and reduced immunogenicity, e.g., compared to a wild-type GBA1 coding sequence (e.g., comprising the nucleotide sequence of SEQ ID NO: 1776 or 1777). In some embodiments, the nucleotide sequence encoding GBA1 described herein surprisingly provides reduced GBA1 expression in dorsal root ganglia (DRG) while retaining high GBA1 activity in other regions of the brain (e.g., brainstem), e.g., relative to a wild-type GBA1 coding sequence (e.g., comprising the nucleotide sequence of SEQ ID NO: 1776 or 1777). In some embodiments, a nucleotide sequence encoding a wild-type GBA1 protein described herein can be administered to a subject having a GBA1 -related disorder, such as Parkinson’s disease.

[0009] In some embodiments, the nucleotide sequence encoding GBA1 comprises SEQ ID NO: 2001 or a sequence at least 94% (e.g., at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the nucleotide sequence encoding GBA1 comprises SEQ ID NO: 2002 or a sequence at least 93% (e.g., at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.

[0010] In some embodiments, the nucleotide sequence encoding GBA1 is comprised in an AAV viral genome comprising the nucleotide sequence of SEQ ID NO: 2006 or SEQ ID NO: 2007, or a sequence at least 97% (e.g., at least 97%, at least 98%, or at least 99%) identical thereto.

[0011] In some embodiments, the nucleotide sequence encoding GBA1 (e.g., SEQ ID NO: 2001 or SEQ ID NO: 2002, or a sequence at least 94% (e.g., at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto) comprises a lower GC content than the nucleotide sequence of SEQ ID NO: 1772, 1773, 1780, or 1781.

[0012] In some embodiments, administering to a subject a nucleotide sequence encoding GBA1 (e.g., a sequence comprising the nucleotide sequence of SEQ ID NO: 2001 or SEQ ID NO: 2002, or a sequence at least 94% (e.g., at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto) results in higher GBA1 activity in the brain of the subject, e.g., a higher degree of reduction of glucosylceramide and glucosylsphingosine substrates, compared to administering a sequence comprising the nucleotide sequence of SEQ ID NO: 1772 or 1773.

[0013] In some embodiments, administering to a subject an AAV particle comprising a nucleotide sequence encoding GBA1 (e.g., a nucleotide sequence comprising the nucleotide sequence of SEQ ID NO: 2007, or a sequence at least 97% (e.g., at least 97%, at least 98%, or at least 99%) identical thereto) results in reduced GBA1 expression in the DRG compared to administering a sequence comprising the nucleotide sequence of SEQ ID NO: 1772 or 1773, without a significant reduction in GBA1 activity in other brain regions (e.g., the brainstem) compared to administering a sequence comprising the nucleotide sequence of SEQ ID NO: 1772 or 1773.

[0014] In some embodiments, the disclosure provides an isolated nucleic acid comprising a transgene encoding a GBA1 protein, wherein the nucleotide sequence encoding the GBA1 protein comprises a codon-optimized nucleotide sequence that is at least 93% identical (e.g., at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the nucleotide sequence of SEQ ID NO: 2002. In some embodiments, the nucleotide sequence encoding the GBA1 protein comprises the nucleotide sequence of SEQ ID NO: 2002. In some embodiments, the isolated nucleic acid is a viral genome or is comprised in a viral genome.

[0015] In some embodiments, the disclosure provides an isolated nucleic acid comprising a nucleotide sequence encoding a beta-glucocerebrosidase 1 (GBA1) protein that is at least 93% identical (e.g., at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the nucleotide sequence of SEQ ID NO: 2002. In some embodiments, the isolated nucleic acid encoding the GBA1 protein comprises the nucleotide sequence of SEQ ID NO: 2002. In some embodiments, the isolated nucleic acid is a viral genome or is comprised in a viral genome.

[0016] In some embodiments, the disclosure provides an isolated nucleic acid comprising a transgene encoding a GBA1 protein, wherein the nucleotide sequence encoding the GBA1 protein comprises a codon-optimized nucleotide sequence that is at least 94% identical (e.g., at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the nucleotide sequence of SEQ ID NO: 2001. In some embodiments, the nucleotide sequence encoding the GBA1 protein comprises the nucleotide sequence of SEQ ID NO: 2001. In some embodiments, the nucleotide sequence encoding the GBA1 protein consists of the nucleotide sequence of SEQ ID NO: 2001. In some embodiments, the isolated nucleic acid is a viral genome or is comprised in a viral genome.

[0017] In some embodiments, the disclosure provides an isolated nucleic acid comprising a nucleotide sequence encoding a beta-glucocerebrosidase 1 (GBA1) protein that is at least 94% identical (e.g., at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the nucleotide sequence of SEQ ID NO: 2001. In some embodiments, the isolated nucleic acid encoding the GBA1 protein comprises the nucleotide sequence of SEQ ID NO: 2001. In some embodiments, the isolated nucleic acid encoding the GBA1 protein consists of the nucleotide sequence of SEQ ID NO: 2001. In some embodiments, the isolated nucleic acid is a viral genome or is comprised in a viral genome.

[0018] In some embodiments, the disclosure provides an isolated nucleic acid comprising a transgene encoding a GBA1 protein and an enhancement element, wherein the encoded enhancement element comprises: a sphingolipid activator protein C polypeptide or a functional fragment or variant thereof, optionally comprising the amino acid sequence of SEQ ID NO: 1789 or 1758 or an amino acid sequence at least 85% identical thereto (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical); a cell penetrating peptide, optionally comprising the amino acid sequence of any one of SEQ ID Nos: 1794, 1796, or 1798 or an amino acid sequence having at least one, two, or three but not more than four modifications (e.g., substitutions (e.g., conservative substitutions)) relative to SEQ ID Nos: 1794, 1796, or 1798; and / or a lysosomal targeting sequence, optionally comprising the amino acid sequence of any one of SEQ ID Nos: 1800, 1802, 1804, 1806, or 1808 or an amino acid sequence having at least one, two, or three but not more than four modifications (e.g., substitutions (e.g., conservative substitutions)) relative to SEQ ID Nos: 1800, 1802, 1804, 1806, or 1808. In some embodiments, the isolated nucleic acid is a viral genome or is comprised in a viral genome.

[0019] In some embodiments, the disclosure provides a recombinant viral genome comprising a nucleic acid comprising a transgene encoding a GBA1 protein, and further comprising a nucleotide sequence encoding a miR binding site that modulates (e.g., reduces) expression of the encoded GBA1 protein in cells or tissues of the DRG, liver, hematopoietic lineage, or a combination thereof. In some embodiments, the encoded miR binding site comprises a miR183 binding site. In some embodiments, the viral genome encodes multiple miR binding sites, e.g., four miR183 binding sites. In some embodiments, the viral genome further encodes an enhancement element, e.g., an enhancement element described herein.

[0020] In some embodiments, the disclosure provides a recombinant viral genome comprising a promoter operably linked to a nucleic acid comprising a transgene encoding a GBA1 protein described herein. In some embodiments, the viral genome comprises an internal terminal repeat (ITR) sequence (e.g., an ITR region described herein), an enhancer (e.g., an enhancer described herein), an intron region (e.g., an intron region described herein), a Kozak sequence (e.g., a Kozak sequence described herein), an exon region (e.g., an exon region described herein), a nucleotide sequence encoding a miR binding site (e.g., a miR binding site described herein), and / or a poly A signal region (e.g., a poly A signal sequence described herein). In some embodiments, the viral genome comprises the nucleotide sequence of SEQ ID NO: 2006 or 2007, or a nucleotide sequence that is at least 97% identical thereto (e.g., at least 97%, at least 98%, or 99% identical thereto). In some embodiments, the viral genome comprises the nucleotide sequence of SEQ ID NO: 2006, or a nucleotide sequence that is at least 97% identical thereto (e.g., at least 97%, at least 98%, or 99% identical thereto). In some embodiments, the viral genome comprises the nucleotide sequence of SEQ ID NO: 2007, or a nucleotide sequence that is at least 97% identical thereto (e.g., at least 97%, at least 98%, or 99% identical thereto).

[0021] In some embodiments, the disclosure provides a recombinant AAV particle comprising a capsid protein and a viral genome comprising a promoter operably linked to a transgene encoding a GBA1 protein described herein (e.g., a promoter described herein). In some embodiments, the capsid protein comprises an AAV capsid protein. In some embodiments, the capsid protein comprises a VOY101 capsid protein, an AAV5 capsid protein, an AAV9 capsid protein, or a functional variant thereof. In some embodiments, the recombinant AAV particle is an isolated AAV particle.

[0022] In some embodiments, the disclosure provides a method of making a viral genome described herein. In some embodiments, the method of making a viral genome comprises providing a nucleic acid encoding a viral genome described herein and a backbone region suitable for replication of the viral genome in a cell (e.g., a bacterial cell) (e.g., wherein the backbone region comprises one or both of a bacterial origin of replication and an optional marker), and excising the virus from the backbone region, e.g., by cleaving the nucleic acid molecule upstream and downstream of the viral genome.

[0023] In some embodiments, the disclosure provides a method of manufacturing a recombinant AAV particle. In some embodiments, the method of manufacturing a recombinant AAV particle comprises providing a host cell comprising a viral genome described herein and incubating the host cell under conditions suitable for encapsidation of the viral genome in an AAV particle (e.g., a VOY101 capsid protein), thereby producing an isolated AAV particle.

[0024] In some embodiments, the disclosure provides a method of delivering a nucleic acid encoding a GBA1 protein to a subject, the method comprising administering an effective amount of an AAV particle or plurality of AAV particles described herein, the AAV particle comprising a viral genome described herein, e.g., a viral genome comprising a nucleic acid comprising a transgene encoding a GBA1 protein described herein.

[0025] In some embodiments, the disclosure provides a method of treating a subject having or diagnosed with a disease, neurological disorder, or neuromuscular disorder associated with GBA1 expression. In some embodiments, the method comprises administering an effective amount of an AAV particle or plurality of AAV particles described herein, the AAV particle comprising a viral genome described herein, e.g., a viral genome comprising a nucleic acid comprising a transgene encoding a GBA1 protein described herein. In some embodiments, the disease or neurodegenerative disorder or neuromuscular disorder associated with GBA1 expression comprises Parkinson’s disease (PD) (e.g., PD associated with one or more mutations in the GBA1 gene), dementia with Lewy bodies (DLB), Gaucher disease (GD) (e.g., GD type 1 (GD1) or GD type 3 (GD3)), spinal muscular atrophy (SMA), multiple system atrophy (MSA), or multiple sclerosis (MS).

[0026] In some embodiments, the disclosure provides an AAV viral genome comprising at least one inverted terminal repeat sequence (ITR) and a payload region, wherein the payload region encodes one or more GBA1 proteins. In some embodiments, the AAV viral genome comprises a 5’ ITR, a promoter, a payload region comprising a nucleotide sequence encoding a GBA1 protein, and a 3’ ITR. The encoded protein can be a human (Homo sapiens) GBA1, a cynomolgus monkey (Macaca fascicularis) GBA1, or a rhesus monkey (Macaca mulatto) GBA1, a synthetic (non-naturally occurring) GBA1, or a derivative thereof, e.g., a variant that retains one or more functions of a wild-type GBA1 protein. In some embodiments, the GBA1 can be at least partially humanized. In some embodiments, the encoded protein is a wild-type human GBA1 protein.

[0027] The GCase of the present disclosure can be co-expressed with a sphingolipid activator protein. In some embodiments, the transgene encoding GCase includes a nucleotide sequence encoding a sphingolipid activator protein. In some embodiments, the sphingolipid activator protein is sphingolipid activator protein A (SapA). In some embodiments, the sphingolipid activator protein is sphingolipid activator protein C (Sap C).

[0028] The viral genome can be incorporated into an AAV particle, wherein the AAV particle comprises the viral genome and a capsid. In some embodiments, the capsid comprises a sequence as shown in Table 1.

[0029] In some embodiments, the AAV particles described herein can be used in a pharmaceutical composition. The pharmaceutical composition can be used to treat a disorder or condition associated with reduced GBA1 expression, activity, or protein levels. In some embodiments, the disorder or condition is a lysosomal lipid storage disease. In some embodiments, the disorder or condition associated with reduced GBA1 protein levels is PD (e.g., PD associated with one or more mutations in the GBA1 gene), Gaucher disease (e.g., type 1 GD (e.g., non-neuropathic GD (GD1)), type 2 (e.g., acute neuropathic GD (GD2)), or type 3 GD (GD3)), or other GBA1 -associated disorder (e.g., Lewy body dementia (DLB)). In some embodiments, the disorder or condition associated with reduced GBA1 protein levels is PD. In some embodiments, the disorder or condition associated with reduced GBA1 protein levels is GD. In some embodiments, the GD is GD1 or GD3. In some embodiments, the disorder or condition associated with reduced GBA1 protein levels is DLB.

[0030] In some embodiments, administration of the AAV particle results in enhanced GBA1 expression in the target cells.

[0031] In some aspects, the present disclosure provides methods for increasing GCase enzyme activity in a patient using AAV-mediated gene transfer of an optimized GBA1 transgene cassette. AAV-mediated gene transfer can be delivered to the CNS and thereby reduce substrate glycosphingolipid glucosylceramide / GluCer levels and alpha-synuclein pathology, slowing or reversing disease pathogenesis in patients with GBA1 -associated disorders, including GBA1 -PD, Gaucher disease (e.g., type 2 or 3 GD), and Lewy body dementia. In some embodiments, such methods involve intrastriatal (ISTR) or intracistema magna (ICM) administration of an AAV vector encapsidating an optimized GBA1 gene replacement transgene cassette described herein to achieve widespread, cell-autonomous transduction and cross-correction of therapeutic GBA1 enzyme.

[0032] One skilled in the art will recognize or be able to ascertain using no more than routine experimentation many equivalents of the specific embodiments of the application described herein. Such equivalents are intended to be encompassed by the following listed embodiments. Listed Embodiments 1. An isolated nucleic acid encoding a β-glucocerebrosidase 1 (GBAl) protein and at least 93% identical (e.g., 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to the nucleotide sequence of SEQ ID NO: 2002. 2. The isolated nucleic acid of embodiment 1, wherein the nucleotide sequence encoding the GBAl protein comprises a nucleotide sequence that is at least 93% identical to SEQ ID NO: 2002. 3. The isolated nucleic acid of embodiment 1 or 2, wherein the nucleotide sequence encoding the GBAl protein comprises a nucleotide sequence that is at least 95% identical to SEQ ID NO: 2002. 4. The isolated nucleic acid of any one of embodiments 1-3, wherein the nucleotide sequence encoding the GBAl protein comprises the nucleotide sequence of SEQ ID NO: 2002. 5. The isolated nucleic acid of any one of embodiments 1-4, further comprising a potentiation element. 6. An isolated nucleic acid, e.g., a recombinant nucleic acid, comprising a transgene encoding a β-glucocerebrosidase 1 (GBAl) protein and a potentiation element, wherein the encoded potentiation element comprises: (a) a sphingolipid-activating protein C polypeptide or a functional fragment or variant thereof, optionally comprising the amino acid sequence of SEQ ID NO: 1789 or 1758 or an amino acid sequence that is at least 85% (e.g., at least 90%, 92%, 95%, 97%, 98%, or 99%) identical thereto; (b) a cell-penetrating peptide, optionally comprising the amino acid sequence of any one of SEQ ID NOs: 1794, 1796, or 1798 or an amino acid sequence having at least one, two, or three but not more than four modifications (e.g., substitutions (e.g., conservative substitutions)) relative to SEQ ID NOs: 1794, 1796, or 1798; and / or (c) a lysosomal targeting sequence, optionally comprising the amino acid sequence of any one of SEQ ID NOs: 1800, 1802, 1804, 1806, or 1808 or an amino acid sequence having at least one, two, or three but not more than four modifications (e.g., substitutions (e.g., conservative substitutions)) relative to SEQ ID NOs: 1800, 1802, 1804, 1806, or 1808. 7. A recombinant viral genome comprising a nucleic acid encoding a b- glucocerebrosidase 1 (GBAl) protein, further comprising a nucleotide sequence encoding an miR binding site that modulates (e.g., reduces) expression of the encoded GBAl protein in cells or tissues of the DRG, liver, hematopoietic lineage, or a combination thereof; wherein optionally, the recombinant viral genome comprises a nucleic acid of any one of embodiments 1-6. 8. The viral genome of embodiment 7, wherein the nucleic acid further encodes a potentiation element. 9. The isolated nucleic acid of embodiment 5 or 6, or the viral genome of embodiment 8, wherein the encoded potentiation element comprises a sphingolipid activator protein C polypeptide or a functional fragment or variant thereof. 10. The isolated nucleic acid of embodiments 5-6 or 9, or the viral genome of embodiments 8 or 9, wherein: (i) the encoded sphingolipid activator protein C polypeptide or functional fragment or variant thereof comprises an amino acid sequence of SEQ ID NO: 1789 or 1758, or an amino acid sequence that is at least 85% (e.g., at least 90%, 92%, 95%, 97%, 98%, or 99%) identical thereto; and / or (ii) the nucleotide sequence encoding the encoded sphingolipid activator protein C polypeptide or functional fragment or variant thereof comprises a nucleotide sequence of SEQ ID NO: 1787 or 1791, or a nucleotide sequence that is at least 85% (e.g., at least 90%, 92%, 95%, 97%, 98%, or 99%) identical thereto. 11. The isolated nucleic acid of embodiment 5, or the viral genome of embodiment 8, wherein: (i) the encoded potentiation element comprises an amino acid sequence of any one of SEQ ID NOs: 1750, 1752, 1754, 1756-1758, 1784, or 1785, an amino acid sequence having at least one, two, or three but not more than four modifications (e.g., substitutions (e.g., conservative substitutions)) relative to SEQ ID NOs: 1750, 1752, 1754, 1756-1758, 1784, or 1785, or an amino acid sequence that is at least 85% (e.g., at least 90%, 92%, 95%, 97%, 98%, or 99%) identical thereto; and / or (ii) the nucleotide sequence encoding the potentiation element comprises a nucleotide sequence of any one of SEQ ID NOs: 1751, 1753, 1755, 1858, or 1859, or a nucleotide sequence that is at least 85% (e.g., at least 90%, 92%, 95%, 97%, 98%, or 99%) identical thereto. 12. The isolated nucleic acid of any one of embodiments 5-6 or 9-11 or the viral genome of embodiments 8-11, wherein the encoded potentiating element comprises a cell-penetrating peptide. 13. The isolated nucleic acid of embodiments 6 or 12 or the viral genome of embodiment 12, wherein: (i) the cell-penetrating peptide comprises the amino acid sequence of any one of SEQ ID NOs: 1794, 1796, or 1798 or an amino acid sequence having at least one, two or three but not more than four modifications (e.g., substitutions (e.g., conservative substitutions)) relative to SEQ ID NOs: 1794, 1796, or 1798; (ii) the nucleotide sequence encoding the cell-penetrating peptide comprises the nucleotide sequence of any one of SEQ ID NOs: 1793, 1795, or 1797 or a nucleotide sequence that is at least 80% (e.g., 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99%) identical thereto. 14. The isolated nucleic acid of any one of embodiments 5-6 or 9-13 or the viral genome of any one of embodiments 8-13, wherein the encoded potentiating element comprises a lysosomal targeting sequence. 15. The isolated nucleic acid of embodiments 6 or 14 or the viral genome of any one of embodiments 14, wherein: (i) the encoded lysosomal targeting sequence comprises the amino acid sequence of any one of SEQ ID NOs: 1800, 1802, 1804, 1806, or 1808 or an amino acid sequence having at least one, two or three but not more than four modifications (e.g., substitutions (e.g., conservative substitutions)) relative to SEQ ID NOs: 1800, 1802, 1804, 1806, or 1808; (ii) the nucleotide sequence encoding the lysosomal targeting sequence comprises the nucleotide sequence of any one of SEQ ID NOs: 1799, 1801, 1803, 1805, or 1807 or a nucleotide sequence having at least one, two or three but not more than four modifications (e.g., substitutions (e.g., conservative substitutions)) relative to SEQ ID NOs: 1799, 1801, 1803, 1805, or 1807. 16. The isolated nucleic acid of any one of embodiments 5-6 or 9-15 or the viral genome of any one of embodiments 8-15, wherein the nucleic acid encodes at least 2, 3, 4, or more potentiating elements. 17. The isolated nucleic acid of any one of embodiments 5-6 or 9-16 or the viral genome of any one of embodiments 8-16, wherein the nucleic acid encodes two potentiating elements, wherein: (i) the first potentiation element comprises a lysosomal targeting sequence, optionally wherein the lysosomal targeting sequence comprises the amino acid sequence of SEQ ID NO: 1802 or an amino acid sequence having at least one, two or three but not more than four modifications (e.g., substitutions (e.g., conservative substitutions)) relative to SEQ ID NO: 1802; and (ii) the second potentiation element comprises a sphingolipid-activator protein C polypeptide or functional fragment or variant thereof, optionally wherein the sphingolipid-activator protein C polypeptide or functional fragment or variant thereof comprises the amino acid sequence of SEQ ID NO: 1789 or an amino acid sequence having at least one, two or three but not more than four modifications (e.g., substitutions (e.g., conservative substitutions)) relative to SEQ ID NO: 1789. 18. The isolated nucleic acid or viral genome of embodiment 17, wherein the nucleic acid encoding the first potentiation element and the second potentiation element comprises the nucleotide sequence of SEQ ID NOs: 1801 and 1787, a nucleotide sequence that is at least 85% (e.g., at least 90%, 92%, 95%, 97%, 98%, or 99%) identical to SEQ ID NOs: 1801 and 1787, or a nucleotide sequence having at least one, two or three but not more than four modifications (e.g., substitutions (e.g., conservative substitutions)) relative to SEQ ID NOs: 1801 and 1787. 19. The isolated nucleic acid of any one of embodiments 5-6 or 9-17 or the viral genome of any one of embodiments 8-18, wherein the nucleic acid encodes a first potentiation element and a second potentiation element, wherein: (i) the first potentiation element comprises a cell-penetrating peptide, optionally wherein the cell-penetrating peptide comprises the amino acid sequence of SEQ ID NO: 1798 or an amino acid sequence having at least one, two or three but not more than four modifications (e.g., substitutions (e.g., conservative substitutions)) relative to SEQ ID NO: 1798; and (ii) the second potentiation element comprises a lysosomal targeting sequence, optionally wherein the lysosomal targeting sequence comprises the amino acid sequence of SEQ ID NO: 1802 or an amino acid sequence having at least one, two or three but not more than four modifications (e.g., substitutions (e.g., conservative substitutions)) relative to SEQ ID NO: 1802. 20. The isolated nucleic acid or viral genome of embodiment 19, wherein the nucleic acid encoding the first and second potentiation elements comprises the nucleotide sequence of SEQ ID NOs: 1797 and 1801, a nucleotide sequence that is at least 85% (e.g., at least 90%, 92%, 95%, 97%, 98%, or 99%) identical to SEQ ID NOs: 1797 and 1801, or a nucleotide sequence that has at least one, two or three but not more than four modifications (e.g., substitutions (e.g., conservative substitutions)) relative to SEQ ID NOs: 1797 and 1801. 21. The isolated nucleic acid of any one of embodiments 5-6 or 9-20 or the viral genome of any one of embodiments 8-20, wherein the nucleic acid encodes a first, second, and third potentiation element, wherein: (i) the first potentiation element comprises a lysosomal targeting sequence, optionally wherein the lysosomal targeting sequence comprises the amino acid sequence of SEQ ID NO: 1802 or an amino acid sequence that has at least one, two or three but not more than four modifications (e.g., substitutions (e.g., conservative substitutions)) relative to SEQ ID NO: 1802; (ii) the second potentiation element comprises a cell penetrating peptide, optionally wherein the cell penetrating peptide comprises the amino acid sequence of SEQ ID NO: 1798 or an amino acid sequence that has at least one, two or three but not more than four modifications (e.g., substitutions (e.g., conservative substitutions)) relative to SEQ ID NO: 1798; and (iii) the third potentiation element comprises a sphingolipid-activated protein C polypeptide or functional fragment or variant thereof, optionally wherein the sphingolipid-activated protein C polypeptide or functional fragment or variant thereof comprises the amino acid sequence of SEQ ID NO: 1789 or an amino acid sequence that has at least one, two or three but not more than four modifications (e.g., substitutions (e.g., conservative substitutions)) relative to SEQ ID NO: 1789. 22. The isolated nucleic acid or viral genome of embodiment 21, wherein the nucleic acid encoding the first, second, and third potentiation elements comprises the nucleotide sequence of SEQ ID NOs: 1801, 1797, and 1787, a nucleotide sequence that is at least 85% (e.g., at least 90%, 92%, 95%, 97%, 98%, or 99%) identical to SEQ ID NOs: 1801, 1797, and 1787, or a nucleotide sequence that has at least one, two or three but not more than four modifications (e.g., substitutions (e.g., conservative substitutions)) relative to SEQ ID NOs: 1801, 1797, and 1787. 23. The isolated nucleic acid of any one of embodiments 1 to 6 or 9 to 22 or the viral genome of any one of embodiments 7 to 22, wherein the nucleic acid further encodes a linker. 24. The isolated nucleic acid of any one of embodiments 5 to 6 or 9 to 22 or the viral genome of any one of embodiments 8 to 22, wherein the encoded potentiation element and the encoded GBA1 protein are directly connected, e.g., in the absence of a linker. 25. The isolated nucleic acid of any one of embodiments 5 to 6 or 9 to 23 or the viral genome of any one of embodiments 8 to 23, wherein the encoded potentiation element and the encoded GBA1 protein are connected via the encoded linker. 26. The isolated nucleic acid or viral genome of embodiments 23 or 25, wherein: (i) the encoded linker comprises the amino acid sequence of any one of SEQ ID NOs: 1854, 1855, 1843, or 1845 or an amino acid sequence having at least one, two, or three but not more than four modifications (e.g., substitutions (e.g., conservative substitutions)) relative to SEQ ID NOs: 1854, 1855, 1843, or 1845; (ii) the nucleotide sequence encoding the linker comprises the nucleotide sequence of any one of SEQ ID NOs: 1724, 1726, 1729, or 1730 or a nucleotide sequence having at least one, two, or three but not more than four modifications (e.g., substitutions (e.g., conservative substitutions)) relative to SEQ ID NOs: 1724, 1726, 1729, or 1730; (iii) the encoded linker comprises a furin cleavage site; (iv) the encoded linker comprises a T2A polypeptide; (v) the encoded linker comprises a (Gly4Ser)n linker (SEQ ID NO: 1871), wherein n is 1 to 10, e.g., n is 3, 4, or 5; and / or (vi) the encoded linker comprises a (Gly4Ser)3 linker (SEQ ID NO: 1845). 27. The isolated nucleic acid or viral genome of embodiments 23 or 25 to 26, wherein: (i) the encoded linker comprises the amino acid sequence of SEQ ID NO: 1854 and / or the amino acid sequence of SEQ ID NO: 1855 or an amino acid sequence having at least one, two, or three but not more than four modifications (e.g., substitutions (e.g., conservative substitutions)) relative to SEQ ID NO: 1854 and / or 1855; and / or (ii) the nucleotide sequence encoding the linker comprises the nucleotide sequence of SEQ ID NO: 1724 and / or the nucleotide sequence of SEQ ID NO: 1726 or a nucleotide sequence having at least one, two or three but not more than four modifications (e.g. substitutions (e.g. conservative substitutions)) with respect to SEQ ID NO: 1724 and / or 1726. 28. The isolated nucleic acid of any one of embodiments 23 or 25 to 27 or the viral genome of any one of embodiments 23 or 25 to 26, wherein: (i) the encoded linker comprises the amino acid sequence of SEQ ID NO: 1845 or an amino acid sequence having at least one, two or three but not more than four modifications (e.g. substitutions) with respect to SEQ ID NO: 1845; (ii) the nucleotide sequence encoding the linker comprises the nucleotide sequence of SEQ ID NO: 1730 or a nucleotide sequence having at least one, two or three but not more than four modifications (e.g. substitutions) with respect to SEQ ID NO: 1730. 29. The isolated nucleic acid of any one of embodiments 5 to 6 or 9 to 28 or the viral genome of any one of embodiments 8 to 28, wherein the encoded GBA1 protein and the encoded booster element are expressed as a single polypeptide. 30. The isolated nucleic acid of any one of embodiments 5 to 6 or 9 to 28 or the viral genome of any one of embodiments 8 to 28, wherein the single polypeptide comprises a cleavage site present between the encoded GBA1 protein and the encoded booster element, optionally wherein the cleavage site is a T2A and / or furin cleavage site. 31. The isolated nucleic acid of any one of embodiments 5 to 6 or 9 to 30 or the viral genome of any one of embodiments 8 to 30, wherein: (i) the nucleotide sequence encoding the booster element is 5’ of the nucleotide sequence encoding the GBA1 protein; and / or (ii) the nucleotide sequence encoding the booster element is 3’ of the nucleotide sequence encoding the GBA1 protein. 32. The isolated nucleic acid of any one of embodiments 1 to 6 or 9 to 31 or the viral genome of any one of embodiments 7 to 31, wherein the encoded GBA1 protein comprises the amino acid sequence of SEQ ID NO: 1775 or an amino acid sequence at least 70% (e.g. at least 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98% or 99%) identical thereto. 33. The isolated nucleic acid of any one of embodiments 6 or 9 to 32 or the viral genome of any one of embodiments 7 to 32, wherein the nucleotide sequence encoding the GBA1 protein comprises the nucleotide sequence of SEQ ID NO: 2002 or a nucleotide sequence that is at least 93% (e.g., at least 94%, 95%, 96%, 97%, 98%, or 99%) identical thereto. 34. The isolated nucleic acid of any one of embodiments 1 to 6 or 9 to 33 or the viral genome of any one of embodiments 7 to 33, wherein the nucleotide sequence encoding the GBA1 protein comprises the nucleotide sequence of SEQ ID NO: 2002. 35. The isolated nucleic acid of any one of embodiments 1 to 6 or 9 to 34 or the viral genome of any one of embodiments 7 to 37, further encoding a signal sequence comprising any one of SEQ ID NOs: 1850-1853, 1856, 1857, or 2005. 36. The isolated nucleic acid or viral genome of embodiment 35, wherein the encoded signal sequence comprises the amino acid sequence of SEQ ID NO: 2005. 37. The isolated nucleic acid or viral genome of any one of embodiments 35 or 36, wherein the nucleotide sequence encoding the signal sequence is located: (i) 5’ of the nucleotide sequence encoding the GBA1 protein; and / or (ii) 5’ of the encoded potentiation element. 38. The isolated nucleic acid or viral genome of embodiment 35 or 36, wherein the nucleotide sequence encoding the GBA1 protein comprises the nucleotide sequence of SEQ ID NO: 2001 or a nucleotide sequence that is at least 97% identical (e.g., 97%, 98%, 99%, or 100% identical) thereto. 39. The isolated nucleic acid or viral genome of embodiment 38, wherein the nucleotide sequence encoding the GBA1 protein comprises the nucleotide sequence of SEQ ID NO: 2001. 40. The isolated nucleic acid or viral genome of embodiment 38 or embodiment 39, wherein the nucleotide sequence encoding the GBA1 protein consists of the nucleotide sequence of SEQ ID NO: 2001. 39. An isolated nucleic acid or viral genome comprising a nucleotide sequence encoding a β-glucocerebrosidase 1 (GBA1) protein, wherein the nucleotide sequence encoding GBA1 comprises a nucleotide sequence encoding a signal sequence comprising the nucleotide sequence of SEQ ID NO: 2005 or a nucleotide sequence that is at least 85% (e.g., 85%, 88%, 90%, 92%, 95%, 96%, 97%, 98%, 99%, or 100%) identical thereto; and a nucleotide sequence encoding a GBA1 protein comprising the nucleotide sequence of SEQ ID NO: 2002 or a nucleotide sequence that is at least 93% (e.g., 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identical thereto. 40. The isolated nucleic acid or viral genome of embodiment 39, wherein the nucleotide sequence encoding the signal sequence comprises the nucleotide sequence of SEQ ID NO: 2005 or a nucleotide sequence that is at least 99% identical thereto. 41. An isolated nucleic acid or viral genome comprising a nucleotide sequence of SEQ ID NO: 2001 or a nucleotide sequence that is at least 94% (e.g., 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identical thereto, wherein the nucleotide sequence encodes a β-glucocerebrosidase 1 (GBA1) protein. 42. The isolated nucleic acid or viral genome of embodiment 41, wherein the nucleotide sequence encoding the GBA1 protein comprises or consists of the nucleotide sequence of SEQ ID NO: 2001. 43. An isolated viral genome, e.g., a recombinant viral genome, comprising a promoter operably linked to the nucleic acid of any one of embodiments 1-6 or 9-42. 44. The viral genome of any one of embodiments 7-43, further comprising a promoter operably linked to the nucleic acid encoding the GBA1 protein. 45. The viral genome of any one of embodiments 7-44, further comprising an enhancer. 46. The viral genome of embodiment 45, wherein the enhancer comprises a CMVie enhancer. 47. The viral genome of embodiment 45 or 46, wherein the enhancer comprises the nucleotide sequence of SEQ ID NO: 1831 or a nucleotide sequence that is at least 95% identical thereto. 48. The viral genome of any one of embodiments 43-47, wherein the promoter comprises a tissue-specific promoter. 49. The viral genome of any one of embodiments 43-47, wherein the promoter comprises a ubiquitous promoter. 50. The viral genome of any one of embodiments 43-49, wherein the promoter comprises: (i) an EF-1a promoter, a chicken beta-actin (CBA) promoter and / or a derivative thereof CAG, a CMV immediate early enhancer and / or promoter, a beta glucuronidase (GUSB) promoter, a ubiquitin C (UBC) promoter, a neuron-specific enolase (NSE), a platelet-derived growth factor (PDGF) promoter, a platelet-derived growth factor B chain (PDGF-beta) promoter, an intercellular adhesion molecule 2 (ICAM-2) promoter, a synapsin (Syn) promoter, a methyl-CpG binding protein 2 (MeCP2) promoter, a Ca2+ / calmodulin-dependent protein kinase II (CaMKII) promoter, a metabotropic glutamate receptor 2 (mGluR2) promoter, a neurofilament light chain (NFL) or heavy chain (NFH) promoter, a beta-globin minigene nB2 promoter, a preproenkephalin (PPE) promoter, an enkephalin (Enk) and excitatory amino acid transporter 2 (EAAT2), a glial fibrillary acidic protein (GFAP) promoter, a myelin basic protein (MBP) promoter, a cardiovascular promoter (e.g., aMHC, cTnT, and CMV-MLC2k), a liver promoter (e.g., hAAT, TBG), a skeletal muscle promoter (e.g., desmin, MCK, C512), or a fragment (e.g., a truncation) or functional variant thereof; and / or (ii) a nucleotide sequence of any one of SEQ ID NOs: 1832, 1833, 1834, 1835, 1836, 1839, 1840, or a nucleotide sequence that is at least 95% identical thereto. 51. The viral genome of any one of embodiments 43-47, wherein the promoter comprises a CB promoter or a functional variant thereof. 52. The viral genome of embodiment 51, wherein the CB promoter or functional variant thereof comprises a nucleotide sequence of SEQ ID NO: 1834, or a nucleotide sequence that is at least 95% identical thereto. 53. The viral genome of any one of embodiments 51 or 52, wherein the promoter comprises a CMVie enhancer and a CB promoter. 54. The viral genome of embodiment 53, wherein the CMVie enhancer comprises the nucleotide sequence of SEQ ID NO: 1831 or a nucleotide sequence at least 95% identical thereto, and the CB promoter comprises the nucleotide sequence of SEQ ID NO: 1834 or a nucleotide sequence at least 95% identical thereto. 55. The viral genome of embodiment 50, wherein the promoter comprises an EF-1a promoter or a functional variant thereof. 56. The viral genome of embodiment 55, wherein the EF-1a promoter or functional variant thereof comprises the nucleotide sequence of SEQ ID NO: 1839 or 1840 or a nucleotide sequence at least 95% identical thereto. 57. The viral genome of embodiment 55 or 56, wherein the EF-1a promoter or functional variant thereof comprises an intron, for example an intron comprising the nucleotide sequence of positions 242 to 1180 of SEQ ID NO: 1839 or an intron comprising the nucleotide sequence of SEQ ID NO: 1841 or a nucleotide sequence at least 95% identical thereto. 58. The viral genome of any one of embodiments 55 to 57, wherein the EF-1a promoter or functional variant thereof does not comprise an intron, for example an intron comprising the nucleotide sequence of positions 242 to 1180 of SEQ ID NO: 1839 or an intron comprising the nucleotide sequence of SEQ ID NO: 1841 or a nucleotide sequence at least 95% identical thereto. 59. The viral genome of embodiment 50, wherein the promoter comprises a CBA promoter or a functional variant thereof. 60. The viral genome of embodiment 59, wherein the CBA promoter functional variant comprises the nucleotide sequence of SEQ ID NO: 1836 or a nucleotide sequence at least 95% identical thereto. 61. The viral genome of any one of embodiments 43 to 47, wherein the promoter comprises a CMVie enhancer, a CBA promoter or a functional variant thereof and an intron. 62. The viral genome of embodiment 61, wherein: (i) the CMVie enhancer comprises the nucleotide sequence of SEQ ID NO: 1831 or a nucleotide sequence at least 95% identical thereto; (ii) the CBA promoter or functional variant thereof comprises the nucleotide sequence of SEQ ID NO: 1836 or a nucleotide sequence at least 95% identical thereto; and (iii) the intron comprises the nucleotide sequence of SEQ ID NO: 1837 or a nucleotide sequence at least 95% identical thereto. 63. The viral genome of embodiment 50, wherein the promoter comprises a CAG promoter region. 64. The viral genome of any one of embodiments 43-47 or 63, wherein the promoter comprises a CAG promoter region comprising: (i) a CMVie enhancer, a CBA promoter, or a functional variant thereof, and an intron; and / or (ii) the nucleotide sequence of SEQ ID NO: 1835, or a nucleotide sequence at least 95% identical thereto. 65. The viral genome of any one of embodiments 43-47, wherein the promoter comprises a CMV promoter, or a functional variant thereof. 66. The viral genome of embodiment 67, wherein the CMV promoter, or a functional variant thereof, comprises the nucleotide sequence of SEQ ID NO: 1832, or a nucleotide sequence at least 95% identical thereto. 67. The viral genome of any one of embodiments 43-47, wherein the promoter comprises a CMVie enhancer and a CMV promoter, or a functional variant thereof, optionally wherein the CMVie enhancer comprises the nucleotide sequence of SEQ ID NO: 1831, or a nucleotide sequence at least 95% identical thereto, and the CMV promoter, or a functional variant thereof, comprises the nucleotide sequence of SEQ ID NO: 1832, or a nucleotide sequence at least 95% identical thereto. 68. The viral genome of any one of embodiments 43-47, wherein the promoter comprises a CMV promoter region. 69. The viral genome of embodiment 68, wherein the CMV promoter region comprises: (i) a CMVie enhancer and a CMV promoter, or a functional variant thereof; (ii) the nucleotide sequence of SEQ ID NO: 1833, or a nucleotide sequence at least 95% identical thereto. 70. The viral genome of any one of embodiments 7-69, further comprising an inverted terminal repeat (ITR) sequence. 71. The viral genome of embodiment 70, wherein the ITR sequence is 5’ of the nucleic acid encoding the GBA1 protein. 72. The viral genome of embodiment 70 or 71, wherein the ITR sequence is 3’ of the nucleic acid encoding the GBA1 protein. 73. The viral genome of any one of embodiments 7-72, comprising an ITR 5’ of the nucleic acid encoding the GBA1 protein, and an ITR 3’ of the nucleic acid encoding the GBA1 protein. 74. The viral genome of any of embodiments 70-73, wherein the ITR comprises the nucleic acid sequence of SEQ ID NO: 1829, 1830, or 1862, or a nucleotide sequence that is at least 95% identical thereto. 75. The viral genome of any of embodiments 70-74, wherein the ITR comprises the nucleotide sequence of SEQ ID NO: 1860 and / or 1861, or a nucleotide sequence having at least one, two, or three modifications, but not more than four modifications, of SEQ ID NO: 1860 and / or 1861. 76. The viral genome of any of embodiments 70-75, wherein the ITR is 5’ to the nucleic acid encoding the GBA1 protein and comprises the nucleotide sequence of SEQ ID NO: 1860 and / or 1861, or a nucleotide sequence having at least one, two, or three modifications, but not more than four modifications, of SEQ ID NO: 1860 or 1861. 77. The viral genome of any of embodiments 70-76, wherein the ITR is 3’ to the nucleic acid encoding the GBA1 protein and comprises the nucleotide sequence of SEQ ID NO: 1860 or 1861, or a nucleotide sequence having at least one, two, or three modifications, but not more than four modifications, of SEQ ID NO: 1860 and / or 1861. 78. The viral genome of any of embodiments 70-77, wherein: (i) the ITR 5’ to the nucleic acid encoding the GBA1 protein comprises the nucleotide sequence of SEQ ID NO: 1829, or a nucleotide sequence that is at least 95% identical thereto; and / or (ii) the ITR 3’ to the nucleic acid encoding the GBA1 protein comprises the nucleotide sequence of SEQ ID NO: 1830, or a nucleotide sequence that is at least 95% identical thereto. 79. The viral genome of any of embodiments 7-78, further comprising a polyadenylation (polyA) signal region. 80. The viral genome of embodiment 79, wherein the polyA signal region comprises the nucleotide sequence of SEQ ID NO: 1846, or a nucleotide sequence that is at least 95% identical thereto. 81. The viral genome of any of embodiments 7-80, further comprising an intron region. 82. The viral genome of embodiment 81, wherein the intron comprises a beta-globin intron. 83. The viral genome of embodiment 81 or 82, wherein the intron comprises the nucleotide sequence of SEQ ID NO: 1842 or a nucleotide sequence at least 95% identical thereto. 84. The viral genome of any one of embodiments 7-83, further comprising an exon region, e.g., at least one, two, or three exon regions. 85. The viral genome of any one of embodiments 7-84, further comprising a Kozak sequence. 86. The viral genome of any one of embodiments 7-85, further comprising a nucleotide sequence encoding a miRNA (miR) binding site, e.g., a miR binding site that modulates, e.g., reduces, expression of a GBA1 protein encoded by the viral genome in a cell or tissue in which the corresponding miRNA is expressed. 87. The viral genome of embodiment 86, wherein the encoded miR binding site is fully or partially complementary to a miRNA expressed in a cell or tissue of the DRG, liver, hematopoietic, or a combination thereof. 88. The viral genome of embodiment 87, wherein the encoded miR binding site modulates, e.g., reduces, expression of the encoded GBA1 protein in a cell or tissue of the DRG, liver, hematopoietic lineage, or a combination thereof. 89. The viral genome of any one of embodiments 86-88, comprising at least 1, 2, 3, 4, or 5 copies of the nucleotide sequence encoding the miR binding site. 90. The viral genome of any one of embodiments 86-89, comprising at least 4 copies of the nucleotide sequence encoding the miR binding site, optionally wherein all four copies encode the same miR binding site. 91. The viral genome of embodiment 90, wherein the 4 copies of the nucleic acid encoding the miR binding site are contiguous. 92. The viral genome of embodiment 90, wherein the 4 copies of the nucleic acid encoding the miR binding site are separated by a spacer. 93. The viral genome of embodiment 92, wherein the spacer comprises the nucleotide sequence of SEQ ID NO: 1848 or a nucleotide sequence having at least one, two, or three modifications, but not more than four modifications, of SEQ ID NO: 1848. 94. The viral genome of any one of embodiments 86-93, wherein the encoded miR binding site comprises a miR183 binding site, a miR122 binding site, a miR-142-3p, or a combination thereof, optionally wherein: (i) the encoded miR183 binding site comprises the nucleotide sequence of SEQ ID NO: 1847 or a nucleotide sequence substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity, e.g., 100% sequence identity); or a nucleotide sequence having at least one, two, three, four, five, six, or seven modifications, but not more than ten modifications, of SEQ ID NO: 1847; (ii) the encoded miR122 binding site comprises the nucleotide sequence of SEQ ID NO: 1865 or a nucleotide sequence substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity, e.g., 100% sequence identity); or a nucleotide sequence having at least one, two, three, four, five, six, or seven modifications, but not more than ten modifications, of SEQ ID NO: 1865; and / or (iii) the encoded miR-142-3p binding site comprises the nucleotide sequence of SEQ ID NO: 1869 or a nucleotide sequence substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity, e.g., 100% sequence identity); or a nucleotide sequence having at least one, two, three, four, five, six, or seven modifications, but not more than ten modifications, of SEQ ID NO: 1869. 95. The viral genome of any one of embodiments 86-94, wherein the viral genome comprises a nucleotide sequence encoding a miR183 binding site. 96. The viral genome of embodiment 95, wherein the viral genome encodes at least 1-5 copies, e.g., 4 copies, of a miR183 binding site. 97. The viral genome of embodiment 96, wherein each copy is contiguous. 98. The viral genome of embodiment 96, wherein each copy is separated by a spacer. 99. The viral genome of any one of embodiments 95-98, wherein the encoded miR183 binding site comprises the nucleotide sequence of SEQ ID NO: 1847 or a nucleotide sequence substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity, e.g., 100% sequence identity); or a nucleotide sequence having at least one, two, three, four, five, six, or seven modifications, but not more than ten modifications, of SEQ ID NO: 1847. 100. The viral genome of embodiment 98, wherein the viral genome comprises: (i) a first encoded miR183 binding site comprising the nucleotide sequence of SEQ ID NO: 1847 or a nucleotide sequence that is substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity, e.g., 100% sequence identity) or having at least one, two, three, four, five, six, or seven modifications, but not more than ten modifications, of SEQ ID NO: 1847; (ii) a first spacer sequence comprising the nucleotide sequence of SEQ ID NO: 1848 or a nucleotide sequence having at least one, two, or three modifications, but not more than four modifications, of SEQ ID NO: 1848; (iii) a second encoded miR183 binding site comprising the nucleotide sequence of SEQ ID NO: 1847 or a nucleotide sequence that is substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity, e.g., 100% sequence identity) or having at least one, two, three, four, five, six, or seven modifications, but not more than ten modifications, of SEQ ID NO: 1847; (iv) a second spacer sequence comprising the nucleotide sequence of SEQ ID NO: 1848 or a nucleotide sequence having at least one, two, or three modifications, but not more than four modifications, of SEQ ID NO: 1848; (v) a third encoded miR183 binding site comprising the nucleotide sequence of SEQ ID NO: 1847 or a nucleotide sequence that is substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity, e.g., 100% sequence identity) or having at least one, two, three, four, five, six, or seven modifications, but not more than ten modifications, of SEQ ID NO: 1847; (vi) a third spacer sequence comprising the nucleotide sequence of SEQ ID NO: 1848 or a nucleotide sequence having at least one, two, or three modifications, but not more than four modifications, of SEQ ID NO: 1848; and (vii) a fourth encoded miR183 binding site comprising the nucleotide sequence of SEQ ID NO: 1847 or a nucleotide sequence that is substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity, e.g., 100% sequence identity) thereto; or having at least one, two, three, four, five, six, or seven modifications of SEQ ID NO: 1847, but not more than ten modifications. 101. The viral genome of any of embodiments 7-100, comprising a series of miR183 binding sites, the series comprising four copies of a miR183 binding site, wherein each copy of a miR binding site in the series is separated by a spacer. 102. The viral genome of embodiment 101, wherein the series of encoded miR183 binding sites comprises the nucleotide sequence of SEQ ID NO: 1849 or a nucleotide sequence that is at least 95% identical thereto. 103. The viral genome of embodiment 102, wherein the series of encoded miR183 binding sites comprises or consists of the nucleotide sequence of SEQ ID NO: 1849. 104. The viral genome of any of embodiments 7-103, which is self-complementary. 105. The viral genome of any of embodiments 7-103, which is single-stranded. 106. A recombinant viral genome comprising, in 5’ to 3’ order: (i) a 5’ adeno-associated (AAV) ITR, optionally wherein the 5’ AAV ITR comprises the nucleotide sequence of SEQ ID NO: 1829 or a nucleotide sequence that is at least 95% identical thereto; (ii) a CMVie enhancer, optionally wherein the CMVie enhancer comprises the nucleotide sequence of SEQ ID NO: 1831 or a nucleotide sequence that is at least 95% identical thereto; (iii) a CB promoter or functional variant thereof, optionally wherein the CB promoter or functional variant thereof comprises the nucleotide sequence of SEQ ID NO: 1834 or a nucleotide sequence that is at least 95% identical thereto; (iv) an intron, optionally wherein the intron comprises the nucleotide sequence of SEQ ID NO: 1842 or a nucleotide sequence that is at least 95% identical thereto; (v) a nucleotide sequence encoding a signal sequence, optionally wherein the nucleotide sequence encoding the signal sequence comprises the nucleotide sequence of SEQ ID NO: 2005 or a nucleotide sequence that is at least 95% identical thereto; (vi) a nucleotide sequence encoding a GBA1 protein, wherein the nucleotide sequence encoding the GBA1 protein comprises the nucleotide sequence of SEQ ID NO: 2002 or a nucleotide sequence that is at least 93% identical to the nucleotide sequence of SEQ ID NO: 2002; (vii) a polyA signal region, optionally wherein the polyA signal region comprises the nucleotide sequence of SEQ ID NO: 1846 or a nucleotide sequence that is at least 95% identical thereto; and (viii) a 3’ AAV ITR, optionally wherein the 3’ AAV ITR comprises the nucleotide sequence of SEQ ID NO: 1830 or a nucleotide sequence that is at least 95% identical thereto. 107. The recombinant viral genome of embodiment 106, wherein: (i) the 5’ AAV ITR comprises the nucleotide sequence of SEQ ID NO: 1829 or a nucleotide sequence that is at least 95% identical thereto; (ii) the CMVie enhancer comprises the nucleotide sequence of SEQ ID NO: 1831 or a nucleotide sequence that is at least 95% identical thereto; (iii) the CB promoter or functional variant thereof comprises the nucleotide sequence of SEQ ID NO: 1834 or a nucleotide sequence that is at least 95% identical thereto; (iv) the nucleotide sequence of SEQ ID NO: 1842 or a nucleotide sequence that is at least 95% identical thereto; (v) the nucleotide sequence encoding the signal sequence comprises the nucleotide sequence of SEQ ID NO: 2005 or a nucleotide sequence that is at least 95% identical thereto; (vi) the nucleotide sequence encoding the GBA1 protein comprises the nucleotide sequence of SEQ ID NO: 2002 or a nucleotide sequence that is at least 93% identical to the nucleotide sequence of SEQ ID NO: 2002; (vii) the polyA signal region comprises the nucleotide sequence of SEQ ID NO: 1846 or a nucleotide sequence that is at least 95% identical thereto; and (viii) the 3’ AAV ITR comprises the nucleotide sequence of SEQ ID NO: 1830 or a nucleotide sequence that is at least 95% identical thereto. 108. The recombinant viral genome of embodiment 106 or 107, wherein: (i) the 5’ AAV ITR comprises the nucleotide sequence of SEQ ID NO: 1829; (ii) the CMVie enhancer comprises the nucleotide sequence of SEQ ID NO: 1831 ; (iii) the CB promoter or functional variant thereof comprises the nucleotide sequence of SEQ ID NO: 1834; (iv) the intron comprises the nucleotide sequence of SEQ ID NO: 1842; (v) the nucleotide sequence encoding the signal sequence comprises the nucleotide sequence of SEQ ID NO: 2005; (vi) the nucleotide sequence encoding the GBA1 protein comprises the nucleotide sequence of SEQ ID NO: 2002; (vii) the polyA signal region comprises the nucleotide sequence of SEQ ID NO: 1846; and (viii) the 3’ AAV ITR comprises the nucleotide sequence of SEQ ID NO: 1830. 109. The recombinant viral genome of embodiment 108, comprising the nucleotide sequence of SEQ ID NO: 2006 or a nucleotide sequence at least 97% identical thereto. 110. The recombinant viral genome of embodiment 108 or 109, comprising the nucleotide sequence of SEQ ID NO: 2006. 111. The recombinant viral genome of embodiment 108 or 109, consisting of the nucleotide sequence of SEQ ID NO: 2006. 112. A recombinant viral genome comprising, in 5’ to 3’ order: (i) a 5’ adeno-associated (AAV) ITR, optionally wherein the 5’ AAV ITR comprises the nucleotide sequence of SEQ ID NO: 1829 or a nucleotide sequence at least 95% identical thereto; (ii) a CMVie enhancer, optionally wherein the CMVie enhancer comprises the nucleotide sequence of SEQ ID NO: 1831 or a nucleotide sequence at least 95% identical thereto; (iii) a CB promoter or functional variant thereof, optionally wherein the CB promoter or functional variant thereof comprises the nucleotide sequence of SEQ ID NO: 1834 or a nucleotide sequence at least 95% identical thereto; (iv) an intron, optionally wherein the intron comprises the nucleotide sequence of SEQ ID NO: 1842 or a nucleotide sequence at least 95% identical thereto; (v) a nucleotide sequence encoding a signal sequence, optionally wherein the nucleotide sequence encoding the signal sequence comprises the nucleotide sequence of SEQ ID NO: 2005 or a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO: 2005; (vi) a nucleotide sequence encoding a GBAl protein, optionally wherein the nucleotide sequence encoding the GBAl protein comprises the nucleotide sequence of SEQ ID NO: 2002 or a nucleotide sequence that is at least 93% identical to the nucleotide sequence of SEQ ID NO: 2002; (vii) a series of miR183 binding sites; (viii) a polyA signal region, optionally wherein the polyA signal region comprises the nucleotide sequence of SEQ ID NO: 1846 or a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO: 1846; and (ix) a 3’ AAV ITR, optionally wherein the 3’ AAV ITR comprises the nucleotide sequence of SEQ ID NO: 1830 or a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO: 1830; wherein the series of miR183 binding sites comprises: (a) a miR183 binding site comprising the nucleotide sequence of SEQ ID NO: 1847 or a nucleotide sequence having at least one, two, three, four, five, six, or seven modifications, but not more than ten modifications, of the nucleotide sequence of SEQ ID NO: 1847; (b) a spacer sequence comprising the nucleotide sequence of SEQ ID NO: 1848 or a nucleotide sequence having at least one, two, or three modifications, but not more than four modifications, of the nucleotide sequence of SEQ ID NO: 1848; (c) a miR183 binding site comprising the nucleotide sequence of SEQ ID NO: 1847 or a nucleotide sequence having at least one, two, three, four, five, six, or seven modifications, but not more than ten modifications, of the nucleotide sequence of SEQ ID NO: 1847; (d) a spacer sequence comprising the nucleotide sequence of SEQ ID NO: 1848 or a nucleotide sequence having at least one, two, or three modifications, but not more than four modifications, of the nucleotide sequence of SEQ ID NO: 1848; (e) a miR183 binding site comprising the nucleotide sequence of SEQ ID NO: 1847 or a nucleotide sequence having at least one, two, three, four, five, six, or seven modifications, but not more than ten modifications, of the nucleotide sequence of SEQ ID NO: 1847; (f) a spacer sequence comprising the nucleotide sequence of SEQ ID NO: 1848 or a nucleotide sequence having at least one, two, or three modifications, but not more than four modifications, of the nucleotide sequence of SEQ ID NO: 1848; (g) a miR183 binding site comprising the nucleotide sequence of SEQ ID NO: 1847 or a nucleotide sequence having at least one, two, three, four, five, six, or seven modifications, but not more than ten modifications, of the nucleotide sequence of SEQ ID NO: 1847. 113. The recombinant viral genome of embodiment 112, (i) the 5’ AAV ITR comprises the nucleotide sequence of SEQ ID NO: 1829 or a nucleotide sequence that is at least 95% identical thereto; (ii) the CMVie enhancer comprises the nucleotide sequence of SEQ ID NO: 1831 or a nucleotide sequence that is at least 95% identical thereto; (iii) the CB promoter or functional variant thereof comprises the nucleotide sequence of SEQ ID NO: 1834 or a nucleotide sequence that is at least 95% identical thereto; (iv) the nucleotide sequence of SEQ ID NO: 1842 or a nucleotide sequence that is at least 95% identical thereto; (v) the nucleotide sequence encoding the signal sequence comprises the nucleotide sequence of SEQ ID NO: 2005 or a nucleotide sequence that is at least 95% identical thereto; (vi) the nucleotide sequence encoding the GBA1 protein comprises the nucleotide sequence of SEQ ID NO: 2002 or a nucleotide sequence that is at least 93% identical to the nucleotide sequence of SEQ ID NO: 2002; (vii) the series of miR183 binding sites comprises: (a) a miR183 binding site comprising the nucleotide sequence of SEQ ID NO: 1847 or a nucleotide sequence having at least one, two, three, four, five, six, or seven modifications, but not more than ten modifications, of the nucleotide sequence of SEQ ID NO: 1847; (b) a spacer sequence comprising the nucleotide sequence of SEQ ID NO: 1848 or a nucleotide sequence having at least one, two, or three modifications, but not more than four modifications, of the nucleotide sequence of SEQ ID NO: 1848; (c) a miR183 binding site comprising the nucleotide sequence of SEQ ID NO: 1847 or a nucleotide sequence having at least one, two, three, four, five, six, or seven modifications, but not more than ten modifications, of the nucleotide sequence of SEQ ID NO: 1847; (d) a spacer sequence comprising the nucleotide sequence of SEQ ID NO: 1848 or a nucleotide sequence having at least one, two, or three modifications, but not more than four modifications, to the nucleotide sequence of SEQ ID NO: 1848; (e) a miR183 binding site comprising the nucleotide sequence of SEQ ID NO: 1847 or a nucleotide sequence having at least one, two, three, four, five, six, or seven modifications, but not more than ten modifications, to the nucleotide sequence of SEQ ID NO: 1847; (f) a spacer sequence comprising the nucleotide sequence of SEQ ID NO: 1848 or a nucleotide sequence having at least one, two, or three modifications, but not more than four modifications, to the nucleotide sequence of SEQ ID NO: 1848; (g) a miR183 binding site comprising the nucleotide sequence of SEQ ID NO: 1847 or a nucleotide sequence having at least one, two, three, four, five, six, or seven modifications, but not more than ten modifications, to the nucleotide sequence of SEQ ID NO: 1847; (viii) the polyA signal region comprises the nucleotide sequence of SEQ ID NO: 1846 or a nucleotide sequence that is at least 95% identical thereto; and (ix) the 3’ AAV ITR comprises the nucleotide sequence of SEQ ID NO: 1830 or a nucleotide sequence that is at least 95% identical thereto. 114. The recombinant viral genome of embodiments 106, 107, 112, or 113, wherein the nucleotide sequence encoding the GBA1 protein comprises the nucleotide sequence of SEQ ID NO: 2002 or a nucleotide sequence that is at least 95% identical thereto. 115. The recombinant viral genome of embodiments 113 or 114, wherein: (i) the 5’ AAV ITR comprises the nucleotide sequence of SEQ ID NO: 1829; (ii) the CMVie enhancer comprises the nucleotide sequence of SEQ ID NO: 1831; (iii) the CB promoter or functional variant thereof comprises the nucleotide sequence of SEQ ID NO: 1834; (iv) the intron comprises the nucleotide sequence of SEQ ID NO: 1842; (v) the nucleotide sequence encoding the signal sequence comprises the nucleotide sequence of SEQ ID NO: 2005; (vi) the nucleotide sequence encoding the GBA1 protein comprises the nucleotide sequence of SEQ ID NO: 2002; (vii) the miR183 binding site series comprises the nucleotide sequence of SEQ ID NO: 1849; (viii) the polyA signal region comprises the nucleotide sequence of SEQ ID NO: 1846; and (ix) the 3' AAV ITR comprises the nucleotide sequence of SEQ ID NO: 1830. 116. The recombinant viral genome of embodiment 115, comprising the nucleotide sequence of SEQ ID NO: 2007, or a nucleotide sequence at least 97% identical thereto. 117. The recombinant viral genome of embodiment 115 or embodiment 116, comprising the nucleotide sequence of SEQ ID NO: 2007. 118. The recombinant viral genome of any one of embodiments 7-117, further comprising a nucleic acid encoding a capsid protein, wherein the capsid protein comprises a VP1 polypeptide, a VP2 polypeptide, and / or a VP3 polypeptide. 119. The recombinant viral genome of embodiment 118, wherein the VP1 polypeptide, the VP2 polypeptide, and / or the VP3 polypeptide is encoded by at least one Cap gene. 120. The viral genome of any one of embodiments 7-119, further comprising a nucleic acid encoding a Rep protein, wherein the Rep protein comprises a Rep78 protein, a Rep68 protein, a Rep52 protein, and / or a Rep40 protein. 121. The viral genome of embodiment 120, wherein the Rep78 protein, the Rep68 protein, the Rep52 protein, and / or the Rep40 protein is encoded by at least one Rep gene. 122. An AAV particle comprising: (i) a capsid protein; and (ii) a viral genome of any one of embodiments 7-121. 123. The AAV particle of embodiment 122, wherein: (i) the capsid protein comprises the amino acid sequence of SEQ ID NO: 138 or an amino acid sequence having at least 80% (e.g., at least about 85%, 90%, 95%, 96%, 97%, 98%, or 99%) sequence identity thereto; (ii) the capsid protein comprises an amino acid sequence having at least one, two, or three modifications of the amino acid sequence of SEQ ID NO: 138, but not more than 30, 20, or 10 modifications; (iii) the capsid protein comprises an amino acid sequence of SEQ ID NO: 11 or an amino acid sequence having at least 80% (e.g., at least about 85%, 90%, 95%, 96%, 97%, 98%, or 99%) sequence identity thereto; (iv) the capsid protein comprises an amino acid sequence having at least one, two, or three modifications of the amino acid sequence of SEQ ID NO: 11, but not more than 30, 20, or 10 modifications; (v) the capsid protein comprises an amino acid sequence encoded by a nucleotide sequence of SEQ ID NO: 137 or a sequence having at least 80% (e.g., at least about 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto; and / or (vi) a nucleotide sequence encoding the capsid protein comprises a nucleotide sequence of SEQ ID NO: 137 or a sequence having at least 80% (e.g., at least about 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto. 124. The AAV particle of either of embodiments 122 or 123, wherein the capsid protein comprises: (i) an amino acid substitution at position K449, e.g., a K449R substitution, according to the numbering of SEQ ID NO: 138; (ii) an insert comprising an amino acid sequence of TLAVPFK (SEQ ID NO: 1262), optionally wherein the insert is present immediately following position 588 relative to the reference sequence according to the numbering of SEQ ID NO: 138; (iii) an amino acid other than “A” at position 587 and / or an amino acid other than “Q” at position 588 according to the numbering of SEQ ID NO: 138; (iv) an amino acid substitution of A587D and / or Q588G according to the numbering of SEQ ID NO: 138. 125. The AAV particle of any one of embodiments 122 to 124, wherein the capsid protein comprises (i) an amino acid substitution of K449R according to the numbering of SEQ ID NO: 138; and (ii) an insert comprising an amino acid sequence of TLAVPFK (SEQ ID NO: 1262), optionally wherein the insert is present immediately following position 588 of SEQ ID NO: 138. 126. The AAV particle of any of embodiments 122-124, wherein the capsid protein comprises (i) an amino acid substitution of K449R, numbered according to SEQ ID NO: 138; (ii) an insert comprising the amino acid sequence of TLAVPFK (SEQ ID NO: 1262), optionally wherein the insert is present immediately following position 588 relative to the reference sequence of SEQ ID NO: 138; and (iii) amino acid substitutions of A587D and Q588G, numbered according to SEQ ID NO: 138. 127. The AAV particle of any of embodiments 122-124, wherein the capsid protein comprises (i) an insert comprising the amino acid sequence of TLAVPFK (SEQ ID NO: 1262), optionally wherein the insert is present immediately following position 588 relative to the reference sequence of SEQ ID NO: 138; and (ii) amino acid substitutions of A587D and Q588G, numbered according to SEQ ID NO: 138. 128. The AAV particle of any of embodiments 122-127, wherein the capsid protein comprises any of the capsid proteins listed in Table 1, or a functional variant thereof. 129. The AAV particle of any of embodiments 122-128, wherein the capsid protein comprises VOY101, VOY201, AAVPHP.N (PHP.N), AAVPHP.B (PHP.B), AAVPHP.A (PHP.A), PHP.B2, PHP.B3, G2B4, G2B5, AAV5, AAV9, AAVrh10, or a functional variant thereof (e.g., an AAV9 capsid or variant thereof, or an AAV5 capsid or variant thereof). 130. The AAV particle of any of embodiments 122-129, wherein: (i) the capsid protein comprises the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity); (ii) the capsid protein comprises an amino acid sequence containing at least one, two, or three modifications, but not more than 30, 20, or 10 modifications (e.g., substitutions) relative to the amino acid sequence of SEQ ID NO: 1; (iii) the capsid protein comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 2 or a nucleotide sequence substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity); and / or (iv) the nucleotide sequence encoding the capsid protein comprises the nucleotide sequence of SEQ ID NO: 2 or a nucleotide sequence substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity). 131. The AAV particle of any one of embodiments 122-130, wherein the capsid protein comprises: (i) a VP1 polypeptide, a VP2 polypeptide, a VP3 polypeptide, or a combination thereof; (ii) an amino acid sequence corresponding to positions 138-743 of SEQ ID NO: 1, e.g., VP2, or a sequence having at least 80% (e.g., at least about 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99%) sequence identity thereto; (iii) an amino acid sequence corresponding to positions 203-743 of SEQ ID NO: 1, e.g., VP3, or a sequence having at least 80% (e.g., at least about 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99%) sequence identity thereto; and / or (iv) an amino acid sequence corresponding to positions 1-743 of SEQ ID NO: 1, e.g., VP1, or a sequence having at least 80% (e.g., at least about 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99%) sequence identity thereto. 132. The AAV particle of any one of embodiments 122-131, wherein the nucleotide sequence encoding the capsid protein comprises: (i) a CTG start codon; and / or (ii) the nucleotide sequence of SEQ ID NO: 137 comprising 3 to 20 mutations (e.g., substitutions), e.g., 3 to 15 mutations, 3 to 10 mutations, 3 to 5 mutations, 5 to 20 mutations, 5 to 15 mutations, 5 to 10 mutations, 10 to 20 mutations, 10 to 15 mutations, 15 to 20 mutations, 3 mutations, 5 mutations, 10 mutations, 12 mutations, 15 mutations, 18 mutations, or 20 mutations. 133. A vector comprising the isolated nucleic acid of any one of embodiments 1-6 or the viral genome of any one of embodiments 7-121. 134. A cell comprising the viral genome of any one of embodiments 7-11, the viral particle of any one of embodiments 122-132, or the vector of embodiment 133. 135. The cell of embodiment 134, which is a mammalian cell (e.g., a HEK293 cell), an insect cell (e.g., a Sf9 cell), or a bacterial cell. 136. A nucleic acid comprising a viral genome of any one of embodiments 7 to 121, and a backbone region suitable for replication of the viral genome in a cell, e.g., a bacterial cell (e.g., wherein the backbone region comprises one or both of a bacterial origin of replication and an optional selectable marker). 137. The nucleic acid of embodiment 136, wherein the viral genome comprises the nucleotide sequence of SEQ ID NO: 2006 or SEQ ID NO: 2007, or a sequence at least 97% identical thereto. 138. A method of manufacturing a viral genome, the method comprising: (i) providing a nucleic acid molecule comprising a viral genome of embodiment 136 or 137, or a nucleic acid encoding a viral genome of any one of embodiments 7 to 121; and (ii) excising the viral genome from the backbone region, e.g., by cleaving the nucleic acid molecule upstream and downstream of the viral genome. 139. A method of manufacturing a recombinant AAV particle, the method comprising (i) providing a host cell comprising a viral genome of any one of embodiments 7 to 122, or a nucleic acid encoding a viral genome of embodiment 136 or 137; and (ii) incubating the host cell under conditions suitable for encapsidation of the viral genome in a capsid protein, e.g., a VOY101 capsid protein, an AAV9 capsid protein, or a variant thereof, or an AAV5 capsid protein, or a variant thereof; thereby manufacturing an isolated AAV particle. 140. The method of embodiment 139, further comprising, prior to step (i), introducing a first nucleic acid molecule comprising the viral genome into the host cell. 141. The method of embodiment 139 or 140, wherein the host cell comprises a second nucleic acid encoding a capsid protein, e.g., a VOY101 capsid protein. 142. The method of embodiment 140, further comprising introducing the second nucleic acid into the cell. 143. The method of embodiment 141 or 142, wherein the second nucleic acid molecule is introduced into the host cell prior to, concurrently with, or after the first nucleic acid molecule. 144. The method of any one of embodiments 139 to 143, wherein the host cell is a mammalian cell (e.g., a HEK293 cell), an insect cell (e.g., a Sf9 cell), or a bacterial cell. 145. A pharmaceutical composition comprising an AAV particle of any one of embodiments 122-132 or an AAV particle comprising a viral genome of any one of embodiments 7-121 and a pharmaceutically acceptable excipient. 146. A method of delivering a nucleic acid sequence encoding a GBA1 protein to a subject, comprising administering an effective amount of a pharmaceutical composition of embodiment 145, an AAV particle of any one of embodiments 122-132, an AAV particle comprising a viral genome of any one of embodiments 7-121, or an AAV particle comprising a viral genome comprising a nucleic acid of any one of embodiments 1-6, thereby delivering the nucleic acid sequence encoding a GBA1 protein to the subject. 147. The method of embodiment 146, wherein the subject has a disease associated with expression of GBA, has been diagnosed with or is at risk of developing the disease, the expression of GBA, for example, is abnormal or decreased GBA1 expression, for example, expression of a GBA1 gene, GBA1 mRNA, and / or GBA1 protein. 148. The method of embodiment 146 or 147, wherein the subject has a neurodegenerative disorder or a neuromuscular disorder, has been diagnosed with or is at risk of developing the disorder. 149. A method of treating a subject having or diagnosed with a disease associated with expression of GBA1, comprising administering an effective amount of a pharmaceutical composition of embodiment 145, an AAV particle of any one of embodiments 122-132, an AAV particle comprising a viral genome of any one of embodiments 7-121, or an AAV particle comprising a viral genome comprising a nucleic acid of any one of embodiments 1-6, thereby treating the disease associated with expression of GBA1 in the subject. 150. A method of treating a subject having or diagnosed with a neurodegenerative disorder or a neuromuscular disorder, comprising administering an effective amount of a pharmaceutical composition of embodiment 145, an AAV particle of any one of embodiments 122-132, an AAV particle comprising a viral genome of any one of embodiments 7-121, or an AAV particle comprising a viral genome comprising a nucleic acid of any one of embodiments 1-6, thereby treating the neurodegenerative disorder or neuromuscular disorder in the subject. 151. The method of any one of embodiments 147-150, wherein the disease associated with expression of GBA1 or the neurodegenerative disorder or neuromuscular disorder comprises Parkinson’s disease (PD), dementia with Lewy bodies (DLB), Gaucher disease (GD), spinal muscular atrophy (SMA), multiple system atrophy (MSA), or multiple sclerosis (MS). 152. A method of treating a subject who has or is diagnosed with Parkinson's disease (PD) (e.g., PD associated with a mutation in the GBA1 gene), comprising administering an effective amount of a pharmaceutical composition as described in embodiment 145, an AAV particle as described in any one of embodiments 122 to 132, an AAV particle containing a viral genome as described in any one of embodiments 7 to 121, or an AAV particle containing a viral genome containing a nucleic acid as described in any one of embodiments 1 to 6, thereby treating the subject's PD. 153. The method of embodiment 151 or embodiment 152, wherein the subject has one or more mutations in GBA1. 154. The method of any one of embodiments 151 to 153, wherein the PD is an early-onset PD (e.g., before age 50) or a juvenile PD (e.g., before age 20). 155. The method of embodiments 151 to 154, wherein the PD is dominant tremor, postural instability gait difficulty PD (PIGD), or incidental PD (e.g., PD not associated with mutation). 156. A method of treating a subject suffering from or diagnosed with Gaucher disease (GD), comprising administering an effective amount of a pharmaceutical composition as described in embodiment 145, an AAV particle as described in any one of embodiments 122 to 132, an AAV particle containing a viral genome as described in any one of embodiments 7 to 121, or an AAV particle containing a viral genome containing a nucleic acid as described in any one of embodiments 1 to 6, thereby treating the subject's GD. 157. The method of embodiment 151 or 156, wherein the GD is a neuropathic GD (e.g., affecting cells or tissues of the CNS, such as cells or tissues of the brain and / or spinal cord), a non-neuropathyic GD (e.g., not affecting cells or tissues of the CNS) or a combination thereof. 158. The method of any one of embodiments 151 or 156 to 157, wherein the GD is a type I GD (GD1), a type 2 GD (GD2), or a type 3 GD (GD3). 159. The method of embodiment 158, wherein the GD1 is a non-neuropathy GD. 160. The method of embodiment 158, wherein the GD2 is a neuropathic GD. 161. The method of any one of embodiments 146 to 160, wherein when measured by analysis, for example by the analysis described in Example 7, the subject has a reduced GCase activity level compared to a reference level. 162. The method of embodiment 161, wherein the reference level comprises a level of GCase activity in a subject that does not have a disease associated with GBA1 expression, a neuromuscular disorder, and / or a neurodegenerative disorder. 163. The method of any one of embodiments 149-162, wherein the treatment comprises preventing progression of the disease in the subject. 164. The method of any one of embodiments 149-162, wherein the treatment results in improvement of at least one symptom of the disease associated with GBA1 expression, the neurodegenerative disorder, and / or the neuromuscular disorder in the subject. 165. The method of embodiment 164, wherein the symptom of the disease associated with GBA1 expression, the neurodegenerative disorder, and / or the neuromuscular disorder comprises decreased GCase activity, accumulation of glucocerebroside and other glycolipids within, e.g., immune cells (e.g., macrophages), buildup of synuclein aggregates (e.g., Lewy bodies), developmental delay, progressive encephalopathy, progressive dementia, ataxia, myoclonus, ophthalmoplegia, bulbar palsy, generalized weakness, limb tremor, depression, visual hallucinations, cognitive decline, or a combination thereof. 166. The method of any one of embodiments 146-165, wherein the subject is a human. 167. The method of any one of embodiments 146-166, wherein the subject is a juvenile, e.g., between 6 years old and 20 years old. 168. The method of any one of embodiments 146-167, wherein the subject is an adult, e.g., over 20 years old. 169. The method of any one of embodiments 146-168, wherein the subject has a mutation in the GBA1 gene, GBA1 mRNA, and / or GBA1 protein. 170. The method of any one of embodiments 146-169, wherein the AAV particle is administered to the subject intravenously; intracerebrally; via intrathalamic (ITH) administration; intramuscularly; intrathecally; intracerebroventricularly; via intraparenchymal administration; via focused ultrasound (FUS), e.g., FUS combined with intravenous administration of microbubbles (FUS-MB), or MRI-guided FUS combined with intravenous administration; or via intra-cisterna magna injection (ICM). 171. The method of any one of embodiments 146-170, wherein the AAV particle is administered via dual ITH and ICM administration. 172. The method of any of embodiments 146-170, wherein the AAV particle is administered via intravenous injection, optionally wherein the intravenous injection is performed via focused ultrasound (FUS), e.g., FUS in combination with intravenous administration of microbubbles (FUS-MB) or MRI-guided FUS in combination with intravenous administration. 173. The method of any of embodiments 146-172, wherein the AAV particle is administered to a cell, tissue, or region of the CNS, e.g., a region of the brain or spinal cord, e.g., the parenchyma, cortex, substantia nigra, caudate cerebellum, striatum, corpus callosum, cerebellum, brainstem, caudate-putamen, thalamus, superior colliculus, spinal cord, or a combination thereof. 174. The method of any of embodiments 146-173, wherein the AAV particle is administered to a peripheral cell, tissue, or region, e.g., a lung cell or tissue, a heart cell or tissue, a spleen cell or tissue, a liver cell or tissue, or a combination thereof. 175. The method of any of embodiments 146-174, wherein the AAV particle is administered to cerebrospinal fluid, serum, or a combination thereof. 176. The method of any of embodiments 146-175, wherein the AAV particle is administered to at least two tissues or regions of the CNS, e.g., via bilateral administration. 177. The method of any of embodiments 146-176, further comprising performing a blood test, performing an imaging test, collecting a CNS biopsy sample, collecting a tissue biopsy (e.g., a lung, liver, or spleen biopsy), collecting a blood or serum sample, or collecting a cerebrospinal fluid aqueous solution biopsy. 178. The method of any of embodiments 146-177, further comprising assessing, e.g., measuring, the amount of GBA1 expression, e.g., GBA1 gene, GBA1 mRNA, and / or GBA1 protein expression, in the subject, e.g., in a cell, tissue, or bodily fluid of the subject, optionally wherein the level of GBA1 protein is measured by an assay described herein, e.g., an ELISA, Western blot, or immunohistochemical assay. 179. The method of embodiment 178, wherein the GBA1 expression is measured prior to, during, or after treatment with the AAV particle. 180. The method of embodiment 178 or 179, wherein the cell or tissue is a cell or tissue of the central nervous system (e.g., the parenchyma) or a peripheral cell or tissue (e.g., the liver, heart, and / or spleen). 181. The method of any of embodiments 146-180, wherein the administration results in an increased level of GBA1 protein expression in cells or tissues of the subject relative to a reference level, e.g., a subject who has not received treatment, e.g., has not been administered the AAV particle. 182. The method of any of embodiments 146-181, further comprising assessing, e.g., measuring, the level of GCase activity in the subject, e.g., in cells or tissues of the subject, optionally wherein the level of GCase activity is measured by an assay described herein, e.g., an assay described in Example 7. 183. The method of any of embodiments 146-182, wherein the administration results in an increase in at least one, two, or all of: (i) the level of GCase activity in cells, tissues (e.g., cells or tissues of the CNS, e.g., the cortex, striatum, thalamus, cerebellum, and / or brainstem), and / or bodily fluids (e.g., CSF and / or serum) of the subject, optionally wherein the level of GCase activity is increased at least 2, 3, 4, or 5-fold compared to a reference level, e.g., a subject who has not received treatment, e.g., has not been administered the AAV particle; (ii) the level of viral genomes (VG) per cell in CNS tissues (e.g., the cortex, striatum, thalamus, cerebellum, brainstem, and / or spinal cord) of the subject, optionally wherein the level of VG per cell is increased over 50 VG / cell compared to peripheral tissues, wherein the level of VG per cell is at least 4- to 10-fold lower than the level in the CNS tissues, e.g., measured by an assay described herein; and / or (iii) the level of GBA1 mRNA expression in cells or tissues (e.g., cells or tissues of the CNS, e.g., the cortex, thalamus, and / or brainstem), optionally wherein the level of GBA1 mRNA is increased at least 100- to 1300-fold, e.g., 100-fold, 200-fold, 500-fold, 600-fold, 850-fold, 900-fold, 950-fold, 1000-fold, 1050-fold, 1100-fold, 1150-fold, 1200-fold, 1250-fold, or 1300-fold compared to a reference level (e.g., a subject who has not received treatment, e.g., has not been administered the AAV particle) or endogenous GBA1 mRNA level, e.g., measured by an assay described herein. 184. The method of any of embodiments 146-183, further comprising administering an additional therapeutic agent and / or therapy suitable for treating or preventing the disease associated with GBA1 expression, the neurodegenerative disorder, and / or the neuromuscular disorder. 185. The method of embodiment 184, wherein the other therapeutic agent comprises enzyme replacement therapy (ERT) (e.g., imiglucerase, velaglucerase alfa, or taliglucerase alfa); substrate reduction therapy (SRT) (e.g., eliglustat or miglustat), blood transfusion, levodopa, carbidopa, Safinamide, a dopamine agonist (e.g., pramipexole, rotigotine, or ropinirole), an anticholinergic drug (e.g., benztropine or trihexyphenidyl), a cholinesterase inhibitor (e.g., rivastigmine, donepezil, or galantamine), an N-methyl-d-aspartate (NMDA) receptor antagonist (e.g., memantine), or a combination thereof. 186. The isolated nucleic acid of any one of embodiments 1 to 6, the viral genome of any one of embodiments 7 to 121, the AAV particle of any one of embodiments 122 to 132, or the pharmaceutical composition of embodiment 145, for use in the manufacture of a medicament. 187. The isolated nucleic acid of any one of embodiments 1 to 6, the viral genome of any one of embodiments 7 to 121, the AAV particle of any one of embodiments 122 to 132, or the pharmaceutical composition of embodiment 145, for use in the treatment of a disease associated with GBA1 expression, a neuromuscular disorder, and / or a neurodegenerative disorder. 188. Use of an effective amount of an AAV particle comprising a genome of any one of embodiments 7 to 121, an AAV particle comprising a genome comprising a nucleic acid of any one of embodiments 1 to 6, an AAV particle of any one of embodiments 122 to 132, or the pharmaceutical composition of embodiment 146, for the manufacture of a medicament for the treatment of a disease associated with GBA1 expression, a neuromuscular disorder, and / or a neurodegenerative disorder. 189. An adeno-associated virus (AAV) viral genome comprising the nucleotide sequence of SEQ ID NO: 2006 or 2007. 190. An AAV particle comprising the AAV viral genome of claim 189 and a capsid selected from those listed in Table 1. 191. The viral genome of embodiment 190, wherein the capsid comprises an AAV2 serotype, an AAV5 serotype, or an AAV9 serotype, or a variant thereof. 192. A pharmaceutical composition comprising the AAV particle of claim 190 or claim 191. 193. A method of treating a neurological or neuromuscular disorder, the method comprising administering to a subject the pharmaceutical composition of claim 192. 194. The method of claim 193, wherein the neurological or neuromuscular disorder is Parkinson’s disease, Gaucher disease, or Lewy body dementia or a related disorder. 195. The method of claim 194, wherein the neurological or neuromuscular disorder is a disorder associated with reduced levels of GCase protein.

[0033] The specifics of various aspects or embodiments of the present disclosure are set forth in the detailed description below. Other features, objects, and advantages of the present disclosure will be apparent to those skilled in the art from the following detailed description. In the detailed description, unless otherwise specified, the singular forms also include the plural forms. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. In case of conflict, the present specification will control. BRIEF DESCRIPTION OF DRAWINGS

[0034] Figures 1A-1B LC-MS / MS results depicting the levels of the GBA1 substrate, glucose sphingosine (GlcSph), in cell lysates of Gaucher disease patient-derived fibroblasts (GD1 patient GM04394, GD1 patient GM00852, and GD2 patient GM00877) and healthy control group fibroblasts (CTL GM05758, CTL GM02937, and CTL GM08402). Data is shown as GlcSph normalized to actin ( Figure 1A ) or to the lysosomal protein Lamp1 ( Figure 1B ). Figure 1C LC-MS / MS results depicting the levels of the GBA1 substrate, glucose sphingosine (GlcSph), in cell lysates of Gaucher disease patient-derived fibroblasts (GD1 patient GM04394, GD1 patient GM00852, and GD2 patient GM00877) and healthy control group fibroblasts (CTL GM05758, CTL GM02937, and CTL GM08402). Data is shown as GlcSph normalized to actin ( Figure 1A ) or to the lysosomal protein Lamp1 ( Figure 1B ).

[0035] Figures 2A-2B It is described that at a MOI of 10 3.5GCase activity (normalized to mg protein, RFU / mL) in cell pellets (left panel) or conditioned media (right panel) of GD-II fibroblasts (GM00877) collected at day 7 post transduction with AAV2 viral particles comprising the viral genome constructs (GBA_VGl (SEQ ID NO: 1759), GBA_VG9 (SEQ ID NO: 1767), GBA_VGlO (SEQ ID NO: 1768), GBA_VGl l (SEQ ID NO: 1769), GBA_VG6 (SEQ ID NO: 1764), GBA_VG7 (SEQ ID NO: 1765), GBA_VGl2 (SEQ ID NO: 1770), GBA_VG3 (SEQ ID NO: 1761), GBA_VG4 (SEQ ID NO: 1762), GBA_VG5 (SEQ ID NO: 1763), and GBA_VGl3 (SEQ ID NO: 1771)) from left to right on the X-axis. Figure 2A Figure 2B

[0036] Figure 3 Depicted are levels of GBA1 substrate glucosylsphingosine (GlcSph) (ng / mg Lamp1) in cell lysates collected from GD-II patient fibroblasts (GM00877) at day 7 post transduction with AAV2 vectors containing no AAV control or the indicated viral genomes (from left to right: GBA_VGl (SEQ ID NO: 1759), GBA_VG9 (SEQ ID NO: 1767), GBA_VG6 (SEQ ID NO: 1764), GBA_VG7 (SEQ ID NO: 1765), GBA_VG3 (SEQ ID NO: 1761), GBA_VG4 (SEQ ID NO:), and GBA_VG5 (SEQ ID NO: 1763)) on the X-axis.

[0037] Figure 4A Depicted are levels of GCase activity (normalized to mg protein, RFU / mL) in cell pellets (left panel) or conditioned media (right panel) of GD-II fibroblasts (GM00877) collected at day 7 post transduction with AAV2 viral particles comprising the viral genome constructs (GBA_VGl (SEQ ID NO: 1759), GBA_VG9 (SEQ ID NO: 1767), GBA_VGlO (SEQ ID NO: 1768), GBA_VGl l (SEQ ID NO: 1769), GBA_VG6 (SEQ ID NO: 1764), GBA_VG7 (SEQ ID NO: 1765), GBA_VGl2 (SEQ ID NO: 1770), GBA_VG3 (SEQ ID NO: 1761), GBA_VG4 (SEQ ID NO: 1762), GBA_VG5 (SEQ ID NO: 1763), and GBA_VGl3 (SEQ ID NO: 1771)) from left to right on the X-axis. 2.5 3 3.5 4 ​​​​​(Third column) GCase activity (measured as RFU / mL normalized to milligram protein) in fibroblasts (GD-II GM00877) of GD-II patients on day 7 after transduction of the AAV2 vector containing the viral genome specified on the X-axis (from left to right: GBA_VG1 (SEQ ID NO:1759), GBA_VG14 (SEQ ID NO:1809), GBA_VG15 (SEQ ID NO:1810), GBA_VG16 (SEQ ID NO:1811), GBA_VG17 (SEQ ID NO:1812), GBA_VG18 (SEQ ID NO:1813), GBA_VG19 (SEQ ID NO:1814), and GBA_VG20 (SEQ ID NO:1815)). Figure 4B Depicting the use of MOI 10 2.5 (First pillar), 10 3 (Second pillar), 10 3.5 and 10 4 (Third column) The level of glucosamine, a substrate of GBA1, in cell lysate from fibroblasts derived from GD-II patients on day 7 after transduction of an AAV2 vector containing the viral genomes specified on the X-axis (from left to right: GBA_VG1 (SEQ ID NO:1759), GBA_VG14 (SEQ ID NO:1809), GBA_VG15 (SEQ ID NO:1810), GBA_VG16 (SEQ ID NO:1811), GBA_VG17 (SEQ ID NO:1812), GBA_VG18 (SEQ ID NO:1813), GBA_VG19 (SEQ ID NO:1814), and GBA_VG20 (SEQ ID NO:1815)).

[0038] Figure 5 The GC content and distribution of the optimized nucleotide sequence of the first codon encoding the GBA1 protein of SEQ ID NO:1773, the optimized nucleotide sequence of the second codon encoding the GBA1 protein of SEQ ID NO:1781, and the wild-type nucleotide sequence encoding the GBA1 protein of SEQ ID NO:1777 were depicted.

[0039] Figures 6A-6B The activities of GBA1 proteins expressed by the following AAV2 vectorized viral genome constructs were compared: GBA_VG1 (SEQ ID NO:1759), GBA_VG17 (SEQ ID NO:1812), and GBA_VG21 (SEQ ID NO:1816).Figure 6A GCase activity (RFU / mL) in GD-II patient fibroblasts treated with MOI 10 4.5 GCase activity (RFU / mL) in GD-II patient fibroblasts treated with MOI 10 Figure 6B GCase activity (RFU / mL) in GD-II patient fibroblasts treated with MOI 10 6 GlcSph (ng / mg Lamp1) in cell lysates from GD-II patient fibroblasts treated with MOI 10

[0040] Figure 7 GCase activity (RFU / mL) in GD-II patient fibroblasts treated with MOI 10 3.5 GCase activity (RFU / mL) in GD-II patient fibroblasts treated with MOI 10 4.5 GCase activity (RFU / mL) in GD-II patient fibroblasts treated with MOI 10

[0041] Figure 8 Biodistribution (VG / cell) and GCase activity (RFU / mL, fold over endogenous GCase activity, normalized to mg protein) in the cortex, striatum, thalamus, brainstem, cerebellum, and liver of wild-type mice one month after intravenous injection of VOY101.GBA_VG17 (SEQ ID NO: 1812) at 2e13 vg / kg.

[0042] Figure 9 Biodistribution (VG / cell) in the cortex, striatum, and brainstem of wild-type mice 28 days after intravenous injection of VOY101.GBA_VG17 (SEQ ID NO: 1812), VOY101.GBA_VG35 (SEQ ID NO: 2006), or VOY101.GBA_VG36 (SEQ ID NO: 2007).

[0043] Figure 10Depiction of GCase activity in the cortex, striatum, and brainstem of wild-type mice 28 days after intravenous injection of VOY101.GBA_VG17 (SEQ ID NO: 1812), VOY101.GBA_VG35 (SEQ ID NO: 2006), or VOY101.GBA_VG36 (SEQ ID NO: 2007).

[0044] Figure 11 Depiction of biodistribution, mRNA expression, and GCase activity in the brainstem and DRG of wild-type mice 28 days after intravenous injection of VOY101.GBA_VG17 (SEQ ID NO: 1812), VOY101.GBA_VG35 (SEQ ID NO: 2006), or VOY101.GBA_VG36 (SEQ ID NO: 2007).

[0045] Figure 12 Depiction of substrate quantification of glucosylceramide and glucosylsphingosine in the brainstem, striatum, and DRG of wild-type mice 28 days after intravenous injection of VOY101.GBA_VG17 (SEQ ID NO: 1812), VOY101.GBA_VG35 (SEQ ID NO: 2006), or VOY101.GBA_VG36 (SEQ ID NO: 2007) by LC-MS / MS.

[0046] Figure 13 Depiction of biodistribution (VG / cell) in the cortex and GCase activity in the cortex, striatum, and brainstem of wild-type mice 28 days after intravenous injection of VOY101.GBA_VG17 (SEQ ID NO: 1812) or VOY101.GBA_VG17-HA.

[0047] Figure 14A Depiction of immunohistochemical analysis of HA expression in the cortex, striatum, and brainstem of wild-type mice 28 days after intravenous injection of VOY101.GBA_VG17 (SEQ ID NO: 1812) or VOY101.GBA_VG17-HA. Figure 14B Depiction of immunohistochemical analysis of HA expression in the cerebellum, thalamus, and hippocampus of wild-type mice 28 days after intravenous injection of VOY101.GBA_VG17 (SEQ ID NO: 1812) or VOY101.GBA_VG17-HA. DETAILED DESCRIPTION SUMMARY

[0048] Described herein, inter alia, are compositions comprising isolated (e.g., recombinant) viral particles (e.g., AAV particles) for use in delivering (e.g., vectorized delivery of) proteins (e.g., GBA1 proteins); and methods of making and using the same. Adeno-associated virus (AAV) is a small, nonenveloped icosahedral capsid virus of the Parvoviridae family, characterized by a single-stranded DNA viral genome. Parvoviridae viruses consist of two subfamilies: Parvovirinae, which infect vertebrates, and Densovirinae, which infect invertebrates. Parvoviridae includes the Dependovirus genus, which includes AAV, capable of replicating in vertebrate hosts including, but not limited to, human, primate, bovine, canine, equine, and ovine species.

[0049] Parvoviruses and other members of the Parvoviridae family are generally described in Kenneth I. Berns, "Parvoviridae: The Viruses and Their Replication," Chapter 69, Fields Virolgy (3rd ed. 1996), the contents of which are incorporated by reference herein in their entirety.

[0050] AAV has proven useful as a biological tool due to its relatively simple structure, its ability to infect a wide range of cells, including quiescent and dividing cells, without integrating into the host genome and without replicating, and its relatively benign immunogenic profile. The genome of the virus can be manipulated to contain the minimal components for assembly of a functional recombinant virus or viral particle that is loaded with a desired payload or engineered to target a particular tissue and express or deliver a desired payload. The genome of the virus can be modified to contain the minimal components for assembly of a functional recombinant virus or viral particle that is loaded with a desired nucleic acid construct or payload or engineered to express or deliver a desired nucleic acid construct or payload, such as a transgene, a polynucleotide encoding a polypeptide, such as a GBA1 protein, such as a GCase, GCase and PSAP, GCase and SapA, or GCase and SapC, GCase and a cell penetrating peptide (such as an ApoEII peptide, a TAT peptide, or an ApoB peptide), or GCase and a lysosomal targeting sequence (LTS), which can be delivered to a target cell, tissue, or organism. In some embodiments, the genome encodes a wild-type GBA1 protein. In some embodiments, the genome comprises a codon-optimized, CpG-reduced (e.g., CpG-depleted) nucleotide sequence encoding a wild-type GBA1 protein, such as compared to a wild-type GBA1-encoding sequence comprising the nucleotide sequence of SEQ ID NO: 1776 or 1777. In some embodiments, the target cell is a CNS cell. In some embodiments, the target tissue is a CNS tissue. The target CNS tissue can be a brain tissue. In some embodiments, the brain target tissue comprises the caudate nucleus, putamen, thalamus, superior colliculus, cortex, and corpus callosum.

[0051] Gene therapy provides an alternative approach to Parkinson’s disease (PD) and related diseases that share a single-gene etiology, such as Gaucher disease and Lewy body dementia and related conditions. AAV is commonly used in gene therapy approaches due to a variety of favorable features. Without wishing to be bound by theory, it is believed that in some embodiments, an expression vector, such as an adeno-associated viral vector (AAV) or AAV particle, such as an AAV particle described herein, can be used to administer and / or deliver a GBA1 protein (such as a GCase and related proteins) in order to achieve sustained high concentrations relative to non-AAV therapies, allowing for more durable efficacy, fewer therapeutic doses, broad biodistribution, and / or more stable GBA1 protein levels.

[0052] The compositions and methods described herein provide improved characteristics compared to previous enzyme replacement methods, including (i) increased GCase activity in cells, tissues (e.g., cells or tissues of the CNS, e.g., cortex, striatum, thalamus, cerebellum, and / or brainstem), and / or bodily fluids (e.g., CSF and / or serum) of the subject; (ii) increased biodistribution throughout the CNS (e.g., cortex, striatum, thalamus, cerebellum, brainstem, and / or spinal cord) and periphery (e.g., liver); and / or (iii) payload expression, e.g., GBA1 mRNA expression, in multiple brain regions (e.g., cortex, thalamus, and brainstem) and periphery (e.g., liver), as demonstrated in the examples herein below. In some embodiments, an AAV viral genome comprising a codon-optimized, CpG-reduced (e.g., CpG-depleted) nucleotide sequence encoding a GBA1 protein (e.g., SEQ ID NO: 2001 or SEQ ID NO: 2002) results in high biodistribution in the CNS; increases GCase activity in the CNS, peripheral tissues, and / or bodily fluids; and successful transgene transcription and expression. The compositions and methods described herein can be used to treat disorders associated with a deficiency in GBA1 protein and / or GCase activity, such as neurologic (affecting the CNS) and non-neurologic (affecting non-CNS) Gaucher disease (e.g., Type 1 GD, Type 2 GD, or Type 3 GD), PD and Lewy body dementia (DLB) associated with mutations in the GBA1 gene. In some embodiments, the disclosure provides an AAV viral genome comprising a codon-optimized, CpG-reduced (e.g., CpG-depleted) nucleotide sequence encoding a GBA1 protein (e.g., a nucleotide sequence comprising SEQ ID NO: 2001 or SEQ ID NO: 2002), which has reduced immunogenicity compared to a codon-optimized sequence comprising one or more or all CpG motifs. I. Compositions Adeno-Associated Virus (AAV) Vectors

[0053] AAV has a genome of about 5,000 nucleotides in length that contains two open reading frames, encoding proteins responsible for replication (Rep) and structural proteins of the capsid (Cap), respectively. The open reading frames are flanked by two inverted terminal repeat (ITR) sequences that serve as the origin of replication for the viral genome. The wild-type AAV viral genome includes nucleotide sequences for two open reading frames, one for four non-structural Rep proteins (Rep78, Rep68, Rep52, Rep40, encoded by the Rep gene), and one for three capsid proteins or structural proteins (VP1, VP2, VP3, encoded by the capsid gene or Cap gene). The Rep proteins are important for replication and encapsidation, while the capsid proteins are assembled to produce the protein shell, or AAV capsid, of AAV. Alternative splicing and alternative start codons and promoters result in the four different Rep proteins from a single open reading frame and the three capsid proteins from a single open reading frame. Although it varies by AAV serotype, as a non-limiting example, for AAV9 / hu.14 (SEQ ID NO: 123 of US 7,906,111, the contents of which are incorporated by reference herein in their entirety), VP1 refers to amino acids 1-736, VP2 refers to amino acids 138-736, and VP3 refers to amino acids 203-736. As another non-limiting example, VP1 refers to amino acids 1-743 numbered according to SEQ ID NO: 1, VP2 refers to amino acids 138-743 numbered according to SEQ ID NO: 1, and VP3 refers to amino acids 203-743 numbered according to SEQ ID NO: 1. In other words, VP1 is the full-length capsid sequence, while VP2 and VP3 are shorter components of the whole. Thus, changes in sequence in the VP3 region are also changes in VP1 and VP2, however, the percent difference of VP3 compared to the parental sequence will be greatest because it is the shortest sequence of the three. Although described herein with respect to amino acid sequences, nucleic acid sequences encoding such proteins can be similarly described. The three capsid proteins assemble together to produce the AAV capsid protein. Although not wishing to be bound by theory, the AAV capsid protein typically includes a molar ratio of VP1:VP2:VP3 of 1:1:10. As used herein, “AAV serotype” is defined primarily by the AAV capsid. In some cases, the ITR is also specifically described by the AAV serotype (e.g., AAV2 / 9).

[0054] AAV vectors typically require a co-factor (e.g., adenovirus) to undergo a productive infection in a cell. In the absence of such helper functions, the AAV virion essentially enters the host cell but does not integrate into the genome of the cell.

[0055] Due to several unique features, AAV vectors have been investigated for use in delivering gene therapy agents. Non-limiting examples of such features include: (i) the ability to infect both dividing and non-dividing cells; (ii) a broad host range of infectivity, including human cells; (iii) wild-type AAV has not been associated with any disease and does not express replication in infected cells; (iv) lack of a cell-mediated immune response against the vector, and (v) the non-integrative nature in the host chromosome, thereby reducing the potential for long-term genetic alteration. In addition, the effects of AAV vector infection on altering the pattern of gene expression of the cell are minimal (Stilwell and Samulski et al., Biotechniques, 2003, 34, 148, the contents of which are incorporated by reference herein in their entirety).

[0056] Generally, the AAV vectors for GCase protein delivery can be recombinant viral vectors that have a replication deficiency due to the lack of sequences encoding functional Rep and Cap proteins within the viral genome. In some cases, the defective AAV vectors can lack most or all of the coding sequences and contain essentially only one or two AAV ITR sequences and a payload sequence. In certain embodiments, the viral genome encodes a GCase protein. In some embodiments, the viral genome encodes a GCase protein and a SapA protein. In some embodiments, the viral genome encodes a GCase protein and a SapC protein. For example, the viral genome can encode a human GCase, a human GCase + SapA, or a human GCase + SapC protein.

[0057] In some embodiments, the viral genome can comprise one or more lysosomal targeting sequences (LTS).

[0058] In some embodiments, the viral genome can comprise one or more cell-penetrating peptide sequences (CPP).

[0059] In some embodiments, the viral genome can comprise one or more lysosomal targeting sequences and one or more cell-penetrating sequences.

[0060] In some embodiments, the AAV particles of the present disclosure can be introduced into a mammalian cell.

[0061] The AAV vectors can be modified to enhance delivery efficiency. Such modified AAV vectors of the present disclosure can be efficiently packaged and used to successfully infect target cells at high frequency and with minimal toxicity.

[0062] In other embodiments, the AAV particles of the present disclosure can be used to deliver GCase proteins to the central nervous system (see, e.g., U.S. Patent No. 6,180,613; the contents of which are incorporated by reference herein in their entirety) or specific tissues of the CNS.

[0063] As used herein, the term "AAV vector" or "AAV particle" includes a capsid and a viral genome, which viral genome includes a payload. As used herein, a "payload" or "payload region" refers to one or more polynucleotides or regions of polynucleotides encoded by or within the viral genome, or expression products of such polynucleotides or regions of polynucleotides, e.g., transgenes, polynucleotides encoding polypeptides or multi-polypeptides, e.g., GCase proteins.

[0064] It is understood that the compositions described herein can have other conservative or non-essential amino acid substitutions that do not materially affect their function. AAV serotype

[0065] AAV particles of the present disclosure can comprise or be derived from any natural or recombinant AAV serotype. In accordance with the present disclosure, AAV particles can utilize or be based on a serotype or comprise a peptide selected from any of: VOY101, VOY201, AAVPHP.B (PHP.B), AAVPHP.A (PHP.A), AAVG2B-26, AAVG2B-13, AAVTH1.1-32, AAVTH1.1-35, AAVPHP.B2 (PHP.B2), AAVPHP.B3 (PHP.B3), AAVPHP.N / PHP.B-DGT, AAVPHP.B-EST, AAVPHP.B-GGT, AAVPHP.B-ATP, AAVPHP.B-ATT-T, AAVPHP.B-DGT-T, AAVPHP.B-GGT-T, AAVPHP.B-SGS, AAVPHP.B-AQP, AAVPHP.B-QQP, AAVPHP.B-SNP(3), AAVPHP.B-SNP, AAVPHP.B-QGT, AAVPHP.B-NQT, AAVPHP.B-EGS, AAVPHP.B-SGN, AAVPHP.B-EGT, AAVPHP.B-DST, AAVPHP.B-DST, AAVPHP.B-STP, AAVPHP.B-PQP, AAVPHP.B-SQP, AAVPHP.B-QLP, AAVPHP.B-TMP, AAVPHP.B-TTP, AAVPHP.S / G2A12, AAVG2A15 / G2A3 (G2A3), AAVG2B4 (G2B4), AAVG2B5 (G2B5), PHP.S, AAV1, AAV2, AAV2G9, AAV3, AAV3a, AAV3b, AAV3-3, AAV4, AAV4-4, AAV5, AAV6, AAV6.1, AAV6.2, AAV6.1.2, AAV7, AAV7.2, AAV8, AAV9, AAV9.11, AAV9.13, AAV9.16, AAV9.24, AAV9.45, AAV9.47, AAV9.61, AAV9.68, AAV9.84, AAV9.9, AAV10, AAV11, AAV12, AAV16.3, AAV24.1, AAV27.3, AAV42.12, AAV42-1b, AAV42-2, AAV42-3a, AAV42-3b, AAV42-4, AAV42-5a, AAV42-5b, AAV42-6b, AAV42-8, AAV42-10, AAV42-11, AAV42-12, AAV42-13, AAV42-15, AAV42-aa, AAV43-1, AAV43-12, AAV43-20,AAV43-21, AAV43-23, AAV43-25, AAV43-5, AAV44.1, AAV44.2, AAV44.5, AAV223.1, AAV223.2, AAV223.4, AAV223.5, AAV223.6, AAV223.7, AAV1-7 / rh.48, AAV1-8 / rh.49, AAV2-15 / rh.62, AAV2-3 / rh.61, AAV2-4 / rh.50, AAV2-5 / rh.51, AAV3.1 / hu.6, AAV3.1 / hu.9, AAV3-9 / rh.52, AAV3-11 / rh.53, AAV4-8 / r11.64, AAV4-9 / rh.54, AAV4-19 / rh.55, AAV5-3 / rh.57, AAV5-22 / rh.58, AAV7.3 / hu.7, AAV16.8 / hu.10, AAV16.12 / hu.11, AAV29.3 / bb.1, AAV29.5 / bb.2, AAV106.1 / hu.37, AAV114.3 / hu.40, AAV127.2 / hu.41, AAV127.5 / hu.42, AAV128.3 / hu.44, AAV130.4 / hu.48, AAV145.1 / hu.53, AAV145.5 / hu.54, AAV145.6 / hu.55, AAV161.10 / hu.60, AAV161.6 / hu.61, AAV33.12 / hu.17, AAV33.4 / hu.15, AAV33.8 / hu.16, AAV52 / hu.19, AAV52.1 / hu.20, AAV58.2 / hu.25, AAV A3.3, AAV A3.4, AAV A3.5, AAV A3.7, AAV C1, AAV C2, AAV C5, AAV-DJ, AAV-DJ8, AAV F3, AAV F5, AAV H2, AAV rh.72, AAV hu.8, AAV rh.68, AAV rh.70, AAV pi.1, AAV pi.3, AAV pi.2, AAV rh.60, AAV rh.44, AAV rh.65, AAV rh.55, AAV rh.47, AAV rh.69, AAV rh.45, AAV rh.59, AAV hu.12, AAV H6, AAV LK03, AAV H-1 / hu.1, AAV H-5 / hu.3, AAV LG-10 / rh.40, AAV LG-4 / rh.38, AAV LG-9 / hu.39, AAV N721-8 / rh.43, AAV Ch.5, AAV Ch.5R1, AAV cy.2, AAV cy.3, AAV cy.4, AAV cy.5,AAVCy.5R1, AAVCy.5R2, AAVCy.5R3, AAVCy.5R4, AAVcy.6, AAVhu.1, AAVhu.2, AAVhu.3, AAVhu.4, AAVhu.5, AAVhu.6, AAVhu.7, AAVhu.9, AAVhu.10, AAVhu.11, AAVhu.13, AAVhu.15, AAVhu.16, AAVhu.17, AAVhu.18, AAVhu.20, AAVhu.21, AAVhu.22, AAVhu.23.2, AAVhu.24, AAVhu.25, AAVhu.27, AAVhu.28, AAVhu.29, AAVhu.29R, AAVhu.31, AAVhu.32, AAVhu.34, AAVhu.35, AAVhu.37, AAVhu.39, AAVhu.40, AAVhu.41, AAVhu.42, AAVhu.43, AAVhu.44, AAVhu.44R1, AAVhu.44R2, AAVhu.44R3, AAVhu.45, AAVhu.46, AAVhu.47, AAVhu.48, AAVhu.48R1, AAVhu.48R2, AAVhu.48R3, AAVhu.49, AAVhu.51, AAVhu.52, AAVhu.54, AAVhu.55, AAVhu.56, AAVhu.57, AAVhu.58, AAVhu.60, AAVhu.61, AAVhu.63, AAVhu.64, AAVhu.66, AAVhu.67, AAVhu.14 / 9, AAVhu.t 19, AAVrh.2, AAVrh.2R, AAVrh.8, AAVrh.8R, AAVrh.10, AAVrh.12, AAVrh.13, AAVrh.13R, AAVrh.14, AAVrh.17, AAVrh.18, AAVrh.19, AAVrh.20, AAVrh.21, AAVrh.22, AAVrh.23, AAVrh.24, AAVrh.25, AAVrh.31, AAVrh.32, AAVrh.33, AAVrh.34, AAVrh.35, AAVrh.36, AAVrh.37, AAVrh.37R2, AAVrh.38, AAVrh.39, AAVrh.40, AAVrh.46, AAVrh.48, AAVrh.48.1, AAVrh.48.1.2, AAVrh.48.2, AAVrh.49, AAVrh.51, AAVrh.52, AAVrh.53, AAVrh.54, AAVrh.56, AAVrh.57,AAVrh.58, AAVrh.61, AAVrh.64, AAVrh.64R1, AAVrh.64R2, AAVrh.67, AAVrh.73, AAVrh.74, AAVrh8R, AAVrh8R A586R mutant, AAVrh8R R533A mutant, AAVV, BAAV, goat AAV, bovine AAV, AAVhE1.1, AAVhEr1.5, AAVhER1.14, AAVhEr1.8, AAVhEr1.16, AAVhEr1.18, AAVhEr1.35, AAVhEr1.7, AAVhEr1.36, AAVhEr2.29, AAVhEr2.4, AAVhEr2.16, AAVhEr2.30, AAVhEr2.31, AAVhEr2.36, AAVhER1.23, AAVhEr3.1, AAV2.5T, AAV-PAEC, AAV-LK01, AAV-LK02, AAV-LK03, AAV-LK04, AAV-LK05, AAV-LK06, AAV-LK07, AAV-LK08, AAV-LK09, AAV-LK10, AAV-LK11, AAV-LK12, AAV-LK13, AAV-LK14, AAV-LK15, AAV-LK16, AAV-LK17, AAV-LK18, AAV-LK19, AAV-PAEC2, AAV-PAEC4, AAV-PAEC6, AAV-PAEC7, AAV-PAEC8, AAV-PAEC11, AAV-PAEC12, AAV-2-pre-miRNA-101, AAV-8h, AAV-8b, AAV-h, AAV-b, AAV SM 10-2, AAV shuffie 100-1, AAV shuffie 100-3, AAV shuffie 100-7, AAV shuffie 10-2, AAV shuffie 10-6, AAV shuffie 10-8, AAV shuffie 100-2, AAV SM 10-1, AAV SM 10-8, AAV SM 100-3, AAV SM 100-10, BNP61 AAV, BNP62 AAV, BNP63 AAV, AAVrh.50, AAVrh.43, AAVrh.62, AAVrh.48, AAVhu.19, AAVhu.11, AAVhu.53, AAV4-8 / rh.64, AAVLG-9 / hu.39, AAV54.5 / hu.23, AAV54.2 / hu.22, AAV54.7 / hu.24, AAV54.1 / hu.21, AAV54.4R / hu.27, AAV46.2 / hu.28, AAV46.6 / hu.29, AAV128.1 / hu.43,True Type AAV (ttAAV), UPENN AAV 10, Japanese AAV 10 serotype, AAV CBr-7.1, AAV CBr-7.10, AAV CBr-7.2, AAV CBr-7.3, AAV CBr-7.4, AAV CBr-7.5, AAV CBr-7.7, AAV CBr-7.8, AAV CBr-B7.3, AAV CBr-B7.4, AAV CBr-E1, AAV CBr-E2, AAV CBr-E3, AAV CBr-E4, AAV CBr-E5, AAV CBr-e5, AAV CBr-E6, AAV CBr-E7, AAV CBr-E8, AAV CHt-1, AAV CHt-2, AAV CHt-3, AAV CHt-6.1, AAV CHt-6.10, AAV CHt-6.5, AAV CHt-6.6, AAV CHt-6.7, AAV CHt-6.8, AAV CHt-P 1, AAV CHt-P2, AAV CHt-P5, AAV CHt-P6, AAV CHt-P8, AAV CHt-P9, AAV CKd-1, AAV CKd-10, AAV CKd-2, AAV CKd-3, AAV CKd-4, AAV CKd-6, AAV CKd-7, AAV CKd-8, AAV CKd-B 1, AAV CKd-B2, AAV CKd-B3, AAV CKd-B4, AAV CKd-B5, AAV CKd-B6, AAV CKd-B7, AAV CKd-B8, AAV CKd-H1, AAV CKd-H2, AAV CKd-H3, AAV CKd-H4, AAV CKd-H5, AAV CKd-H6, AAV CKd-N3, AAV CKd-N4, AAV CKd-N9, AAV CLg-F 1, AAV CLg-F2, AAV CLg-F3, AAV CLg-F4, AAV CLg-F5, AAV CLg-F6, AAV CLg-F7, AAV CLg-F8, AAV CLv-1, AAV CLv1-1, AAV Clv 1-10, AAV CLv1-2, AAV CLv-12, AAV CLv1-3, AAV CLv-13, AAV CLv1-4, AAV Clv1-7, AAV Clv1-8, AAV Clv1-9, AAV CLv-2, AAV CLv-3, AAV CLv-4, AAV CLv-6, AAV CLv-8, AAV CLv-D 1, AAV CLv-D2, AAV CLv-D3, AAV CLv-D4,AAV CLv-D5, AAV CLv-D6, AAV CLv-D7, AAV CLv-D8, AAV CLv-E1, AAV CLv-K1, AAV CLv-K3, AAV CLv-K6, AAV CLv-L4, AAV CLv-L5, AAV CLv-L6, AAV CLv-M1, AAV CLv-M11, AAV CLv-M2, AAV CLv-M5, AAV CLv-M6, AAV CLv-M7, AAV CLv-M8, AAV CLv-M9, AAV CLv-R1, AAV CLv-R2, AAV CLv-R3, AAV CLv-R4, AAV CLv-R5, AAV CLv-R6, AAV CLv-R7, AAV CLv-R8, AAV CLv-R9, AAV CSp-1, AAV CSp-10, AAV CSp-11, AAV CSp-2, AAV CSp-3, AAV CSp-4, AAV CSp-6, AAV CSp-7, AAV CSp-8, AAV CSp-8.10, AAV CSp-8.2, AAV CSp-8.4, AAV CSp-8.5, AAV CSp-8.6, AAV CSp-8.7, AAV CSp-8.8, AAV CSp-8.9, AAV CSp-9, AAV.hu.48R3, AAV.VR-355, AAV3B, AAV4, AAV5, AAVF1 / HSC1, AAVF11 / HSC11, AAVF12 / HSC12, AAVF13 / HSC13, AAVF14 / HSC14, AAVF15 / HSC15, AAVF16 / HSC16, AAVF17 / HSC17, AAVF2 / HSC2, AAVF3 / HSC3, AAVF4 / HSC4, AAVF5 / HSC5, AAVF6 / HSC6, AAVF7 / HSC7, AAVF8 / HSC8, and / or AAVF9 / HSC9, and variants thereof.

[0066] In some embodiments, the AAV serotype can be or have a sequence as described in U.S. Publication No. US20030138772, the contents of which are incorporated by reference herein in their entirety, such as but not limited to AAV1 (SEQ ID NO: 6 and 64 of US20030138772), AAV2 (SEQ ID NO: 7 and 70 of US20030138772), AAV3 (SEQ ID NO: 8 and 71 of US20030138772), AAV4 (SEQ ID NO: 63 of US20030138772), AAV5 (SEQ ID NO: 114 of US20030138772), AAV6 (SEQ ID NO: 65 of US20030138772), AAV7 (SEQ ID NO: 1-3 of US20030138772), AAV8 (SEQ ID NO: 4 and 95 of US20030138772), AAV9 (SEQ ID NO: 5 and 100 of US20030138772), AAV10 (SEQ ID NO: 117 of US20030138772), AAV11 (SEQ ID NO: 118 of US20030138772), AAV12 (SEQ ID NO: 119 of US20030138772), AAVrh10 (amino acids 1 to 738 of SEQ ID NO: 81 of US20030138772), AAV16.3 (SEQ ID NO: 10 of US20030138772), AAV29.3 / bb.1 (SEQ ID NO: 11 of US20030138772), AAV29.4 (SEQ ID NO: 12 of US20030138772), AAV29.5 / bb.2 (SEQ ID NO: 13 of US20030138772), AAV1.3 (SEQ ID NO: 14 of US20030138772), AAV13.3 (SEQ ID NO: 15 of US20030138772), AAV24.1 (SEQ ID NO: 16 of US20030138772), AAV27.3 (SEQ ID NO: 17 of US20030138772), AAV7.2 (SEQ ID NO: 18 of US20030138772), AAVC1 (SEQ ID NO: 19 of US20030138772), AAVC3 (SEQ ID NO: 20 of US20030138772), AAVC5 (SEQ ID NO: 21 of US20030138772), AAVF1 (SEQ ID NO: 22 of US20030138772), AAVF2 (SEQ ID NO: 23 of US20030138772), AAVF3 (SEQ ID NO: 24 of US20030138772), AAVF4 (SEQ ID NO: 25 of US20030138772), AAVF5 (SEQ ID NO: 26 of US20030138772), AAVF6 (SEQ ID NO: 27 of US20030138772), AAVF7 (SEQ ID NO: 28 of US20030138772), AAVF8 (SEQ ID NO: 29 of US20030138772), AAVF9 (SEQ ID NO: 30 of US20030138772), AAVF10 (SEQ ID NO: 31 of US20030138772), AAVF11 (SEQ ID NO: 32 of US20030138772), AAVF12 (SEQ ID NO: 33 of US20030138772), AAVF13 (SEQ ID NO: 34 of US20030138772), AAVF14 (SEQ ID NO: 35 of US20030138772), AAVF15 (SEQ ID NO: 36 of US20030138772), AAVF16 (SEQ ID NO: 37 of US20030138772), AAVF17 (SEQ ID NO: 38 of US20030138772), AAVF18 (SEQ ID NO: 39 of US20030138772), AAVF19 (SEQ ID NO: 40 of US20030138772), AAVF20 (SEQ ID NO: 41 of US20030138772), AAVF21 (SEQ ID NO: 42 of US20030138772), AAVF22 (SEQ ID NO: 43 of US20030138772), AAVF23 (SEQ ID NO: 44 of US20030138772), AAVF24 (SEQ ID NO: 45 of US20030138772), AAVF25 (SEQ ID NO: 46 of US20030138772), AAVF26 (SEQ ID NO: 47 of US20030138772), AAVAAV2 (US20030138772 SEQ ID NO: 22), AAVF3 (US20030138772 SEQ ID NO: 23), AAVF5 (US20030138772 SEQ ID NO: 24), AAVH6 (US20030138772 SEQ ID NO: 25), AAVH2 (US20030138772 SEQ ID NO: 26), AAV42-8 (US20030138772 SEQ ID NO: 27), AAV42-15 (US20030138772 SEQ ID NO: 28), AAV42-5b (US20030138772 SEQ ID NO: 29), AAV42-1b (US20030138772 SEQ ID NO: 30), AAV42-13 (US20030138772 SEQ ID NO: 31), AAV42-3a (US20030138772 SEQ ID NO: 32), AAV42-4 (US20030138772 SEQ ID NO: 33), AAV42-5a (US20030138772 SEQ ID NO: 34), AAV42-10 (US20030138772 SEQ ID NO: 35), AAV42-3b (US20030138772 SEQ ID NO: 36), AAV42-11 (US20030138772 SEQ ID NO: 37), AAV42-6b (US20030138772 SEQ ID NO: 38), AAV43-1 (US20030138772 SEQ ID NO: 39), AAV43-5 (US20030138772 SEQ ID NO: 40), AAV43-12 (US20030138772 SEQ ID NO: 41), AAV43-20 (US20030138772 SEQ ID NO: 42), AAV43-21 (US20030138772 SEQ ID NO: 43), AAV43-23 (US20030138772 SEQ ID NO: 44), AAV43-25 (US20030138772 SEQ ID NO: 45), AAV44.1 (US20030138772 SEQ ID NO: 46), AAV44.5 (US20030138772 SEQ ID NO: 47), AAV223.1 (US20030138772 SEQ ID NO: 48), AAV223.2 (US20030138772 SEQ IDAAV223.4 (US20030138772 SEQ ID NO: 50), AAV223.5 (US20030138772 SEQ ID NO: 51), AAV223.6 (US20030138772 SEQ ID NO: 52), AAV223.7 (US20030138772 SEQ ID NO: 53), AAV A3.4 (US20030138772 SEQ ID NO: 54), AAV A3.5 (US20030138772 SEQ ID NO: 55), AAV A3.7 (US20030138772 SEQ ID NO: 56), AAV A3.3 (US20030138772 SEQ ID NO: 57), AAV 42.12 (US20030138772 SEQ ID NO: 58), AAV 44.2 (US20030138772 SEQ ID NO: 59), AAV 42-2 (US20030138772 SEQ ID NO: 9), or a variant thereof.

[0067] In some embodiments, the AAV serotype can be or have a sequence as described in U.S. Publication No. US20150159173, the contents of which are incorporated by reference in their entirety herein, such as but not limited to AAV2 (SEQ ID NO: 7 and 23 of US20150159173), rh20 (SEQ ID NO: 1 of US20150159173), rh32 / 33 (SEQ ID NO: 2 of US20150159173), rh39 (SEQ ID NO: 3, 20 and 36 of US20150159173), rh46 (SEQ ID NO: 4 and 22 of US20150159173), rh73 (SEQ ID NO: 5 of US20150159173), rh74 (SEQ ID NO: 6 of US20150159173), AAV6.1 (SEQ ID NO: 29 of US20150159173), rh.8 (SEQ ID NO: 41 of US20150159173), rh.48.1 (SEQ ID NO: 44 of US20150159173), hu.44 (SEQ ID NO: 45 of US20150159173), hu.29 (SEQ ID NO: 42 of US20150159173), hu.48 (SEQ ID NO: 38 of US20150159173), rh54 (SEQ ID NO: 49 of US20150159173), AAV2 (SEQ ID NO: 7 of US20150159173), cy.5 (SEQ ID NO: 8 and 24 of US20150159173), rh.10 (SEQ ID NO: 9 and 25 of US20150159173), rh.13 (SEQ ID NO: 10 and 26 of US20150159173), AAV1 (SEQ ID NO: 11 and 27 of US20150159173), AAV3 (SEQ ID NO: 12 and 28 of US20150159173), AAV6 (SEQ ID NO: 13 and 29 of US20150159173), AAV7 (SEQ ID NO: 14 and 30 of US20150159173), AAV8 (SEQ ID NO: 15 and 31 of US20150159173), hu.13 (SEQ ID NO: 16 and 32 of US20150159173), hu.26 (SEQ ID NO: 17 and 33 of US20150159173), hu.37 (SEQ ID NO: 18 and 34 of US20150159173), hu.53 (SEQ ID NO: 19 and 35 of US20150159173), rh.43 (SEQ ID NO: 21 and 37 of US20150159173), rh2 (SEQ ID NO: 39 of US20150159173), rh.37 (SEQ ID NO: 40 of US20150159173), rh.64 (SEQ ID NO: 43 of US20150159173), rh.48 (SEQ ID NO: 44 of US20150159173), ch.5 (SEQ ID NO 46 of US20150159173), rh.67 (SEQ ID NO: 47 of US20150159173), rh.58 (SEQ ID NO: 48 of US20150159173), or variants thereof, including but not limited to Cy5R1, Cy5R2, Cy5R3, Cy5R4, rh.13R, rh.37R2, rh.2R, rh.8R, rh.48.1, rh.48.2, rh.48.1.2, hu.44R1, hu.44R2, hu.44R3, hu.29R, ch.5R1, rh64R1, rh64R2, AAV6.2, AAV6.1, AAV6.12, hu.48R1, hu.48R2, and hu.48R3.

[0068] In some embodiments, the AAV serotype can be or have a sequence as described in U.S. Patent No. US 7198951, the contents of which are incorporated by reference herein in their entirety, such as but not limited to AAV9 (SEQ ID NO: 1-3 of US 7198951), AAV2 (SEQ ID NO: 4 of US 7198951), AAV1 (SEQ ID NO: 5 of US 7198951), AAV3 (SEQ ID NO: 6 of US 7198951), and AAV8 (SEQ ID NO: 7 of US 7198951).

[0069] In some embodiments, the AAV serotype can be or have a mutation in the AAV9 sequence as described by N Pulicherla et al. (Molecular Therapy 19(6): 1070-1078 (2011), which is incorporated by reference herein in its entirety), such as but not limited to AAV9.9, AAV9.11, AAV9.13, AAV9.16, AAV9.24, AAV9.45, AAV9.47, AAV9.61, AAV9.68, AAV9.84.

[0070] In some embodiments, the AAV serotype can be or have a sequence as described in U.S. Patent No. US 6156303, the contents of which are incorporated by reference herein in their entirety, such as but not limited to AAV3B (SEQ ID NO: 1 and 10 of US 6156303), AAV6 (SEQ ID NO: 2, 7 and 11 of US 6156303), AAV2 (SEQ ID NO: 3 and 8 of US 6156303), AAV3A (SEQ ID NO: 4 and 9 of US 6156303), or derivatives thereof.

[0071] In some embodiments, the AAV serotype can be or have a sequence as described in U.S. Publication No. US20140359799, the contents of which are incorporated by reference herein in their entirety, such as but not limited to AAV8 (US20140359799 of SEQ ID NO: 1), AAVDJ (US20140359799 of SEQ ID NO: 2 and 3), or variants thereof.

[0072] In some embodiments, the serotype can be AAVDJ or a variant thereof, such as AAVDJ8 (or AAV-DJ8), as described by Grimm et al. (Journal of Virology 82(12): 5887-5911 (2008), which is incorporated by reference herein in its entirety). The amino acid sequence of AAVDJ8 can include two or more mutations in order to remove the heparin binding domain (HBD). As a non-limiting example, the AAV-DJ sequence described as SEQ ID NO: 1 in U.S. Patent No. 7,588,772 (the contents of which are incorporated by reference herein in their entirety) can include two mutations: (1) R587Q, where the arginine (R; Arg) at amino acid 587 is changed to glutamine (Q; Gin); and (2) R590T, where the arginine (R; Arg) at amino acid 590 is changed to threonine (T; Thr). As another non-limiting example, three mutations can be included: (1) K406R, where the lysine (K; Lys) at amino acid 406 is changed to arginine (R; Arg); (2) R587Q, where the arginine (R; Arg) at amino acid 587 is changed to glutamine (Q; Gin); and (3) R590T, where the arginine (R; Arg) at amino acid 590 is changed to threonine (T; Thr).

[0073] In some embodiments, the AAV serotype can be or have a sequence of AAV4 as described in International Publication No. WO1998011244, the contents of which are incorporated by reference herein in their entirety, such as but not limited to AAV4 (SEQ ID NOs: 1-20 of WO1998011244).

[0074] In some embodiments, the AAV serotype can be or have a mutation in the AAV2 sequence to produce AAV2 G9 as described in International Publication No. WO2014144229, the contents of which are incorporated by reference herein in their entirety.

[0075] In some embodiments, the AAV serotype can be or have a sequence as described in International Publication No. WO2005033321, the contents of which are incorporated by reference herein in their entirety, such as but not limited to AAV3-3 (SEQ ID NO: 217 of WO2005033321), AAV1 (SEQ ID NO: 219 and 202 of WO2005033321), AAV106.1 / hu.37 (SEQ ID No: 10 of WO2005033321), AAV114.3 / hu.40 (SEQ ID No: 11 of WO2005033321), AAV127.2 / hu.41 (SEQ ID NO: 6 and 8 of WO2005033321), AAV128.3 / hu.44 (SEQ ID No: 81 of WO2005033321), AAV130.4 / hu.48 (SEQ ID NO: 78 of WO2005033321), AAV145.1 / hu.53 (SEQ ID No: 176 and 177 of WO2005033321), AAV145.6 / hu.56 (SEQ ID NO: 168 and 192 of WO2005033321), AAV16.12 / hu.11 (SEQ ID NO: 153 and 57 of WO2005033321), AAV16.8 / hu.10 (SEQ ID NO: 156 and 56 of WO2005033321), AAV161.10 / hu.60 (SEQ ID No: 170 of WO2005033321), AAV161.6 / hu.61 (SEQ ID No: 174 of WO2005033321), AAV1-7 / rh.48 (SEQ ID NO: 32 of WO2005033321), AAV1-8 / rh.49 (SEQ ID NO: 103 and 25 of WO2005033321), AAV2 (SEQ ID NO: 211 and 221 of WO2005033321), AAV2-15 / rh.62 (SEQ ID No: 33 and 114 of WO2005033321), AAV2-3 / rh.61 (SEQ ID NO: 21 of WO2005033321), AAV2-4 / rh.50 (SEQ ID No: 23 and 108 of WO2005033321), AAV2-5 / rh.51 (SEQ ID NO: 104 and 22 of WO2005033321), AAV3.1 / hu.6 (SEQ ID NO: 5 and 84 of WO2005033321), AAV3.1 / hu.9 (SEQ ID NO: 155 and 58 of WO2005033321), AAV3-11 / rh.53 (SEQ ID NO: 186 and 176 of WO2005033321), AAV3-3 (SEQ ID NO: 200 of WO2005033321), AAV33.12 / hu.17 (SEQ ID NO: 4 of WO2005033321), AAV33.4 / hu.15 (SEQ ID No: 50 of WO2005033321), AAV33.8 / hu.16 (SEQ ID No: 51 of WO2005033321), AAV3-9 / rh.52 (SEQ ID NO: 96 and 18 of WO2005033321), AAV4-19 / rh.55 (SEQ ID NO: 117 of WO2005033321), AAV4-4 (SEQ ID NO: 201 and 218 of WO2005033321), AAV4-9 / rh.54 (SEQ ID NO: 116 of WO2005033321), AAV5 (SEQ ID NO: 199 and 216 of WO2005033321), AAV52.1 / hu.20 (SEQ ID NO: 63 of WO2005033321), AAV52 / hu.19 (SEQ ID NO: 133 of WO2005033321), AAV5-22 / rh.58 (SEQ ID No: 27 of WO2005033321), AAV5-3 / rh.57 (SEQ ID NO: 105 of WO2005033321), AAV5-3 / rh.57 (SEQ ID No: 26 of WO2005033321), AAV58.2 / hu.25 (SEQ ID No: 49 of WO2005033321), AAV6 (SEQ ID NO: 203 and 220 of WO2005033321), AAV7 (SEQ ID NO: 222 and 213 of WO2005033321), AAV7.3 / hu.7 (SEQ ID No: 55 of WO2005033321), AAV8 (SEQ ID NO: 223 and 214 of WO2005033321), AAVH-1 / hu.1 (SEQ ID No: 46 of WO2005033321), AAVH-5 / hu.3 (SEQ ID No: 44 of WO2005033321), AAVhu.1 (SEQ ID NO: 144 of WO2005033321), AAVhu.10 (SEQ ID NO: 156 of WO2005033321), AAVhu.11 (SEQ ID NO: 153 of WO2005033321), AAVhu.12 (SEQ ID NO: 59 of WO2005033321), AAVhu.13 (SEQ ID NO: 129 of WO2005033321), AAVhu.14 / AAV9 (SEQ ID NO: 123 and 3 of WO2005033321), AAVhu.15 (SEQ ID NO: 147 of WO2005033321), AAVhu.16 (SEQ ID NO: 148 of WO2005033321), AAVhu.17 (SEQ ID NO: 83 of WO2005033321), AAVhu.18 (SEQ ID NO: 149 of WO2005033321), AAVhu.19 (SEQ ID NO: 133 of WO2005033321), AAVhu.2 (SEQ ID NO: 143 of WO2005033321), AAVhu.20 (SEQ ID NO: 134 of WO2005033321), AAVhu.21 (SEQ ID NO: 135 of WO2005033321), AAVhu.22 (SEQ ID NO: 138 of WO2005033321), AAVhu.23.2 (SEQ ID NO: 137 of WO2005033321), AAVhu.24 (SEQ ID NO: 136 of WO2005033321), AAVhu.25 (SEQ ID NO: 146 of WO2005033321), AAVhu.27 (SEQ ID NO: 140 of WO2005033321), AAVhu.29 (SEQ ID NO: 132 of WO2005033321), AAVhu.3 (SEQ ID NO: 145 of WO2005033321), AAVhu.31 (SEQ ID NO: 121 of WO2005033321), AAVhu.32 (SEQ ID NO: 122 of WO2005033321), AAVhu.34 (SEQ ID NO: 125 of WO2005033321), AAVhu.35 (SEQ ID NO: 164 of WO2005033321), AAVhu.37 (SEQ ID NO: 88 of WO2005033321), AAVhu.39 (SEQ ID NO: 102 of WO2005033321), AAVhu.4 (SEQ ID NO: 141 of WO2005033321), AAVhu.40 (SEQ ID NO: 87 of WO2005033321), AAVhu.41 (SEQ ID NO:91 of WO2005033321), AAVhu.42 (SEQ ID NO:85 of WO2005033321), AAVhu.43 (SEQ ID NO:160 of WO2005033321), AAVhu.44 (SEQ ID NO:144 of WO2005033321), AAVhu.45 (SEQ ID NO:127 of WO2005033321), AAVhu.46 (SEQ ID NO:159 of WO2005033321), AAVhu.47 (SEQ ID NO:128 of WO2005033321), AAVhu.48 (SEQ ID NO:157 of WO2005033321), AAVhu.49 (SEQ ID NO:189 of WO2005033321), AAVhu.51 (SEQ ID NO:190 of WO2005033321), AAVhu.52 (SEQ ID NO:191 of WO2005033321), AAVhu.53 (SEQ ID NO:186 of WO2005033321), AAVhu.54 (SEQ ID NO:188 of WO2005033321), AAVhu.55 (SEQ ID NO:187 of WO2005033321), AAVhu.56 (SEQ ID NO:192 of WO2005033321), AAVhu.57 (SEQ ID NO:193 of WO2005033321), AAVhu.58 (SEQ ID NO:194 of WO2005033321), AAVhu.6 (SEQ ID NO:84 of WO2005033321), AAVhu.60 (SEQ ID NO:184 of WO2005033321), AAVhu.61 (SEQ ID NO:185 of WO2005033321), AAVhu.63 (SEQ ID NO:195 of WO2005033321), AAVhu.64 (SEQ ID NO:196 of WO2005033321), AAVhu.66 (SEQ ID NO:197 of WO2005033321), AAVhu.67 (SEQ ID NO:198 of WO2005033321), AAVhu.7 (SEQ ID NO:150 of WO2005033321), AAVhu.8 (SEQ ID NO:12 of WO2005033321), AAVhu.9 (SEQ ID NO:155 of WO2005033321), AAVLG-10 / rh.40 (WO2005033321 SEQ ID No: 14), AAVLG-4 / rh.38 (WO2005033321 SEQ ID No: 86), AAVLG-4 / rh.38 (WO2005033321 SEQ ID No: 7), AAVN721-8 / rh.43 (WO2005033321 SEQ ID NO: 163), AAVN721-8 / rh.43 (WO2005033321 SEQ ID No: 43), AAVpi.1 (WO2005033321 SEQ ID NO: 28), AAVpi.2 (WO2005033321 SEQ ID NO: 30), AAVpi.3 (WO2005033321 SEQ ID NO: 29), AAVrh.38 (WO2005033321 SEQ ID NO: 86), AAVrh.40 (WO2005033321 SEQ ID NO: 92), AAVrh.43 (WO2005033321 SEQ ID NO: 163), AAVrh.44 (WO2005033321 SEQ ID NO: 34), AAVrh.45 (WO2005033321 SEQ ID NO: 41), AAVrh.47 (WO2005033321 SEQ ID NO: 38), AAVrh.48 (WO2005033321 SEQ ID NO: 115), AAVrh.49 (WO2005033321 SEQ ID NO: 103), AAVrh.50 (WO2005033321 SEQ ID NO: 108), AAVrh.51 (WO2005033321 SEQ ID NO: 104), AAVrh.52 (WO2005033321 SEQ ID NO: 96), AAVrh.53 (WO2005033321 SEQ ID NO: 97), AAVrh.55 (WO2005033321 SEQ ID NO: 37), AAVrh.56 (WO2005033321 SEQ ID NO: 152), AAVrh.57 (WO2005033321 SEQ ID NO: 105), AAVrh.58 (WO2005033321 SEQ ID NO: 106), AAVrh.59 (WO2005033321 SEQ ID NO: 42), AAVrh.60 (WO2005033321 SEQ ID NO: 31), AAVrh.61 (WO2005033321 SEQ ID NO: 107), AAVrh.62 (SEQ ID NO: 114 of WO2005033321), AAVrh.64 (SEQ ID NO: 99 of WO2005033321), AAVrh.65 (SEQ ID NO: 35 of WO2005033321), AAVrh.68 (SEQ ID NO: 16 of WO2005033321), AAVrh.69 (SEQ ID NO: 39 of WO2005033321), AAVrh.70 (SEQ ID NO: 20 of WO2005033321), AAVrh.72 (SEQ ID NO: 9 of WO2005033321), or variants thereof, including but not limited to AAVcy.2, AAVcy.3, AAVcy.4, AAVcy.5, AAVcy.6, AAVrh.12, AAVrh.17, AAVrh.18, AAVrh.19, AAVrh.21, AAVrh.22, AAVrh.23, AAVrh.24, AAVrh.25, AAVrh.25 / 42 15, AAVrh.31, AAVrh.32, AAVrh.33, AAVrh.34, AAVrh.35, AAVrh.36, AAVrh.37, AAVrh14. Non-limiting examples of variants include SEQ ID NOs: 13, 15, 17, 19, 24, 36, 40, 45, 47, 48, 51-54, 60-62, 64-77, 79, 80, 82, 89, 90, 93-95, 98, 100, 101, 109-113, 118-120, 124, 126, 131, 139, 142, 151, 154, 158, 161, 162, 165-183, 202, 204-212, 215, 219, 224-236 of WO2005033321, the contents of which are incorporated by reference in their entirety herein.

[0076] In some embodiments, the AAV serotype can be or have a sequence as described in International Publication No. WO2015168666, the contents of which are incorporated by reference in their entirety herein, such as but not limited to AAVrh8R (SEQ ID NO: 9 of WO2015168666), AAVrh8R A586R mutant (SEQ ID NO: 10 of WO2015168666), AAVrh8R R533A mutant (SEQ ID NO: 11 of WO2015168666), or variants thereof.

[0077] In some embodiments, the AAV serotype can be or have a sequence as described in U.S. Patent No. US9233131, the contents of which are incorporated by reference in their entirety herein, such as but not limited to AAVhEl.l (SEQ ID NO: 44 of US9233131), AAVhEr1.5 (SEQ ID NO: 45 of US9233131), AAVhER1.14 (SEQ ID NO: 46 of US9233131), AAVhEr1.8 (SEQ ID NO: 47 of US9233131), AAVhEr1.16 (SEQ ID NO: 48 of US9233131), AAVhEr1.18 (SEQ ID NO: 49 of US9233131), AAVhEr1.35 (SEQ ID NO: 50 of US9233131), AAVhEr1.7 (SEQ ID NO: 51 of US9233131), AAVhEr1.36 (SEQ ID NO: 52 of US9233131), AAVhEr2.29 (SEQ ID NO: 53 of US9233131), AAVhEr2.4 (SEQ ID NO: 54 of US9233131), AAVhEr2.16 (SEQ ID NO: 55 of US9233131), AAVhEr2.30 (SEQ ID NO: 56 of US9233131), AAVhEr2.31 (SEQ ID NO: 58 of US9233131), AAVhEr2.36 (SEQ ID NO: 57 of US9233131), AAVhER1.23 (SEQ ID NO: 53 of US9233131), AAVhEr3.1 (SEQ ID NO: 59 of US9233131), AAV2.5T (SEQ ID NO: 42 of US9233131), or variants thereof.

[0078] In some embodiments, the AAV serotype can be or have a sequence as described in U.S. Patent Publication No. US20150376607, the contents of which are incorporated by reference herein in their entirety, such as but not limited to AAV-PAEC (SEQ ID NO: 1 of US20150376607), AAV-LK01 (SEQ ID NO: 2 of US20150376607), AAV-LK02 (SEQ ID NO: 3 of US20150376607), AAV-LK03 (SEQ ID NO: 4 of US20150376607), AAV-LK04 (SEQ ID NO: 5 of US20150376607), AAV-LK05 (SEQ ID NO: 6 of US20150376607), AAV-LK06 (SEQ ID NO: 7 of US20150376607), AAV-LK07 (SEQ ID NO: 8 of US20150376607), AAV-LK08 (SEQ ID NO: 9 of US20150376607), AAV-LK09 (SEQ ID NO: 10 of US20150376607), AAV-LK10 (SEQ ID NO: 11 of US20150376607), AAV-LK11 (SEQ ID NO: 12 of US20150376607), AAV-LK12 (SEQ ID NO: 13 of US20150376607), AAV-LK13 (SEQ ID NO: 14 of US20150376607), AAV-LK14 (SEQ ID NO: 15 of US20150376607), AAV-LK15 (SEQ ID NO: 16 of US20150376607), AAV-LK16 (SEQ ID NO: 17 of US20150376607), AAV-LK17 (SEQ ID NO: 18 of US20150376607), AAV-LK18 (SEQ ID NO: 19 of US20150376607), AAV-LK19 (SEQ ID NO: 20 of US20150376607), AAV-PAEC2 (SEQ ID NO: 21 of US20150376607), AAV-PAEC4 (SEQ ID NO: 22 of US20150376607), AAV-PAEC6 (SEQ ID NO: 23 of US20150376607), AAV-PAEC7 (SEQ ID NO: 24 of US20150376607), AAV-PAEC8 (SEQ ID NO: 25 of US20150376607), AAV-PAEC9 (SEQ ID NO: 26 of US20150376607), AAV-PAEC10 (SEQ ID NO: 27 of US20150376607), AAV-PAEC11 (SEQ ID NO: 28 of US20150376607), AAV-PAEC12 (SEQ ID NO: 29 of US20150376607), AAV-PAEC13 (SEQ ID NO: 30 of US20150376607), AAV-PAEC14 (SEQ ID NO: 31 of US20150376607), AAV-PAEC15 (SEQ ID NO: 32 of US20150376607), AAV-PAEC16 (SEQ ID NO: 33 of US20150376607), AAV-PAEC17 (SEQ ID NO: 34 of US20150376607), AAV-PAEC18 (SEQ ID NO: 35 of US20150376607), AAV-PAEC19 (SEQ ID NO: 36 of US20150376607), AAV-PAEC20 (SEQ ID NO: 37 of US20150376607), AAV-PAEC21 (SEQ ID NO: 38 of US20150376607), AAV-PAEC22 (SEQ ID NO: 39 of US20150376607), AAV-PAEC23 (SEQ ID NO: 40 of US20150376607), AAV-PAEC24 (SEQ ID NO: 41 of US20150376607), AAV-PAEC25 (SEQ ID NO: 42 of US20150376607), AAV-PAEC26 (SEQ ID NO: 43 of US20150376607), AAV-PAEC27 (SEQ ID NO: 44 of US20150376607), AAV-PAEC28 (SEQ ID NO: 45 of US20150376607), AAV-PAEC29 (SEQ ID NO: 46 of US20150376607), AAV-PAEC30 (SEQ ID NO: 47 of US20150376607), AAV-PAEC31 (SEQ ID NO: 48 of US20150376607), AAV-PAEC32 (SEQ ID NO: 49 of US20150376607), AAVAAV-PAEC11 (SEQ ID NO: 26 of US20150376607), AAV-PAEC12 (SEQ ID NO: 27 of US20150376607), or a variant thereof.

[0079] In some embodiments, the AAV serotype can be or have a sequence as described in U.S. Patent No. US9163261, the contents of which are incorporated by reference in their entirety herein, such as but not limited to AAV-2-pre-miRNA-101 (SEQ ID NO: 1 US9163261), or a variant thereof.

[0080] In some embodiments, the AAV serotype can be or have a sequence as described in U.S. Patent Publication No. US20150376240, the contents of which are incorporated by reference in their entirety herein, such as but not limited to AAV-8h (SEQ ID NO: 6 of US20150376240), AAV-8b (SEQ ID NO: 5 of US20150376240), AAV-h (SEQ ID NO: 2 of US20150376240), AAV-b (SEQ ID NO: 1 of US20150376240), or a variant thereof.

[0081] In some embodiments, the AAV serotype can be or have a sequence as described in U.S. Patent Publication No. US20160017295, the contents of which are incorporated by reference in their entirety herein, such as but not limited to AAV SM 10-2 (SEQ ID NO: 22 of US20160017295), AAV Shuffie 100-1 (SEQ ID NO: 23 of US20160017295), AAV Shuffie 100-3 (SEQ ID NO: 24 of US20160017295), AAV Shuffie 100-7 (SEQ ID NO: 25 of US20160017295), AAV Shuffie 10-2 (SEQ ID NO: 34 of US20160017295), AAV Shuffie 10-6 (SEQ ID NO: 35 of US20160017295), AAV Shuffie 10-8 (SEQ ID NO: 36 of US20160017295), AAV Shuffie 100-2 (SEQ ID NO: 37 of US20160017295), AAV SM 10-1 (SEQ ID NO: 38 of US20160017295), AAV SM 10-8 (SEQ ID NO: 39 of US20160017295), AAV SM 100-3 (SEQ ID NO: 40 of US20160017295), AAV SM 100-10 (SEQ ID NO: 41 of US20160017295), or variants thereof.

[0082] In some embodiments, the AAV serotype can be or have a sequence as described in U.S. Patent Publication No. US20150238550, the contents of which are incorporated by reference in their entirety herein, such as but not limited to BNP61 AAV (SEQ ID NO: 1 of US20150238550), BNP62 AAV (SEQ ID NO: 3 of US20150238550), BNP63 AAV (SEQ ID NO: 4 of US20150238550), or variants thereof.

[0083] In some embodiments, the AAV serotype can be or can have a sequence as described in U.S. Patent Publication No. US20150315612, the contents of which are incorporated by reference in their entirety herein, such as but not limited to AAVrh.50 (SEQ ID NO: 108 of US20150315612), AAVrh.43 (SEQ ID NO: 163 of US20150315612), AAVrh.62 (SEQ ID NO: 114 of US20150315612), AAVrh.48 (SEQ ID NO: 115 of US20150315612), AAVhu.19 (SEQ ID NO: 133 of US20150315612), AAVhu.11 (SEQ ID NO: 153 of US20150315612), AAVhu.53 (SEQ ID NO: 186 of US20150315612), AAV4-8 / rh.64 (SEQ ID NO: 15 of US20150315612), AAVLG-9 / hu.39 (SEQ ID NO: 24 of US20150315612), AAV54.5 / hu.23 (SEQ ID NO: 60 of US20150315612), AAV54.2 / hu.22 (SEQ ID NO: 67 of US20150315612), AAV54.7 / hu.24 (SEQ ID NO: 66 of US20150315612), AAV54.1 / hu.21 (SEQ ID NO: 65 of US20150315612), AAV54.4R / hu.27 (SEQ ID NO: 64 of US20150315612), AAV46.2 / hu.28 (SEQ ID NO: 68 of US20150315612), AAV46.6 / hu.29 (SEQ ID NO: 69 of US20150315612), AAV128.1 / hu.43 (SEQ ID NO: 80 of US20150315612), or variants thereof.

[0084] In some embodiments, the AAV serotype can be or have a sequence as described in International Publication No. WO2015121501, the contents of which are incorporated by reference in their entirety herein, such as but not limited to true type AAV (ttAAV) (SEQ ID NO: 2 of WO2015121501), “UPenn AAV10” (SEQ ID NO: 8 of WO2015121501), “Japanese AAV10” (SEQ ID NO: 9 of WO2015121501), or variants thereof.

[0085] According to the present disclosure, AAV capsid serotypes from various species can be selected or used. In some embodiments, the AAV can be an avian AAV (AAAV). The AAAV serotype can be or have a sequence as described in U.S. Patent No. US 9238800, the contents of which are incorporated by reference in their entirety herein, such as but not limited to AAAV (US 9,238,800 SEQ ID NOs: 1, 2, 4, 6, 8, 10, 12, and 14), or variants thereof.

[0086] In some embodiments, the AAV can be a bovine AAV (BAAV). The BAAV serotype can be or have a sequence as described in U.S. Patent No. US 9,193,769, the contents of which are incorporated by reference in their entirety herein, such as but not limited to BAAV (US 9193769 SEQ ID NOs: 1 and 6), or variants thereof. The BAAV serotype can be or have a sequence as described in U.S. Patent No. US7427396, the contents of which are incorporated by reference in their entirety herein, such as but not limited to BAAV (US7427396 SEQ ID NOs: 5 and 6), or variants thereof.

[0087] In some embodiments, the AAV can be a goat AAV. The goat AAV serotype can be or have a sequence as described in U.S. Patent No. US7427396, the contents of which are incorporated by reference in their entirety herein, such as but not limited to goat AAV (US7427396 SEQ ID NO: 3), or variants thereof.

[0088] In other embodiments, the AAV can be engineered as a hybrid AAV from two or more parental serotypes. In some embodiments, the AAV can be AAV2G9, comprising sequences from AAV2 and AAV9. The AAV2G9 AAV serotype can be or have a sequence as described in U.S. Patent Publication No. US20160017005, the contents of which are incorporated by reference in their entirety herein.

[0089] In some embodiments, the AAV can be a serotype generated from an AAV9 capsid library with mutations in amino acids 390-627 (VP1 numbering), as described by Pulicherla et al. (Molecular Therapy 19(6): 1070-1078 (2011)), the contents of which are incorporated by reference in their entirety herein. Serotypes and corresponding nucleotide and amino acid substitutions can be, but are not limited to, AAV9.1 (G1594C; D532H), AAV6.2 (T1418A and T1436X; V473D and I479K), AAV9.3 (T1238A; F413Y), AAV9.4 (T1250C and A1617T; F417S), AAV9.5 (A1235G, A1314T, A1642G, C1760T; Q412R, T548A, A587V), AAV9.6 (T1231A; F411I), AAV9.9 (G1203A, G1785T; W595C), AAV9.10 (A1500G, T1676C; M559T), AAV9.11 (A1425T, A1702C, A1769T; T568P, Q590L), AAV9.13 (A1369C, A1720T; N457H, T574S), AAV9.14 (T1340A, T1362C, T1560C, G1713A; L447H), AAV9.16 (A1775T; Q592L), AAV9.24 (T1507C, T1521G; W503R), AAV9.26 (A1337G, A1769C; Y446C, Q590P), AAV9.33 (A1667C; D556A), AAV9.34 (A1534G, C1794T; N512D), AAV9.35 (A1289T, T1450A, C1494T, A1515T, C1794A, G1816A; Q430L, Y484N, N98K, V606I), AAV9.40 (A1694T, E565V), AAV9.41 (A1348T, T1362C; T450S), AAV9.44 (A1684C, A1701T, A1737G; N562H, K567N), AAV9.45 (A1492T, C1804T; N498Y, L602F), AAV9.46 (G1441C, T1525C, T1549G; G481R, W509R, L517V), 9.47 (G1241A, G1358A, A1669G, C1745T; S414N, G453D, K557E, T582I), AAV9.48 (C1445T, A1736T; P482L, Q579L), AAV9.50 (A1638T, C1683T, T1805A; Q546H, L602H), AAV9.53 (G1301A, A1405C, C1664T, G1811T; R134Q, S469R, A555V, G604V), AAV9.54 (C1531A, T1609A; L511I, L537M), AAV9.55 (T1605A; F535L), AAV9.58 (C1475T, C1579A; T492I, H527N), AAV.59 (T1336C; Y446H), AAV9.61 (A1493T; N498I), AAV9.64 (C1531A, A1617T; L511I), AAV9.65 (C1335T, T1530C, C1568A; A523D), AAV9.68 (C1510A; P504T), AAV9.80 (G1441A; G481R), AAV9.83 (C1402A, A1500T; P468T, E500D), AAV9.87 (T1464C, T1468C; S490P), AAV9.90 (A1196T; Y399F), AAV9.91 (T1316G, A1583T, C1782G, T1806C; L439R, K528I), AAV9.93 (A1273G, A1421G, A1638C, C1712T, G1732A, A1744T, A1832T; S425G, Q474R, Q546H, P571L, G578R, T582S, D611V), AAV9.94 (A1675T; M559L), and AAV9.95 (T1605A; F535L).

[0090] In some embodiments, the AAV serotype can be or have a sequence as described in International Publication No. WO2016049230, the contents of which are incorporated by reference herein in their entirety, such as but not limited to AAVF1 / HSC1 (SEQ ID NOs:2 and 20 of WO2016049230), AAVF2 / HSC2 (SEQ ID NOs:3 and 21 of WO2016049230), AAVF3 / HSC3 (SEQ ID NOs:5 and 22 of WO2016049230), AAVF4 / HSC4 (SEQ ID NOs:6 and 23 of WO2016049230), AAVF5 / HSC5 (SEQ ID NOs:11 and 25 of WO2016049230), AAVF6 / HSC6 (SEQ ID NOs:7 and 24 of WO2016049230), AAVF7 / HSC7 (SEQ ID NOs:8 and 27 of WO2016049230), AAVF8 / HSC8 (SEQ ID NOs:9 and 28 of WO2016049230), AAVF9 / HSC9 (SEQ ID NOs:10 and 29 of WO2016049230), AAVF11 / HSC11 (SEQ ID NOs:4 and 26 of WO2016049230), AAVF12 / HSC12 (SEQ ID NOs:12 and 30 of WO2016049230), AAVF13 / HSC13 (SEQ ID NOs:14 and 31 of WO2016049230), AAVF14 / HSC14 (SEQ ID NOs:15 and 32 of WO2016049230), AAVF15 / HSC15 (SEQ ID NOs:16 and 33 of WO2016049230), AAVF16 / HSC16 (SEQ ID NOs:17 and 34 of WO2016049230), AAVF17 / HSC17 (SEQ ID NOs:13 and 35 of WO2016049230), or a variant or derivative thereof.

[0091] In some embodiments, the AAV serotype can be or have a sequence as described in U.S. Patent No. US 8734809, the contents of which are incorporated by reference in their entirety, such as but not limited to AAV CBr-E1 (SEQ ID NO: 13 and 87 of US 8734809), AAV CBr-E2 (SEQ ID NO: 14 and 88 of US 8734809), AAV CBr-E3 (SEQ ID NO: 15 and 89 of US 8734809), AAV CBr-E4 (SEQ ID NO: 16 and 90 of US 8734809), AAV CBr-E5 (SEQ ID NO: 17 and 91 of US 8734809), AAV CBr-e5 (SEQ ID NO: 18 and 92 of US 8734809), AAV CBr-E6 (SEQ ID NO: 19 and 93 of US 8734809), AAV CBr-E7 (SEQ ID NO: 20 and 94 of US 8734809), AAV CBr-E8 (SEQ ID NO: 21 and 95 of US 8734809), AAV CLv-D1 (SEQ ID NO: 22 and 96 of US 8734809), AAV CLv-D2 (SEQ ID NO: 23 and 97 of US 8734809), AAV CLv-D3 (SEQ ID NO: 24 and 98 of US 8734809), AAV CLv-D4 (SEQ ID NO: 25 and 99 of US 8734809), AAV CLv-D5 (SEQ ID NO: 26 and 100 of US 8734809), AAV CLv-D6 (SEQ ID NO: 27 and 101 of US 8734809), AAV CLv-D7 (SEQ ID NO: 28 and 102 of US 8734809), AAV CLv-D8 (SEQ ID NO: 29 and 103 of US 8734809), AAV CLv-E1 (SEQ ID NO: 13 and 87 of US 8734809), AAV CLv-R1 (SEQ ID NO: 30 and 104 of US 8734809), AAV CLv-R2 (SEQ ID NO: 31 and 105 of US 8734809), AAV CLv-R3 (SEQ ID NO: 32 and 106 of US 8734809), AAV CLv-R4 (SEQ ID NO: 33 and 107 of US 8734809), AAV CLv-R5 (SEQ ID NO: 34 and 108 of US 8734809), AAV CLv-R6 (SEQ ID NO: 35 and 109 of US 8734809), AAVCLv-R7 (SEQ ID NO:36 and 110 of US8734809), AAV CLv-R8 (SEQ ID NO:X and X of US8734809), AAV CLv-R9 (SEQ ID NO:X and X of US8734809), AAV CLg-F1 (SEQ ID NO:39 and 113 of US8734809), AAV CLg-F2 (SEQ ID NO:40 and 114 of US8734809), AAV CLg-F3 (SEQ ID NO:41 and 115 of US8734809), AAV CLg-F4 (SEQ ID NO:42 and 116 of US8734809), AAV CLg-F5 (SEQ ID NO:43 and 117 of US8734809), AAV CLg-F6 (SEQ ID NO:43 and 117 of US8734809), AAV CLg-F7 (SEQ ID NO:44 and 118 of US8734809), AAV CLg-F8 (SEQ ID NO:43 and 117 of US8734809), AAV CSp-1 (SEQ ID NO:45 and 119 of US8734809), AAV CSp-10 (SEQ ID NO:46 and 120 of US8734809), AAV CSp-11 (SEQ ID NO:47 and 121 of US8734809), AAV CSp-2 (SEQ ID NO:48 and 122 of US8734809), AAV CSp-3 (SEQ ID NO:49 and 123 of US8734809), AAV CSp-4 (SEQ ID NO:50 and 124 of US8734809), AAV CSp-6 (SEQ ID NO:51 and 125 of US8734809), AAV CSp-7 (SEQ ID NO:52 and 126 of US8734809), AAV CSp-8 (SEQ ID NO:53 and 127 of US8734809), AAV CSp-9 (SEQ ID NO:54 and 128 of US8734809), AAV CHt-2 (SEQ ID NO:55 and 129 of US8734809), AAV CHt-3 (SEQ ID NO:56 and 130 of US8734809), AAV CKd-1 (SEQ ID NO:57 and 131 of US8734809), AAV CKd-10 (SEQ ID NO:58 and 132 of US8734809), AAV CKd-2 (SEQ ID NO:59 and 133 of US8734809), AAVCKd-3 (SEQ ID NO:60 and 134 of US8734809), AAV CKd-4 (SEQ ID NO:61 and 135 of US8734809), AAV CKd-6 (SEQ ID NO:62 and 136 of US8734809), AAV CKd-7 (SEQ ID NO:63 and 137 of US8734809), AAV CKd-8 (SEQ ID NO:64 and 138 of US8734809), AAV CLv-1 (SEQ ID NO:35 and 139 of US8734809), AAV CLv-12 (SEQ ID NO:66 and 140 of US8734809), AAV CLv-13 (SEQ ID NO:67 and 141 of US8734809), AAV CLv-2 (SEQ ID NO:68 and 142 of US8734809), AAV CLv-3 (SEQ ID NO:69 and 143 of US8734809), AAV CLv-4 (SEQ ID NO:70 and 144 of US8734809), AAV CLv-6 (SEQ ID NO:71 and 145 of US8734809), AAV CLv-8 (SEQ ID NO:72 and 146 of US8734809), AAV CKd-B 1 (SEQ ID NO:73 and 147 of US8734809), AAV CKd-B2 (SEQ ID NO:74 and 148 of US8734809), AAV CKd-B3 (SEQ ID NO:75 and 149 of US8734809), AAV CKd-B4 (SEQ ID NO:76 and 150 of US8734809), AAV CKd-B5 (SEQ ID NO:77 and 151 of US8734809), AAV CKd-B6 (SEQ ID NO:78 and 152 of US8734809), AAV CKd-B7 (SEQ ID NO:79 and 153 of US8734809), AAV CKd-B8 (SEQ ID NO:80 and 154 of US8734809), AAV CKd-H1 (SEQ ID NO:81 and 155 of US8734809), AAV CKd-H2 (SEQ ID NO:82 and 156 of US8734809), AAV CKd-H3 (SEQ ID NO:83 and 157 of US8734809), AAV CKd-H4 (SEQ ID NO:84 and 158 of US8734809), AAV CKd-H5 (SEQ ID NO:85 and 159 of US8734809), AAV CKd-H6 (SEQ ID NO:86 and 160 of US8734809), AAV CKd-H7 (SEQ ID NO:87 and 161 of US8734809), AAV CKd-H8 (SEQ ID NO:88 and 162 of US8734809), AAV CKd-H9 (SEQ ID NO:89 and 163 of US8734809), AAV CKd-H10 (SEQ ID NO:90 and 164 of US8734809), AAV CKd-H11 (SEQ ID NO:91 and 165 of US8734809), AAV CKd-H12 (SEQ ID NO:92 and 166 of US8734809), AAV CKd-H13 (SEQ ID NO:93 and 167 of US8734809), AAV CKd-H14 (SEQ ID NO:94 and 168 of US8734809), AAV CKd-H15 (SEQ ID NO:95 and 169 of US8734809), AAV CKd-H16 (SEQ ID NO:96 and 170 of US8734809), AAV CKd-H17 (SEQ ID NO:97 and 171 of US8734809), AAV CKd-H18 (SEQ ID NO:98 and 172 of US8734809), AAV CKd-H19 (SEQ ID NO:99 and 173 of US8734809), AAV CKd-H20 (SEQ ID NO:100 and 174 of US8734809), AAV CKd-H21 (SEQ ID NO:101 and 175 of US8734809), AAV CKd-H22 (SEQ ID NO:102 and 176 of US8734809), AAV CKd-H23 (SEQ ID NO:103 and 177 of US8734809), AAV CKd-H24 (SEQ ID NO:104 and 178 of US8734809), AAV CKd-H25 (SEQ ID NO:105 and 179 of US8734809), AAV CKd-H26 (SEQ ID NO:106 and 180 of US8734809), AAV CKd-H27 (SEQ ID NO:107 and 181 of US8734809), AAV CKd-H28 (SEQ ID NO:108 and 182 of US8734809), AAV CKd-H29 (SEQ ID NO:109 and 183 of US8734809), AAV CKd-H30 (SEQ ID NO:110 and 184 of US8734809), AAV CKd-H31 (SEQ ID NO:111 and 185 of US8734809), AAV CKd-H32 (SEQ ID NO:112 and 186 of US8734809), AAV CKd-H33 (SEQ ID NO:113 and 187 of US8734809), AAV CKd-H34 (SEQ ID NO:114 and 188 of US8734809), AAV CKd-H35 (SEQ ID NO:115 and 189 of US8734809), AAV CKd-H36 (SEQ ID NO:116 and 190 of US8734809), AAV CKd-H37 (SEQ ID NO:117 and 191 of US8734809), AAV CKd-H38 (SEQ ID NO:118 and 192 of US8734809), AAV CKd-H39 (SEQ ID NO:119 and 193 of US8734809), AAV CKd-H40 (SEQ ID NO:120 and 194 of US8734809), AAV CKd-H41 (SEQ ID NO:121 and 195 of US8734809), AAV CKd-H42 (SEQ ID NO:122 and 196 of US8734809), AAV CKd-H43 (SEQ ID NO:123 and 197 of US8734809), AAV CKd-H44 (SEQ ID NO:124 and 198 of US8734809), AAV CKd-H45 (SEQ ID NO:125 and 199 of US8734809), AAV CKd-H46 (SEQ ID NO:126 and 200 of US8734809), AAV CKd-H47 (SEQ ID NO:127 and 201 of US8734809), AAV CKd-H48 (SEQ ID NO:128 and 202 of US8734809), AAV CKd-H49 (SEQ ID NO:129 and 203 of US8734809), AAV CKd-H50 (SEQ ID NO:130 and 204 of US8734809), AAV CKd-H51 (SEQ ID NO:131 and 205 of US8734809), AAV CKd-H52 (SEQ ID NO:132 and 206 of US8734809), AAV CKd-H53 (SEQ ID NO:133 and 207 of US8734809), AAV CKd-H54 (SEQ ID NO:134 and 208 of US8734809), AAV CKd-H55 (SEQ ID NO:135 and 209 of US8734809), AAV CKd-H56 (SEQ ID NO:136 and 210 of US8734809), AAV CKd-H57 (SEQ ID NO:137 and 211 of US8734809), AAV CKd-H58 (SEQ ID NO:138 and 212 of US8734809), AAV CKd-H59 (SEQ ID NO:139 and 213 of US8734809), AAV CKd-H60 (SEQ ID NO:140 and 214 of US8734809), AAV CKd-H61 (SEQ ID NO:141 and 215 of US8734809), AAV CKd-H62 (SEQ ID NO:142 and 216 of US8734809), AAV CKd-H63 (SEQ ID NO:143 and 217 of US8734809), AAV CKd-H64 (SEQ ID NO:144 and 218 of US8734809), AAV CKd-H65 (SEQ ID NO:145 and 219 of US8734809), AAV CKd-H66 (SEQ ID NO:146 and 220 of US8734809), AAV CKd-H67 (SEQ ID NO:147 and 221 of US8734809), AAV CKd-H68 (SEQ ID NO:148 and 222 of US8734809), AAV CKd-H69 (SEQ ID NO:149 and 223 of US8734809), AAV CKd-H70 (SEQ ID NO:150 and 224 of US8734809), AAV CKd-H71 (SEQ ID NO:151 and 225 of US8734809), AAV CKd-H72 (SEQ ID NO:152 and 226 of US8734809), AAV CKd-H73 (SEQ ID NO:153 and 227 of US8734809), AAV CKd-H74 (SEQ ID NO:154 and 228 of US8734809), AAV CKd-H75 (SEQ ID NO:155 and 229 of US8734809), AAV CKd-H76 (SEQ ID NO:156 and 230 of US8734809), AAV CKd-H77 (SEQ ID NO:157AAV8 (US8734809 SEQ ID NO: 85 and 159), AAV CKd-H6 (US8734809 SEQ ID NO: 77 and 151), AAV CHt-1 (US8734809 SEQ ID NO: 86 and 160), AAV CLv1-1 (US8734809 SEQ ID NO: 171), AAV CLv1-2 (US8734809 SEQ ID NO: 172), AAV CLv1-3 (US8734809 SEQ ID NO: 173), AAV CLv1-4 (US8734809 SEQ ID NO: 174), AAV Clv1-7 (US8734809 SEQ ID NO: 175), AAV Clv1-8 (US8734809 SEQ ID NO: 176), AAV Clv1-9 (US8734809 SEQ ID NO: 177), AAV Clv1-10 (US8734809 SEQ ID NO: 178), AAV.VR-355 (US8734809 SEQ ID NO: 181), AAV.hu.48R3 (US8734809 SEQ ID NO: 183), or a variant or derivative thereof.

[0092] In some embodiments, the AAV serotype can be or have a sequence as described in International Publication No. WO2016065001, the contents of which are incorporated by reference herein in their entirety, such as but not limited to AAV CHt-P2 (SEQ ID NOs: 1 and 51 of WO2016065001), AAV CHt-P5 (SEQ ID NOs: 2 and 52 of WO2016065001), AAV CHt-P9 (SEQ ID NOs: 3 and 53 of WO2016065001), AAV CBr-7.1 (SEQ ID NOs: 4 and 54 of WO2016065001), AAV CBr-7.2 (SEQ ID NOs: 5 and 55 of WO2016065001), AAV CBr-7.3 (SEQ ID NOs: 6 and 56 of WO2016065001), AAV CBr-7.4 (SEQ ID NOs: 7 and 57 of WO2016065001), AAV CBr-7.5 (SEQ ID NOs: 8 and 58 of WO2016065001), AAV CBr-7.7 (SEQ ID NOs: 9 and 59 of WO2016065001), AAV CBr-7.8 (SEQ ID NOs: 10 and 60 of WO2016065001), AAV CBr-7.10 (SEQ ID NO: 11 and 61 of WO2016065001), AAV CKd-N3 (SEQ ID NO: 12 and 62 of WO2016065001), AAV CKd-N4 (SEQ ID NO: 13 and 63 of WO2016065001), AAV CKd-N9 (SEQ ID NO: 14 and 64 of WO2016065001), AAV CLv-L4 (SEQ ID NO: 15 and 65 of WO2016065001), AAV CLv-L5 (SEQ ID NO: 16 and 66 of WO2016065001), AAV CLv-L6 (SEQ ID NO: 17 and 67 of WO2016065001), AAV CLv-K1 (SEQ ID NO: 18 and 68 of WO2016065001), AAV CLv-K3 (SEQ ID NO: 19 and 69 of WO2016065001), AAV CLv-K6 (SEQ ID NO: 20 and 70 of WO2016065001), AAV CLv-M1 (SEQ ID NO: 21 and 71 of WO2016065001), AAV CLv-M11 (SEQ ID NO: 22 and 72 of WO2016065001), AAV CLv-M2 (SEQ ID NO: 23 and 73 of WO2016065001), AAV CLv-M5 (SEQ ID NO: 24 and 74 of WO2016065001), AAV CLv-M6 (SEQ ID NO: 25 and 75 of WO2016065001), AAV CLv-M7 (SEQ ID NO: 26 and 76 of WO2016065001), AAV CLv-M8 (SEQ ID NO: 27 and 77 of WO2016065001), AAV CLv-M9 (SEQ ID NO: 28 and 78 of WO2016065001), AAV CHt-P1 (SEQ ID NO: 29 and 79 of WO2016065001), AAV CHt-P6 (SEQ ID NO: 30 and 80 of WO2016065001), AAV CHt-P8 (SEQ ID NO: 31 and 81 of WO2016065001), AAV CHt-6.1 (SEQ ID NO: 32 and 82 of WO2016065001), AAV CHt-6.10 (SEQ ID NO: 33 and 83 of WO2016065001), AAV CHt-6.5 (SEQ ID NO: 34 and 84 of WO2016065001), AAV CHt-6.6 (SEQ ID NOs:35 and 85 of WO2016065001), AAV CHt-6.7 (SEQ ID NOs:36 and 86 of WO2016065001), AAV CHt-6.8 (SEQ ID NOs:37 and 87 of WO2016065001), AAV CSp-8.10 (SEQ ID NOs:38 and 88 of WO2016065001), AAV CSp-8.2 (SEQ ID NOs:39 and 89 of WO2016065001), AAV CSp-8.4 (SEQ ID NOs:40 and 90 of WO2016065001), AAV CSp-8.5 (SEQ ID NOs:41 and 91 of WO2016065001), AAV CSp-8.6 (SEQ ID NOs:42 and 92 of WO2016065001), AAV CSp-8.7 (SEQ ID NOs:43 and 93 of WO2016065001), AAV CSp-8.8 (SEQ ID NOs:44 and 94 of WO2016065001), AAV CSp-8.9 (SEQ ID NOs:45 and 95 of WO2016065001), AAV CBr-B7.3 (SEQ ID NOs:46 and 96 of WO2016065001), AAV CBr-B7.4 (SEQ ID NOs:47 and 97 of WO2016065001), AAV3B (SEQ ID NOs:48 and 98 of WO2016065001), AAV4 (SEQ ID NOs:49 and 99 of WO2016065001), AAV5 (SEQ ID NOs:50 and 100 of WO2016065001), or a variant or derivative thereof.

[0093] In some embodiments, the AAV particle can have or can be a serotype selected from any one of the serotypes found in Table 1.

[0094] In some embodiments, the AAV capsid can comprise a sequence of any one of the sequences in Table 1, a fragment or variant thereof.

[0095] In some embodiments, the AAV capsid can be encoded by a sequence, fragment or variant as described in Table 1.

[0096] In any of the DNA and RNA sequences referred to and / or described herein, the individual letter designations have the following descriptions: A is adenine; C is cytosine; G is guanine; T is thymine; U is uracil; W is a wobble base such as adenine or thymine; S is a strong nucleotide such as cytosine and guanine; M is an amino nucleotide such as adenine and cytosine; K is a keto nucleotide such as guanine and thymine; R is purine: adenine and guanine; Y is pyrimidine: cytosine and thymine; B is any non-A base (e.g., cytosine, guanine, and thymine); D is any non-C base (e.g., adenine, guanine, and thymine); H is any non-G base (e.g., adenine, cytosine, and thymine); V is any non-T base (e.g., adenine, cytosine, and guanine); N is any nucleotide (which is not a null); and Z is zero.

[0097] In any of the amino acid sequences referred to and / or described herein, the one letter symbols are explained as follows: G (Gly) stands for glycine; A (Ala) stands for alanine; L (Leu) stands for leucine; M (Met) stands for methionine; F (Phe) stands for phenylalanine; W (Trp) stands for tryptophan; K (Lys) stands for lysine; Q (Gln) stands for glutamine; E (Glu) stands for glutamic acid; S (Ser) stands for serine; P (Pro) stands for proline; V (Val) stands for valine; I (Ile) stands for isoleucine; C (Cys) stands for cysteine; Y (Tyr) stands for tyrosine; H (His) stands for histidine; R (Arg) stands for arginine; N (Asn) stands for asparagine; D (Asp) stands for aspartic acid; T (Thr) stands for threonine; B (Asx) stands for aspartic acid or asparagine; J (Xle) stands for leucine or isoleucine; O (Pyl) stands for pyrrolysine; U (Sec) stands for selenocysteine; X (Xaa) stands for any amino acid; and Z (Glx) stands for glutamine or glutamic acid. Table 1. AAV serotypes

[0098] In some embodiments, the AAV serotype can be or can have a sequence as described in international patent publication WO2015038958, the contents of which are incorporated by reference in their entirety herein, such as but not limited to AAV9 (SEQ ID NO: 11 and 2 of WO2015038958, herein SEQ ID NO: 137 and 138, respectively), PHP.B (SEQ ID NO: 8 and 9 of WO2015038958, herein SEQ ID NO: 5 and 6), G2B-13 (SEQ ID NO: 12 of WO2015038958, herein SEQ ID NO: 7), G2B-26 (SEQ ID NO: 13 of WO2015038958, herein SEQ ID NO: 5), TH1.1-32 (SEQ ID NO: 14 of WO2015038958, herein SEQ ID NO: 8), TH1.1-35 (SEQ ID NO: 15 of WO2015038958, herein SEQ ID NO: 9), AAV5 (SEQ ID No: 199 and 216 of US20150315612, herein SEQ ID NO: 105 and 104, respectively), or a variant thereof.

[0099] In some embodiments, the AAV particles described herein comprise an AAV capsid protein comprising an amino acid sequence provided in WO 2021 / 230987 (e.g., in Table 4 or 6 of WO 2021 / 230987), the contents of which are hereby incorporated by reference in their entirety.

[0100] In some embodiments, the AAV serotype of the AAV particles (e.g., AAV particles for vectorized delivery of GBA1 proteins described herein) is AAV9 or AAV5, or a variant of AAV5 or a variant of AAV9. In some embodiments, the AAV particles comprise an AAV5 capsid variant. In some embodiments, the AAV particles comprise an AAV9 capsid variant.

[0101] In some embodiments, an AAV particle, e.g., a recombinant AAV particle, described herein comprises an AAV9 capsid protein. In some embodiments, the AAV9 capsid protein comprises the amino acid sequence of SEQ ID NO: 138. In some embodiments, a nucleic acid sequence encoding an AAV9 capsid protein comprises the nucleotide sequence of SEQ ID NO: 137. In some embodiments, the AAV9 capsid protein comprises an amino acid sequence that is at least 70% identical to SEQ ID NO: 138, such as at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 138. In some embodiments, a nucleic acid sequence encoding an AAV9 capsid protein comprises a nucleotide sequence that is at least 70% identical to SEQ ID NO: 137, such as at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 137.

[0102] In some embodiments, an AAV particle, e.g., a recombinant AAV particle, described herein comprises an AAV5 capsid protein. In some embodiments, the AAV5 capsid protein comprises the amino acid sequence of SEQ ID NO: 104. In some embodiments, a nucleic acid sequence encoding an AAV5 capsid protein is encoded by the nucleotide sequence of SEQ ID NO: 105. In some embodiments, the AAV5 capsid protein comprises an amino acid sequence that is at least 70% identical to SEQ ID NO: 104, such as at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 104. In some embodiments, a nucleic acid sequence encoding an AAV5 capsid protein comprises a nucleotide sequence that is at least 70% identical to SEQ ID NO: 105, such as at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 105.

[0103] In some embodiments, the AAV capsid of an AAV particle (e.g., an AAV particle for vectorized delivery of a GBA1 protein described herein) allows for blood-brain barrier penetration following intravenous administration. Non-limiting examples of such AAV capsids include AAV9, AAV9 K449R, AAV5, VOY101, VOY201, or an AAV capsid comprising a peptide insertion such as, but not limited to, AAVPHP.N (PHP.N), AAVPHP.B (PHP.B), PHP.S, G2A3, G2B4, G2B5, G2A12, G2A15, PHP.B2, PHP.B3, AAV2.BR1, or AAVPHP.A (PHP.A).

[0104] In some embodiments, the AAV capsid is an AAV9 comprising an insertion comprising the amino acid sequence of PLNGAVHLY (SEQ ID NO: 3648), where the amino acid sequence of PLNGAVHLY (SEQ ID NO: 3648) is present immediately following position 586 with respect to the reference sequence numbered with respect to the amino acid sequence of SEQ ID NO: 138. In some embodiments, the AAV capsid comprises the amino acid sequence of SEQ ID NO: 3636. In some embodiments, SEQ ID NO: 3636 comprises the amino acid sequence of:

[0105] In some embodiments, an AAV serotype is selected for use due to tropism for cells of the central nervous system. In some embodiments, the cells of the central nervous system are neurons. In another embodiment, the cells of the central nervous system are astrocytes.

[0106] In some embodiments, an AAV serotype is selected for use due to tropism for muscle cells.

[0107] In some embodiments, the start codon used for translation of an AAV VP1 capsid protein can be a CTG, TTG, or GTG as described in U.S. Patent No. US8163543, the contents of which are incorporated by reference herein in their entirety. In some embodiments, the nucleotide sequence encoding a capsid protein, e.g., a VP1 capsid protein, comprises 3 to 20 mutations (e.g., substitutions) with respect to the nucleotide sequence of SEQ ID NO: 137, e.g., 3 to 15 mutations, 3 to 10 mutations, 3 to 5 mutations, 5 to 20 mutations, 5 to 15 mutations, 5 to 10 mutations, 10 to 20 mutations, 10 to 15 mutations, 15 to 20 mutations, 3 mutations, 5 mutations, 10 mutations, 12 mutations, 15 mutations, 18 mutations, or 20 mutations.

[0108] The present disclosure is directed to structural capsid proteins (including VP1, VP2, and VP3) encoded by capsid (Cap) genes. These capsid proteins form the protein structural outer shell (i.e., capsid) of viral vectors such as AAV. VP capsid proteins synthesized from Cap polynucleotides typically include methionine as the first amino acid in the peptide sequence (Met1) associated with the start codon (AUG or ATG) in the corresponding Cap nucleotide sequence. However, the first methionine (Met1) residue or substantially any first amino acid (AA1) is typically cleaved off after or during polypeptide synthesis by a protein processing enzyme such as Met-amino peptidase. This “Met / AA-cleavage” process is typically associated with the corresponding acetylation of the second amino acid in the polypeptide sequence (e.g., alanine, valine, serine, threonine, etc.). Met-cleavage typically occurs in the case of VP1 and VP3 capsid proteins, but can also occur in the case of VP2 capsid proteins.

[0109] In the case of incomplete Met / AA-cleavage, a mixture of one or more (one, two, or three) VP capsid proteins of a viral capsid can be produced, some of which can include Met1 / AA1 amino acids (Met+ / AA+) and some of which can lack Met1 / AA1 amino acids (Met- / AA-) due to Met / AA-cleavage. For further discussion of Met / AA-cleavage in capsid proteins, see Jin et al., Direct Liquid Chromatography / Mass Spectrometry Analysis for Complete Characterization of Recombinant Adeno-Associated Virus Capsid Proteins. Hum Gene Ther Methods. 2017 Oct; 28(5): 255-267; Hwang et al., N-Terminal Acetylation of Cellular Proteins Creates Specific Degradation Signals. Science. 2010 Feb 19; 327(5968): 973-977; the contents of each of which are incorporated herein by reference in their entirety.

[0110] According to the present disclosure, reference to a capsid protein is not limited to being either cleaved (Met- / AA-) or uncleaved (Met+ / AA+) and can refer, in context, to an individual capsid protein, a viral capsid comprising a mixture of capsid proteins, and / or a polynucleotide sequence (or fragment thereof) encoding, describing, producing or producing a capsid protein of the present disclosure. Direct reference to a "capsid protein" or "capsid polypeptide" (such as VP1, VP2 or VP2) can also include a VP capsid protein comprising Met1 / AA1amino acids (Met+ / AA+) and the corresponding VP capsid protein without Met1 / AA1amino acids (Met- / AA-) due to Met / AA- cleavage.

[0111] Furthermore, according to the present disclosure, reference to a specific "SEQ ID NO:" (whether protein or nucleic acid) comprising or encoding one or more capsid proteins comprising Met1 / AA1amino acids (Met+ / AA+) is understood to teach a VP capsid protein lacking Met1 / AA1amino acids, as it will be readily apparent when reviewing the sequence that any sequence lacking only the first recited amino acid (whether or not Met1 / AA1) is taught.

[0112] As a non-limiting example, reference to a VP1 polypeptide sequence (Met+) of 736 amino acids in length and comprising a "Met1" amino acid encoded by an AUG / ATG start codon (Met+) can also be understood to teach a VP1 polypeptide sequence (Met-) of 735 amino acids in length and lacking the "Met1" amino acid of the 736 amino acid Met+ sequence. As a second non-limiting example, reference to a VP1 polypeptide sequence of 736 amino acids in length and comprising a "AA1" amino acid encoded by any NNN start codon (AA1+) can also be understood to teach a VP1 polypeptide sequence of 735 amino acids in length and lacking the "AA1" amino acid of the 736 amino acid AA1+ sequence (AA1-).

[0113] Reference to a viral capsid formed from VP capsid proteins (such as reference to a specific AAV capsid serotype) can encompass VP capsid proteins comprising Met1 / AA1amino acids (Met+ / AA1+), the corresponding VP capsid proteins lacking Met1 / AA1amino acids due to Met / AA1- cleavage (Met- / AA1-), and combinations thereof (Met+ / AA1+ and Met- / AA1-).

[0114] As non-limiting examples, the AAV capsid serotype can include VP1 (Met+ / AA1+), VP1 (Met- / AA1-), or a combination of VP1 (Met+ / AA1+) and VP1 (Met- / AA1-). The AAV capsid serotype can also include VP3 (Met+ / AA1+), VP3 (Met- / AA1-), or a combination of VP3 (Met+ / AA1+) and VP3 (Met- / AA1-); and also similar optional combinations of VP2 (Met+ / AA1+) and VP2 (Met- / AA1-). AAV viral genome

[0115] In some aspects, the AAV particles of the present disclosure act as expression vectors comprising a viral genome encoding a GCase protein. The viral genome can encode a GCase protein and a potentiator, such as a prosaposin (PSAP) or saposin (Sap) polypeptide or functional variant thereof (e.g., a SapA protein or a SapC protein), a cell-penetrating peptide (e.g., an ApoEII peptide, a TAT peptide, or an ApoB peptide), a lysosomal targeting sequence (LTS), or a combination thereof. In some embodiments, the expression vector is not limited to AAV and can be an adenovirus, a retrovirus, a lentivirus, a plasmid, a vector, or any variant thereof.

[0116] In some embodiments, the AAV particles, such as those used for vectorized delivery of GBA1 proteins described herein, comprise a viral genome, such as an AAV viral genome (e.g., a vector genome or an AAV viral genome). In some embodiments, the viral genome (e.g., an AAV viral genome) further comprises an inverted terminal repeat sequence (ITR) region, an enhancer, a promoter, an intron region, a Kozak sequence, an exon region, a nucleic acid encoding a transgene having or not having a potentiating element (e.g., a GBA1 protein described herein), a nucleotide sequence encoding at least one miR binding site (e.g., at least one miR183 binding site), a poly A signal region, or a combination thereof. Viral genome components: inverted terminal repeat sequence (ITR)

[0117] In some embodiments, the viral genome can comprise at least one inverted terminal repeat (ITR) region. The AAV particles of the disclosure comprise a viral genome having at least one ITR region and a payload region. In some embodiments, the viral genome has two ITRs. The two ITRs flank the payload region at the 5' and 3' ends. In some embodiments, the ITRs function as origins of replication comprising recognition sites for replication. In some embodiments, the ITRs comprise regions of sequence that can complement and are arranged in a symmetrical manner. In some embodiments, the ITRs incorporated in the viral genomes described herein can comprise naturally occurring polynucleotide sequences or polynucleotide sequences derived recombinantly.

[0118] The ITRs can be derived from the same serotype as the capsid, selected from any of the serotypes listed in Table 1, or a derivative thereof. The ITRs can have a different serotype than the capsid. In some embodiments, the AAV particles have more than one ITR. In one non-limiting example, the AAV particles have a viral genome comprising two ITRs. In some embodiments, the ITRs have the same serotype as each other. In another embodiment, the ITRs have different serotypes. Non-limiting examples include zero, one, or two of the ITRs having the same serotype as the capsid. In some embodiments, both ITRs of the viral genome of the AAV particles are AAV2 ITRs.

[0119] Independently, each ITR can be about 100 to about 150 nucleotides in length. In some embodiments, the ITR is 100-180 nucleotides in length, for example about 100-115, about 100-120, about 100-130, about 100-140, about 100-150, about 100-160, about 100-170, about 100-180, about 110-120, about 110-130, about 110-140, about 110-150, about 110-160, about 110-170, about 110-180, about 120-130, about 120-140, about 120-150, about 120-160, about 120-170, about 120-180, about 130-140, about 130-150, about 130-160, about 130-170, about 130-180, about 140-150, about 140-160, about 140-170, about 140-180, about 150-160, about 150-170, about 150-180, about 160-170, about 160-180, or about 170-180 nucleotides in length. In some embodiments, the ITR comprises about 120-140 nucleotides in length, for example about 130 nucleotides in length. In some embodiments, the ITR is 140-142 nucleotides in length, for example 141 nucleotides in length. In some embodiments, the ITR comprises 1205-135 nucleotides in length, for example 130 nucleotides in length. Non-limiting examples of ITR lengths are 102, 130, 140, 141, 142, 145 nucleotides, and lengths of those nucleotides having at least 95% identity thereto.

[0120] In some embodiments, each ITR is 141 nucleotides in length. In some embodiments, each ITR is 130 nucleotides in length. In some embodiments, the AAV particle comprises two ITRs, and one ITR is 141 nucleotides in length and the other ITR is 130 nucleotides in length.

[0121] In some embodiments, the ITR comprises the nucleotide sequence of any one of SEQ ID NOs: 1829, 1830, or 1862, or a nucleotide sequence that is substantially identical (e.g., at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical, or 100% identical) to any of the foregoing sequences. In some embodiments, the ITR comprises the nucleotide sequence of any one of SEQ ID NOs: 1860, 1861, 1863, or 1864, or a nucleotide sequence having one, two, or three but not more than four modifications (e.g., substitutions) relative to SEQ ID NO: 1860, 1861, 1863, or 1864. Viral genome components: promoters and expression enhancers

[0122] In some embodiments, the payload region of the viral genome comprises at least one element for enhancing transgene target specificity and expression. See, e.g., Powell et al., Viral Expression Cassette Elements to Enhance Transgene Target Specificity and Expression in Gene Therapy, 2015; the contents of which are incorporated by reference herein in their entirety. Non-limiting examples of elements for enhancing transgene target specificity and expression include promoters, endogenous miRNAs, post-transcriptional regulatory elements (PREs), polyadenylation (PolyA) signal sequences, upstream enhancers (USEs), CMV enhancers, and introns.

[0123] In some embodiments, expression of the polypeptide in the target cell can be driven by a specific promoter, including but not limited to a species-specific, inducible, tissue-specific, or cell cycle-specific promoter (Parr et al., Nat. Med. 3:1145-9 (1997); the contents of which are incorporated by reference herein in their entirety).

[0124] In some embodiments, the viral genome provides expression of the GBA1 protein in the target tissue (e.g., CNS). In some embodiments, a promoter is considered to be effective when it drives expression of the encoded polypeptide in the payload region of the viral genome of the AAV particle.

[0125] In some embodiments, a promoter is considered to be effective when it drives expression in the targeted cell or tissue (e.g., CNS).

[0126] In some embodiments, the promoter drives expression of the GCase, GCase and SapA, or GCase and SapC proteins in the tissue targeted for a period of time. Expression driven by the promoter can be for a period of 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 2 weeks, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 3 weeks, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, 31 days, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 13 months, 14 months, 15 months, 16 months, 17 months, 18 months, 19 months, 20 months, 21 months, 22 months, 23 months, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years, or more than 10 years. Expression can be for 1 to 5 hours, 1 to 12 hours, 1 to 2 days, 1 to 5 days, 1 to 2 weeks, 1 to 3 weeks, 1 to 4 weeks, 1 to 2 months, 1 to 4 months, 1 to 6 months, 2 to 6 months, 3 to 6 months, 3 to 9 months, 4 to 8 months, 6 to 12 months, 1 to 2 years, 1 to 5 years, 2 to 5 years, 3 to 6 years, 3 to 8 years, 4 to 8 years, or 5 to 10 years.

[0127] In some embodiments, the promoter drives expression of the polypeptide (e.g., a GCase polypeptide, a GCase polypeptide and a prosaposin (PSAP) polypeptide, a GCase polypeptide and a SapA polypeptide, a GCase polypeptide and a SapC polypeptide, a GCase polypeptide and a cell-penetrating peptide (e.g., an ApoEII peptide, a TAT peptide, and / or an ApoB peptide), or a GCase polypeptide and a lysosomal targeting peptide) for at least 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years, 11 years, 12 years, 13 years, 14 years, 15 years, 16 years, 17 years, 18 years, 19 years, 20 years, 21 years, 22 years, 23 years, 24 years, 25 years, 26 years, 27 years, 28 years, 29 years, 30 years, 31 years, 32 years, 33 years, 34 years, 35 years, 36 years, 37 years, 38 years, 39 years, 40 years, 41 years, 42 years, 43 years, 44 years, 45 years, 46 years, 47 years, 48 years, 49 years, 50 years, 55 years, 60 years, 65 years, or more than 65 years.

[0128] The promoter can be naturally occurring or non-naturally occurring. Non-limiting examples of promoters include viral promoters, plant promoters, and mammalian promoters. In some embodiments, the promoter can be a human promoter. In some embodiments, the promoter can be truncated.

[0129] In some embodiments, the viral genome comprises a promoter that causes expression in one or more (e.g., multiple) cells and / or tissues, e.g., a ubiquitous promoter. In some embodiments, promoters that drive or promote expression in a broad range of mammalian tissues include, but are not limited to, human elongation factor 1 alpha-subunit (EF1a), cytomegalovirus (CMV) immediate early enhancer and / or promoter, chicken beta-actin (CBA) and its derivatives CAG, beta glucuronidase (GUSB), and ubiquitin C (UBC). Tissue-specific expression elements can be used to limit expression to certain cell types, such as but not limited to, CNS-specific promoters, B-cell promoters, monocyte promoters, leukocyte promoters, macrophage promoters, pancreatic acinar cell promoters, endothelial cell promoters, lung tissue promoters, astrocyte promoters, or various specific nervous system cell or tissue type promoters that can be used to limit expression to, e.g., neurons, astrocytes, or oligodendrocytes.

[0130] In some embodiments, the viral genome comprises a nervous system-specific promoter, e.g., a promoter that results in expression of the payload in neurons, astrocytes, and / or oligodendrocytes. Non-limiting examples of tissue-specific expression elements for neurons include neuron-specific enolase (NSE), platelet-derived growth factor (PDGF), platelet-derived growth factor B chain (PDGF-beta), synapsin (Syn), synapsin 1 (Synl), methyl-CpG binding protein 2 (MeCP2), Ca 2+ / calmodulin-dependent protein kinase II (CaMKII), metabotropic glutamate receptor 2 (mGluR2), neurofilament light chain (NFL) or heavy chain (NFH), beta-globin minigene nP2, preproenkephalin (PPE), enkephalin (Enk), and excitatory amino acid transporter 2 (EAAT2) promoters. Non-limiting examples of tissue-specific expression elements for astrocytes include glial fibrillary acidic protein (GFAP) and EAAT2 promoters. Non-limiting examples of tissue-specific expression elements for oligodendrocytes include myelin basic protein (MBP) promoters. Prion promoters represent additional tissue-specific promoters suitable for driving protein expression in CNS tissues (see Loftus, Stacie K. et al. Human molecular genetics 11.24 (2002): 3107-3114, the disclosure of which is incorporated by reference in its entirety).

[0131] In some embodiments, the promoter can be less than 1 kb. The length of the promoter can be 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, or more than 800 nucleotides. The length of the promoter can be 200-300, 200-400, 200-500, 200-600, 200-700, 200-800, 300-400, 300-500, 300-600, 300-700, 300-800, 400-500, 400-600, 400-700, 400-800, 500-600, 500-700, 500-800, 600-700, 600-800, or 700-800 nucleotides.

[0132] In some embodiments, the promoter can be a combination of two or more components of the same or different starting or parental promoters, such as, but not limited to, CMV and CBA. The length of each component can be 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, or more than 800 nucleotides. The length of each component can be 200-300, 200-400, 200-500, 200-600, 200-700, 200-800, 300-400, 300-500, 300-600, 300-700, 300-800, 400-500, 400-600, 400-700, 400-800, 500-600, 500-700, 500-800, 600-700, 600-800, or 700-800 nucleotides. In some embodiments, the promoter is a combination of a 382 nucleotide CMV-enhancer sequence and a 260 nucleotide CBA-promoter sequence. In some embodiments, the promoter is a combination of a 380 nucleotide CMV-enhancer sequence (e.g., comprising the nucleotide sequence of SEQ ID NO: 1831) and a 260 nucleotide CBA-promoter sequence (e.g., comprising the nucleotide sequence of SEQ ID NO: 1834).

[0133] In some embodiments, the viral genome comprises a ubiquitous promoter. Non-limiting examples of ubiquitous promoters include CMV, CBA (including derivatives CAG, CB6, CBh, etc.), EF-1a, PGK, UBC, GUSB (hGBp), and UCOE (promoter of HNRPA2B 1-CBX3). In some embodiments, the viral genome comprises an EF-1a promoter or an EF-1a promoter variant.

[0134] In some embodiments, the promoter is a ubiquitous promoter, such as described in Yu et al., (Molecular Pain 2011, 7:63); Soderblom et al., (E. Neuro 2015), Gill et al., (Gene Therapy 2001, Vol. 8, 1539-1546), and Husain et al., (Gene Therapy 2009), each of which is incorporated herein by reference in its entirety.

[0135] In some embodiments, the promoter is not cell specific.

[0136] In some embodiments, the promoter is a ubiquitin c (UBC) promoter. The size of the UBC promoter can be 300 to 350 nucleotides. As a non-limiting example, the UBC promoter is 332 nucleotides. In some embodiments, the promoter is a beta-glucuronidase (GUSB) promoter. The size of the GUSB promoter can be 350 to 400 nucleotides. As a non-limiting example, the GUSB promoter is 378 nucleotides. In some embodiments, the promoter is a neurofilament light chain (NFL) promoter. The size of the NFL promoter can be 600 to 700 nucleotides. As a non-limiting example, the NFL promoter is 650 nucleotides. In some embodiments, the promoter is a neurofilament heavy chain (NFH) promoter. The size of the NFH promoter can be 900 to 950 nucleotides. As a non-limiting example, the NFH promoter is 920 nucleotides. In some embodiments, the promoter is a scn8a promoter. The size of the scn8a promoter can be 450 to 500 nucleotides. As a non-limiting example, the scn8a promoter is 470 nucleotides.

[0137] In some embodiments, the promoter is a phosphoglycerate kinase 1 (PGK) promoter.

[0138] In some embodiments, the promoter is a chicken beta-actin (CBA) promoter or a functional variant thereof.

[0139] In some embodiments, the promoter is a CB6 promoter or a functional variant thereof.

[0140] In some embodiments, the promoter is a CB promoter or a functional variant thereof. In some embodiments, the promoter is a minimal CB promoter or a functional variant thereof.

[0141] In some embodiments, the promoter is a CBA promoter or a functional variant thereof. In some embodiments, the promoter is a minimal CBA promoter or a functional variant thereof.

[0142] In some embodiments, the promoter is a cytomegalovirus (CMV) promoter or a functional variant thereof.

[0143] In some embodiments, the promoter is a CAG promoter or a functional variant thereof.

[0144] In some embodiments, the promoter is an EF1 a promoter or a functional variant thereof.

[0145] In some embodiments, the promoter is a GFAP promoter (as described, for example, in Zhang, Min, et al. Journal of neuroscience research 86.13 (2008): 2848-2856, the disclosure of which is incorporated by reference herein in its entirety), which drives expression of the GCase polypeptide or GCase polypeptide and a booster element (e.g., GCase and SapA, or GCase and SapC protein expression) in astrocytes.

[0146] In some embodiments, the promoter is a synapsin promoter or a functional variant thereof.

[0147] In some embodiments, the promoter is an RNA pol III promoter. As a non-limiting example, the RNA pol III promoter is U6. As a non-limiting example, the RNA pol III promoter is H1.

[0148] In some embodiments, the viral genome comprises two promoters. As a non-limiting example, the promoters are an EF1 a promoter and a CMV promoter.

[0149] In some embodiments, the viral genome comprises an enhancer element, a promoter, and / or a 5' UTR intron. The enhancer element, also referred to herein as an "enhancer," can be, but is not limited to, a CMV enhancer, the promoter can be, but is not limited to, a CMV, CBA, UBC, GUSB, NSE, synapsin, MeCP2, and GFAP promoter, and the 5' UTR / intron can be, but is not limited to, an SV40 and CBA-MVM. As a non-limiting example, the enhancer, promoter, and / or intron used in combination can be: (1) a CMV enhancer, a CMV promoter, an SV40 5' UTR intron; (2) a CMV enhancer, a CBA promoter, an SV 40 5' UTR intron; (3) a CMV enhancer, a CBA promoter, a CBA-MVM 5' UTR intron; (4) a UBC promoter; (5) a GUSB promoter; (6) a NSE promoter; (7) a synapsin promoter; (8) a MeCP2 promoter; and (9) a GFAP promoter.

[0150] In some embodiments, the viral genome comprises an enhancer. In some embodiments, the enhancer comprises a CMVie enhancer.

[0151] In some embodiments, the viral genome comprises a CMVie enhancer and a CB promoter. In some embodiments, the viral genome comprises a CMVie enhancer and a CMV promoter (e.g., a CMV promoter region). In some embodiments, the viral genome comprises a CMVie enhancer, a CBA promoter or functional variant thereof, and an intron (e.g., a CAG promoter).

[0152] In some embodiments, the viral genome comprises an engineered promoter. In another embodiment, the viral genome comprises a promoter from a naturally expressed protein.

[0153] In some embodiments, a CBA promoter is used in the viral genome of an AAV particle described herein, e.g., in a viral genome encoding a GCase protein or a GCase protein and a potentiation element (e.g., a GCase and SapA protein, a GCase and SapC protein, or a GCase protein and a cell penetrating peptide or variant thereof). In some embodiments, the CBA promoter is engineered for optimal expression of a GCase polypeptide or a GCase polypeptide and a potentiation element described herein (e.g., a prosaposin or saposin or variant thereof; a cell penetrating peptide or variant thereof; or a lysosomal targeting signal). Viral genome components: introns

[0154] In some embodiments, the vector genome comprises at least one intron or fragment or derivative thereof. In some embodiments, the at least one intron can enhance expression of the GCase protein and / or a potentiation element described herein (e.g., a saposin protein or variant thereof; a cell penetrating peptide (e.g., an ApoE II peptide, a TAT peptide, or an ApoB peptide) or variant thereof; and / or a lysosomal targeting signal) (see, e.g., Powell et al., Viral Expression Cassette Elements to Enhance Transgene Target Specificity and Expression in Gene Therapy, 2015; the contents of which are incorporated by reference herein in their entirety). Non-limiting examples of introns include MVM (67-97 bp), F.IX truncated intron 1 (300 bp), beta-globin SD / immunoglobulin heavy chain splice acceptor (250 bp), adenovirus splice donor / immunoglobulin splice acceptor (500 bp), SV40 late splice donor / splice acceptor (19S / 16S) (180 bp), and hybrid adenovirus splice donor / IgG splice acceptor (230 bp).

[0155] In some embodiments, the intron can be 100-500 nucleotides in length. The intron can be 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, or 500 nucleotides in length. The intron can be between 80-100, 80-120, 80-140, 80-160, 80-180, 80-200, 80-250, 80-300, 80-350, 80-400, 80-450, 80-500, 200-300, 200-400, 200-500, 300-400, 300-500, or 400-500 nucleotides in length.

[0156] In some embodiments, the intron can be 100-600 nucleotides in length. In some embodiments, the intron is 566 nucleotides in length.

[0157] In some embodiments, the AAV vector can comprise an SV40 intron or a fragment or variant thereof. In some embodiments, the promoter can be a CMV promoter. In some embodiments, the promoter can be CBA. In some embodiments, the promoter can be Hl.

[0158] In some embodiments, the AAV vector can comprise a beta-globin intron or a fragment or variant thereof. In some embodiments, the intron comprises one or more human beta-globin sequences (e.g., including fragments / variants thereof). In some embodiments, the promoter can be a CB promoter. In some embodiments, the promoter comprises a CMV promoter. In some embodiments, the promoter comprises a minimal CBA promoter.

[0159] In some embodiments, the encoded protein can be located downstream of an intron in the expression vector, such as but not limited to an SV40 intron or a beta globin intron or other intron known in the art. In addition, the encoded GBA1 protein can also be located upstream of a polyadenylation sequence in the expression vector. In some embodiments, the encoded protein can be located within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more than 30 nucleotides from downstream of a promoter comprising an intron (e.g., 3' relative to the promoter comprising an intron) and / or upstream of a polyadenylation sequence in the expression vector (e.g., 5' relative to the polyadenylation sequence). In some embodiments, the encoded GBA1 protein can be located within 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 5-10, 5-15, 5-20, 5-25, 5-30, 10-15, 10-20, 10-25, 10-30, 15-20, 15-25, 15-30, 20-25, 20-30, or 25-30 nucleotides from downstream of an intron (e.g., 3' relative to the intron) and / or upstream of a polyadenylation sequence in the expression vector (e.g., 5' relative to the polyadenylation sequence). In some embodiments, the encoded protein can be located within the first 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, or more than 25% of the nucleotides from downstream of an intron (e.g., 3' relative to the intron) and / or upstream of a polyadenylation sequence in the expression vector (e.g., 5' relative to the polyadenylation sequence). In some embodiments, the encoded protein can be located within the first 1-5%, 1-10%, 1-15%, 1-20%, 1-25%, 5-10%, 5-15%, 5-20%, 5-25%, 10-15%, 10-20%, 10-25%, 15-20%, 15-25%, or 20-25% of the sequence from downstream of an intron (e.g., 3' relative to the intron) and / or upstream of a polyadenylation sequence in the expression vector (e.g., 5' relative to the polyadenylation sequence).

[0160] In certain embodiments, the intron sequence is not an enhancer sequence. In some embodiments, the intron sequence is not a subcomponent of a promoter sequence. In some embodiments, the intron sequence is a subcomponent of a promoter sequence. Viral genome component: untranslated region (UTR)

[0161] In some embodiments, the wild-type untranslated region (UTR) of the gene is transcribed but not translated. Generally, the 5' UTR starts at the transcription start site and ends at the start codon, while the 3' UTR starts immediately after the stop codon and continues until the transcription termination signal.

[0162] Features typically found in a particular target organ gene that is well-expressed can be engineered into the UTR to enhance stability and protein production. As non-limiting examples, the 5' UTR from an mRNA that is normally expressed in the liver (e.g., albumin, serum amyloid A, apolipoprotein A / B / E, transferrin, alpha-fetoprotein, erythropoietin, or Factor VIII) can be used in the viral genome of an AAV particle of the disclosure to enhance expression in liver cell lines or in the liver.

[0163] In some embodiments, the viral genome encoding a transgene described herein (e.g., a transgene encoding a GBA1 protein) comprises a Kozak sequence. While not wishing to be bound by theory, wild-type 5' untranslated regions (UTRs) include features that play a role in translation initiation. Kozak sequences are typically included in 5' UTRs and are generally known to be involved in the process by which ribosomes initiate translation of a variety of genes. Kozak sequences have the consensus CCR(A / G)CCAUGG, where R is a purine (adenine or guanine) three bases upstream of the start codon (ATG), followed by another "G".

[0164] In some embodiments, the 5' UTR in the viral genome comprises a Kozak sequence.

[0165] In some embodiments, the 5' UTR in the viral genome does not comprise a Kozak sequence.

[0166] While not wishing to be bound by theory, it is known that fragments of adenosine and uridine are embedded in wild-type 3' UTRs. Such AU-rich tags are particularly prevalent in genes with high turnover rates. AU-rich elements (AREs) can be divided into three classes based on their sequence features and functional properties (Chen et al., 1995, the contents of which are incorporated by reference in their entirety herein): Class I AREs, such as but not limited to c-Myc and MyoD, contain several copies of the dispersed AUUUA motif within a U-rich region. Class II AREs, such as but not limited to GM-CSF and TNF-a, have two or more overlapping UUAUUUA(U / A)(U / A) nine-mers. Class III AREs, such as but not limited to c-Jun and Myogenin, are less well defined. These U-rich regions do not contain the AUUUA motif. Most proteins known to bind to AREs destabilize the message, while members of the ELAV family, most notably HuR, have been documented to increase mRNA stability. HuR binds to AREs of all three classes. Engineering HuR-specific binding sites into the 3' UTR of a nucleic acid molecule will result in HuR binding, resulting in message stabilization in vivo.

[0167] Introduction, removal, or modification of 3' UTR AU-rich elements (AREs) can be used to modulate the stability of a polynucleotide. In engineering a specific polynucleotide, such as a payload region of a viral genome, one or more copies of an ARE can be introduced to decrease the stability of the polynucleotide, and thereby decrease translation of the resulting protein and reduce its yield. Likewise, an ARE can be identified and removed or mutated to increase intracellular stability, and thus increase translation and yield of the resulting protein.

[0168] In some embodiments, the 3' UTR of a viral genome can include an oligo(dT) sequence for templated addition of a poly-A tail.

[0169] Any UTR from any gene known in the art can be incorporated into the viral genome of an AAV particle. The placement orientation of these UTRs or portions thereof can be the same as in the gene from which it is selected, or the orientation or location can be varied. In some embodiments, a UTR used in the viral genome of an AAV particle can be inverted, shortened, lengthened, or made to have one or more other 5' UTRs or 3' UTRs known in the art. As used herein, the term "alteration" when in reference to a UTR means that the UTR has been changed in some way relative to a reference sequence. For example, a 3' or 5' UTR can be altered relative to a wild-type or native UTR by a change in orientation or location as taught above, or can be altered by including additional nucleotides, nucleotide deletions, nucleotide exchanges, or transpositions.

[0170] In some embodiments, the viral genome of the AAV particle comprises at least one artificial UTR that is not a variant of a wild-type UTR.

[0171] In some embodiments, the viral genome of the AAV particle comprises a UTR that has been selected from a family of transcripts whose proteins share a common function, structure, characteristic, or property. Viral genome components: miR binding sites

[0172] Tissue- or cell-specific expression of the AAV viral particles of the application can be enhanced by the introduction of tissue- or cell-specific regulatory sequences, such as promoters, enhancers, microRNA binding sites (e.g., de-targeting sites). Without wishing to be bound by theory, it is believed that the encoded miR binding sites can be modulated, e.g., hinder, repress, or otherwise inhibit expression of the gene of interest on the viral genome of the AAV particles described herein based on expression of the corresponding endogenous microRNA (miRNA) or the corresponding controlled exogenous miRNA in a tissue or cell, e.g., a non-targeted cell or tissue. In some embodiments, the miR binding sites modulate, e.g., reduce, expression of the payload encoded by the viral genome of the AAV particles described herein in a cell or tissue expressing the corresponding mRNA. In some embodiments, the miR binding sites modulate, e.g., reduce, expression of the encoded GBA1 protein in cells or tissues of the DRG, liver, hematopoietic lineage, or a combination thereof.

[0173] In some embodiments, the viral genome of the AAV particles described herein comprises a nucleotide sequence encoding a microRNA binding site, e.g., a de-targeting site. In some embodiments, the viral genome of the AAV particles described herein comprises a nucleotide sequence encoding a miR binding site, a microRNA binding site series (miR BS), or the reverse complement thereof.

[0174] In some embodiments, the nucleotide sequence encoding the miR binding site series or the miR binding site is located in the 3'-UTR region of the viral genome (e.g., 3' relative to the nucleic acid sequence encoding the payload), e.g., before the polyA sequence, in the 5'-UTR region of the viral genome (e.g., 5' relative to the nucleic acid sequence encoding the payload), or both.

[0175] In some embodiments, the encoded miR binding site series comprises at least 1 to 5 copies of a miR binding site, for example, 1 to 3, 2 to 4, or 3 to 5 copies, or at least 1, at least 2, at least 3, at least 4, at least 5, or more copies of a miR binding site (miR BS). In some embodiments, the encoded miR binding site series comprises 4 copies of a miR binding site. In some embodiments, all copies are identical, for example, comprising the same miR binding site. In some embodiments, the miR binding sites within the encoded miR binding site series are contiguous and not separated by a spacer. In some embodiments, the miR binding sites within the encoded miR binding site series are separated by a spacer, for example, a non-coding sequence. In some embodiments, the length of the spacer is about 1 to about 6 nucleotides or about 5 to about 10 nucleotides, for example, about 7-8 nucleotides, in nucleotides. In some embodiments, the spacer length is about 8 nucleotides. In some embodiments, the spacer sequence comprises one or more of (i) GGAT; (ii) CACGTG; (iii) GCATGC, or a repeat of one or more of (i)-(iii). In some embodiments, the spacer comprises the nucleotide sequence of SEQ ID NO: 1848 or a nucleotide sequence having at least one, two, or three modifications but not more than four modifications of SEQ ID NO: 1848.

[0176] In some embodiments, the encoded series of miR binding sites comprises at least 1 to 5 copies of a miR binding site, e.g., 1 to 3, 2 to 4, or 3 to 5 copies, or at least 1, at least 2, at least 3, at least 4, at least 5, or more copies of a miR binding site (miR BS). In some embodiments, at least 1, at least 2, at least 3, at least 4, at least 5, or all of the copies are different, e.g., comprise different miR binding sites. In some embodiments, the miR binding sites within the encoded series of miR binding sites are contiguous and not separated by a spacer. In some embodiments, the miR binding sites within the encoded series of miR binding sites are separated by a spacer, e.g., a non-coding sequence. In some embodiments, the length of the spacer is about 1 to about 6 nucleotides or about 5 to about 10 nucleotides, e.g., about 7-8 nucleotides or about 8 nucleotides, in nucleotides. In some embodiments, the spacer sequence comprises one or more of: (i) GGAT; (ii) CACGTG; (iii) GCATGC, or a repeat of one or more of (i)-(iii). In some embodiments, the spacer comprises the nucleotide sequence of GATAGTTA (SEQ ID NO: 1848) or a nucleotide sequence having at least one, two, or three modifications but not more than four modifications of GATAGTTA (SEQ ID NO: 1848).

[0177] In some embodiments, the encoded miR binding site is substantially identical (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical) to a miR in the host cell. In some embodiments, the encoded miR binding site comprises at least 1, 2, 3, 4, or 5 mismatches or not more than 6, 7, 8, 9, or 10 mismatches relative to a miR in the host cell. In some embodiments, the mismatched nucleotides are contiguous. In some embodiments, the mismatched nucleotides are non-contiguous. In some embodiments, the mismatched nucleotides are present outside of the seed region binding sequence of the miR binding site, such as at one or both ends of the miR binding site. In some embodiments, the encoded miR binding site is 100% identical to a miR in the host cell.

[0178] In some embodiments, the nucleotide sequence encoding the miR binding site is substantially complementary (e.g., at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% complementary) to a miR in the host cell. In some embodiments, the sequence complementary to the nucleotide sequence encoding the miR binding site comprises at least 1, at least 2, at least 3, at least 4, or at least 5 mismatches or no more than 6, no more than 7, no more than 8, no more than 9, or no more than 10 mismatches relative to the corresponding miR in the host cell. In some embodiments, the mismatched nucleotides are contiguous. In some embodiments, the mismatched nucleotides are non-contiguous. In some embodiments, the mismatched nucleotides are present outside of the seed region binding sequence of the miR binding site, such as at one or both ends of the miR binding site. In some embodiments, the encoded miR binding site is 100% complementary to a miR in the host cell.

[0179] In some embodiments, the encoded miR binding site or series of encoded miR binding sites is about 10 to about 125 nucleotides in length, e.g., about 10 to about 50 nucleotides, about 10 to about 100 nucleotides, about 50 to about 100 nucleotides, about 50 to about 125 nucleotides, or about 100 to about 125 nucleotides in length. In some embodiments, the encoded miR binding site or series of encoded miR binding sites is about 7 to about 28 nucleotides in length, e.g., about 8-28 nucleotides, about 7-28 nucleotides, about 8-18 nucleotides, about 12-28 nucleotides, about 20-26 nucleotides, about 22 nucleotides, about 24 nucleotides, or about 26 nucleotides in length, and optionally comprises at least one contiguous region (e.g., 7 or 8 nucleotides) complementary (e.g., fully or partially complementary) to a seed sequence of a miRNA (e.g., miR122, miR142, miR183).

[0180] In some embodiments, the encoded miR binding site or series of encoded miR binding sites is 22 nucleotides in length.

[0181] In some embodiments, the encoded miR binding site is complementary (e.g., fully complementary or partially complementary) to a miR expressed in the liver or a liver cell, such as miR122. In some embodiments, the encoded miR binding site or series of encoded miR binding sites comprises a miR122 binding site sequence. In some embodiments, the encoded miR122 binding site comprises the nucleotide sequence of ACAAACACCATTGTCACACTCCA (SEQ ID NO: 1865), or a nucleotide sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO: 1865 or having at least one, at least two, at least three, at least four, at least five, at least six, or at least seven modifications but not more than ten modifications, e.g., where the modifications can cause a mismatch between the encoded miR binding site and the corresponding miRNA. In some embodiments, the viral genome comprises at least 3, 4, or 5 copies of the encoded miR122 binding site (e.g., a series of encoded miR122 binding sites), optionally where the series of encoded miR122 binding sites comprises the nucleotide sequence of ACAAACACCATTGTCACACTCCACACAAACACCATTGTCACACTCCACACAAACACCATTGTCACACTCCA (SEQ ID NO: 1866), or a nucleotide sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO: 1866 or having at least one, at least two, at least three, at least four, at least five, at least six, or at least seven modifications but not more than ten modifications, e.g., where the modifications can cause a mismatch between the encoded miR binding site and the corresponding miRNA. In some embodiments, at least two of the encoded miR122 binding sites are directly linked, e.g., in the absence of a spacer. In other embodiments, at least two of the encoded miR122 binding sites are separated by a spacer of, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length, the spacer being positioned between two or more consecutive encoded miR122 binding site sequences. In embodiments, the spacer is about 1-6 nucleotides or about 5-10 nucleotides in length, e.g., about 7-8 nucleotides or about 8 nucleotides. In some embodiments, the spacer sequence comprises one or more of: (i) GGAT; (ii) CACGTG; (iii) GCATGC, or a repeat of one or more of (i)-(iii).In some embodiments, the spacer comprises the nucleotide sequence of SEQ ID NO: 1848 or a nucleotide sequence having at least one, two, or three modifications but not more than four modifications of SEQ ID NO: 1848.

[0182] In some embodiments, the encoded miR binding site is complementary (e.g., fully complementary or partially complementary) to a miR expressed in a hematopoietic lineage, including immune cells (e.g., antigen presenting cells or APCs, including dendritic cells (DCs), macrophages, and B-lymphocytes). In some embodiments, the encoded miR binding site is complementary (e.g., fully complementary or partially complementary) to a miR expressed in a hematopoietic lineage, including nucleotide sequences disclosed in US 2018 / 0066279, the contents of which are incorporated by reference in their entirety herein.

[0183] In some embodiments, the encoded miR binding site or series of encoded miR binding sites comprises a miR-142-3p binding site sequence. In some embodiments, the encoded miR-142-3p binding site comprises the nucleotide sequence of TCCATAAAGTAGGAAACACTACA (SEQ ID NO: 1869), at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity thereto, or a nucleotide sequence having at least one, at least two, at least three, at least four, at least five, at least six, or at least seven modifications but not more than ten modifications, e.g., where the modifications can cause a mismatch between the encoded miR binding site and the corresponding miRNA. In some embodiments, the viral genome comprises at least 3, at least 4, or at least 5 copies of the encoded miR-142-3p binding site (e.g., series of encoded miR-142-3p binding sites). In some embodiments, the at least 3, at least 4, or at least 5 copies (e.g., 4 copies) of the encoded miR-142-3p binding site are contiguous (e.g., not separated by a spacer) or are separated by a spacer. In some embodiments, the spacer is about 1 to 6 nucleotides or about 5 to about 10 nucleotides in length, e.g., about 7-8 nucleotides or about 8 nucleotides in length. In some embodiments, the spacer sequence comprises one or more of (i) GGAT; (ii) CACGTG; (iii) GCATGC, or a repeat of one or more of (i)-(iii). In some embodiments, the spacer comprises the nucleotide sequence of SEQ ID NO: 1848 or a nucleotide sequence having at least one, two, or three modifications but not more than four modifications of SEQ ID NO: 1848.

[0184] In some embodiments, the encoded miR binding site is complementary (e.g., fully complementary or partially complementary) to a miR expressed in DRG (dorsal root ganglion) neurons, e.g., miR183, miR182, and / or miR96 binding site. In some embodiments, the encoded miR binding site is complementary (e.g., fully complementary or partially complementary) to a miR expressed in DRG neurons. In some embodiments, the encoded miR binding site comprises a nucleotide sequence disclosed in, e.g., WO 2020 / 132455, the contents of which are incorporated by reference herein in their entirety.

[0185] In some embodiments, the encoded miR binding site or series of encoded miR binding sites comprises a miR183 binding site sequence. In some embodiments, the encoded miR183 binding site comprises In some embodiments, the viral genome comprises a sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO: 1847, or a nucleotide sequence having at least one, at least two, at least three, at least four, at least five, at least six, or at least seven modifications but not more than ten modifications relative to SEQ ID NO: 1847, e.g., where the modifications can result in a mismatch between the encoded miR binding site and the corresponding miRNA. In some embodiments, the sequence complementary (e.g., fully complementary or partially complementary) to the seed sequence corresponds to the encoded miR-183 binding site sequence double underlined. In some embodiments, the viral genome comprises at least 3, at least 4, or at least 5 copies (e.g., 4 copies) of the encoded miR183 binding site. In some embodiments, the viral genome comprises at least 4 copies of the encoded miR183 binding site. In some embodiments, the viral genome comprises the encoded miR183 binding site comprising 4 copies of the miR183 binding site. In some embodiments, at least 3, at least 4, or at least 5 copies (e.g., 4 copies) of the encoded miR183 binding site are contiguous (e.g., not separated by a spacer) or separated by a spacer. In some embodiments, the spacer is about 1 to about 6 nucleotides or about 5 to about 10 nucleotides in length, e.g., about 7-8 nucleotides or about 8 nucleotides. In some embodiments, the spacer comprises the nucleotide sequence of SEQ ID NO: 1848 or a nucleotide sequence having at least one, at least two, or at least three modifications but not more than four modifications of SEQ ID NO: 1848. In some embodiments, the series of encoded miR183 binding sites comprises the nucleotide sequence of SEQ ID NO: 1849, or a nucleotide sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO: 1849, or having at least one, at least two, at least three, at least four, at least five, at least six, or at least seven modifications but not more than ten modifications.

[0186] In some embodiments, the encoded miR binding site or series of encoded miR binding sites comprises a miR182 binding site sequence. In some embodiments, the encoded miR182 binding site comprises the nucleotide sequence of AGTGTGAGTTCTACCATTGCCAAA (SEQ ID NO: 1867), a nucleotide sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO: 1867, or having at least one, at least two, at least three, at least four, at least five, at least six, or at least seven modifications but not more than ten modifications, e.g., where the modifications can cause a mismatch between the encoded miR binding site and the corresponding miRNA. In some embodiments, the viral genome comprises at least 3, at least 4, or at least 5 copies of the encoded miR182 binding site (e.g., series of encoded miR182 binding sites). In some embodiments, the at least 3, at least 4, or at least 5 copies (e.g., 4 copies) of the encoded miR182 binding site are contiguous (e.g., not separated by a spacer) or are separated by a spacer. In some embodiments, the spacer is about 1 to about 6 nucleotides or about 5 to about 10 nucleotides in length, e.g., about 7-8 nucleotides or about 8 nucleotides. In some embodiments, the spacer comprises the nucleotide sequence of SEQ ID NO: 1848 or a nucleotide sequence having at least one, at least two, or at least three modifications but not more than four modifications of SEQ ID NO: 1848.

[0187] In some embodiments, the encoded miR binding site or series of encoded miR binding sites comprises a miR96 binding site sequence. In some embodiments, the encoded miR96 binding site comprises the nucleotide sequence of AGCAAAAATGTGCTAGTGCCAAA (SEQ ID NO: 1868), a nucleotide sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO: 1868, or having at least one, at least two, at least three, at least four, at least five, at least six, or at least seven modifications but not more than ten modifications, e.g., where the modifications can cause a mismatch between the encoded miR binding site and the corresponding miRNA. In some embodiments, the viral genome comprises at least 3, at least 4, or at least 5 copies of the encoded miR96 binding site (e.g., series of encoded miR96 binding sites). In some embodiments, the at least 3, at least 4, or at least 5 copies (e.g., 4 copies) of the encoded miR96 binding site are contiguous (e.g., not separated by a spacer) or are separated by a spacer. In some embodiments, the spacer is about 1 to about 6 nucleotides or about 5 to about 10 nucleotides in length, e.g., about 7-8 nucleotides or about 8 nucleotides. In some embodiments, the spacer comprises the nucleotide sequence of SEQ ID NO: 1848 or a nucleotide sequence having at least one, at least two, or at least three modifications but not more than four modifications of SEQ ID NO: 1848.

[0188] In some embodiments, the encoded miR binding site series comprises a miR122 binding site, a miR142 binding site, a miR183 binding site, a miR182 binding site, a miR 96 binding site, or a combination thereof. In some embodiments, the encoded miR binding site series comprises at least 3, at least 4, or at least 5 copies of a miR122 binding site, a miR142 binding site, a miR183 binding site, a miR182 binding site, a miR 96 binding site, or a combination thereof. In some embodiments, at least two of the encoded miR binding sites are directly linked, e.g., in the absence of a spacer. In other embodiments, at least two of the encoded miR binding sites are separated by a spacer of, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length, which is positioned between two or more consecutive encoded miR binding site sequences. In embodiments, the spacer is at least about 5 to about 10 nucleotides in length, e.g., about 7-8 nucleotides or about 8 nucleotides. In some embodiments, the spacer sequence comprises one or more of: (i) GGAT; (ii) CACGTG; (iii) GCATGC, or a repeat of one or more of (i)-(iii). In some embodiments, the spacer comprises the nucleotide sequence of SEQ ID NO: 1848 or a nucleotide sequence having at least one, two, or three modifications but not more than four modifications of SEQ ID NO: 1848.

[0189] In some embodiments, the encoded miR binding site series comprises at least 3-5 copies (e.g., 4 copies) of a combination of at least two, three, four, five, or all of miR122 binding sites, miR142 binding sites, miR183 binding sites, miR182 binding sites, miR96 binding sites, wherein each miR binding site within the series is consecutive (e.g., not separated by a spacer) or separated by a spacer. In some embodiments, the spacer is about 1 to about 6 nucleotides or about 5 to about 10 nucleotides in length, e.g., about 7-8 nucleotides or about 8 nucleotides. In some embodiments, the spacer sequence comprises one or more of: (i) GGAT; (ii) CACGTG; (iii) GCATGC, or a repeat of one or more of (i)-(iii). In some embodiments, the spacer comprises the nucleotide sequence of SEQ ID NO: 1848 or a nucleotide sequence having at least one, two, or three modifications but not more than four modifications of SEQ ID NO: 1848. Viral genome component: polyadenylation sequence

[0190] In some embodiments, the viral genome of the AAV particle of the disclosure comprises at least one polyadenylation (polyA) sequence. The viral genome of the AAV particle can comprise a polyadenylation sequence between the 3’ end of the payload coding sequence and the 5’ end of the 3’ UTR. In some embodiments, the polyA signal region is located 3’ of the nucleic acid comprising the transgene encoding the payload, e.g., a GBA1 protein described herein.

[0191] In some embodiments, the polyA signal region is about 100-600 nucleotides in length, e.g., about 100-500 nucleotides, about 100-400 nucleotides, about 100-300 nucleotides, about 100-200 nucleotides, about 200-600 nucleotides, about 200-500 nucleotides, about 200-400 nucleotides, about 200-300 nucleotides, about 300-600 nucleotides, about 300-500 nucleotides, about 300-400 nucleotides, about 400-600 nucleotides, about 400-500 nucleotides, or about 500-600 nucleotides. In some embodiments, the polyA signal region is about 100 to about 150 nucleotides in length, e.g., about 127 nucleotides. In some embodiments, the polyA signal region is about 450 to about 500 nucleotides in length, e.g., about 477 nucleotides. In some embodiments, the polyA signal region is about 520 to about 560 nucleotides in length, e.g., about 552 nucleotides. In some embodiments, the polyA signal region is about 127 nucleotides in length.

[0192] In some embodiments, the viral genome comprises a human growth hormone (hGH) polyA sequence. In some embodiments, the viral genome comprises the hGH polyA described above and a payload region encoding a GCase protein or a GCase and a potentiating element (e.g., a saposin protein or a variant thereof; a cell-penetrating peptide (e.g., an ApoEII peptide, a TAT peptide, or an ApoB peptide); or a lysosomal targeting peptide), e.g., encoding a sequence provided in Tables 3 and 4 or a fragment or variant thereof. Viral genome components: filler sequences

[0193] In some embodiments, the viral genome comprises one or more filler sequences. The filler sequence can be a wild-type sequence or an engineered sequence. The filler sequence can be a variant of a wild-type sequence. In some embodiments, the filler sequence is a derivative of human albumin.

[0194] In some embodiments, the viral genome comprises one or more stuffer sequences to make the length of the viral genome the optimal size for packaging. In some embodiments, the viral genome comprises at least one stuffer sequence to make the length of the viral genome about 2.3 kb. In some embodiments, the viral genome comprises at least one stuffer sequence to make the length of the viral genome about 4.6 kb.

[0195] In some embodiments, the viral genome is a single-stranded (ss) viral genome and comprises one or more stuffer sequences that independently or collectively make the length about 0.1 kb to 3.8 kb, such as but not limited to 0.1 kb, 0.2 kb, 0.3 kb, 0.4 kb, 0.5 kb, 0.6 kb, 0.7 kb, 0.8 kb, 0.9 kb, 1 kb, 1.1 kb, 1.2 kb, 1.3 kb, 1.4 kb, 1.5 kb, 1.6 kb, 1.7 kb, 1.8 kb, 1.9 kb, 2 kb, 2.1 kb, 2.2 kb, 2.3 kb, 2.4 kb, 2.5 kb, 2.6 kb, 2.7 kb, 2.8 kb, 2.9 kb, 3 kb, 3.1 kb, 3.2 kb, 3.3 kb, 3.4 kb, 3.5 kb, 3.6 kb, 3.7 kb, or 3.8 kb. In some embodiments, the full-length stuffer sequence in the vector genome is 3.1 kb. In some embodiments, the full-length stuffer sequence in the vector genome is 2.7 kb. In some embodiments, the full-length stuffer sequence in the vector genome is 0.8 kb. In some embodiments, the full-length stuffer sequence in the vector genome is 0.4 kb. In some embodiments, each stuffer sequence in the vector genome is 0.8 kb in length. In some embodiments, each stuffer sequence in the vector genome is 0.4 kb in length.

[0196] In some embodiments, the viral genome is a self-complementary (sc) viral genome and comprises one or more stuffer sequences that independently or collectively make the length about 0.1 kb to 1.5 kb, such as but not limited to 0.1 kb, 0.2 kb, 0.3 kb, 0.4 kb, 0.5 kb, 0.6 kb, 0.7 kb, 0.8 kb, 0.9 kb, 1 kb, 1.1 kb, 1.2 kb, 1.3 kb, 1.4 kb, or 1.5 kb. In some embodiments, the full-length stuffer sequence in the vector genome is 0.8 kb. In some embodiments, the full-length stuffer sequence in the vector genome is 0.4 kb. In some embodiments, each stuffer sequence in the vector genome is 0.8 kb in length. In some embodiments, each stuffer sequence in the vector genome is 0.4 kb in length.

[0197] In some embodiments, the viral genome comprises any portion of the filler sequence. The viral genome can comprise 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% of the filler sequence.

[0198] In some embodiments, the viral genome is a single-stranded (ss) viral genome and comprises one or more filler sequences such that the length of the viral genome is about 4.6 kb. In some embodiments, the viral genome comprises at least one filler sequence and the filler sequence is 3' of the 5' ITR sequence. In some embodiments, the viral genome comprises at least one filler sequence and the filler sequence is 5' of the promoter sequence. In some embodiments, the viral genome comprises at least one filler sequence and the filler sequence is 3' of the polyadenylation signal sequence. In some embodiments, the viral genome comprises at least one filler sequence and the filler sequence is 5' of the 3' ITR sequence. In some embodiments, the viral genome comprises at least one filler sequence and the filler sequence is between two intron sequences. In some embodiments, the viral genome comprises at least one filler sequence and the filler sequence is within an intron sequence. In some embodiments, the viral genome comprises two filler sequences and a first filler sequence is 3' of the 5' ITR sequence and a second filler sequence is 3' of the polyadenylation signal sequence. In some embodiments, the viral genome comprises two filler sequences and a first filler sequence is 5' of the promoter sequence and a second filler sequence is 3' of the polyadenylation signal sequence. In some embodiments, the viral genome comprises two filler sequences and a first filler sequence is 3' of the 5' ITR sequence and a second filler sequence is 5' of the 5' ITR sequence.

[0199] In some embodiments, the viral genome is a self-complementary (sc) viral genome and comprises one or more stuffer sequences so that the length of the viral genome is about 2.3 kb. In some embodiments, the viral genome comprises at least one stuffer sequence and the stuffer sequence is 3' to the 5' ITR sequence. In some embodiments, the viral genome comprises at least one stuffer sequence and the stuffer sequence is 5' to the promoter sequence. In some embodiments, the viral genome comprises at least one stuffer sequence and the stuffer sequence is 3' to the polyadenylation signal sequence. In some embodiments, the viral genome comprises at least one stuffer sequence and the stuffer sequence is 5' to the 3' ITR sequence. In some embodiments, the viral genome comprises at least one stuffer sequence and the stuffer sequence is between two intron sequences. In some embodiments, the viral genome comprises at least one stuffer sequence and the stuffer sequence is within an intron sequence. In some embodiments, the viral genome comprises two stuffer sequences and the first stuffer sequence is 3' to the 5' ITR sequence and the second stuffer sequence is 3' to the polyadenylation signal sequence. In some embodiments, the viral genome comprises two stuffer sequences and the first stuffer sequence is 5' to the promoter sequence and the second stuffer sequence is 3' to the polyadenylation signal sequence. In some embodiments, the viral genome comprises two stuffer sequences and the first stuffer sequence is 3' to the 5' ITR sequence and the second stuffer sequence is 5' to the 5' ITR sequence.

[0200] In some embodiments, the viral genome can comprise one or more stuffer sequences between one of the more regions of the viral genome. In some embodiments, the stuffer region can be located before a region such as, but not limited to, a payload region, an inverted terminal repeat sequence (ITR), a promoter region, an intron region, an enhancer region, a polyadenylation signal sequence region, and / or an exon region. In some embodiments, the stuffer region can be located after a region such as, but not limited to, a payload region, an inverted terminal repeat sequence (ITR), a promoter region, an intron region, an enhancer region, a polyadenylation signal sequence region, and / or an exon region. In some embodiments, the stuffer region can be located before and after a region such as, but not limited to, a payload region, an inverted terminal repeat sequence (ITR), a promoter region, an intron region, an enhancer region, a polyadenylation signal sequence region, and / or an exon region.

[0201] In some embodiments, the viral genome can comprise one or more stuffer sequences that bifurcate at least one region of the viral genome. The bifurcated region of the viral genome can comprise 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% of the region 5' of the stuffer sequence region. In some embodiments, the stuffer sequence can bifurcate at least one region such that 10% of the region is 5' of the stuffer sequence and 90% of the region is 3' of the stuffer sequence. In some embodiments, the stuffer sequence can bifurcate at least one region such that 20% of the region is 5' of the stuffer sequence and 80% of the region is 3' of the stuffer sequence. In some embodiments, the stuffer sequence can bifurcate at least one region such that 30% of the region is 5' of the stuffer sequence and 70% of the region is 3' of the stuffer sequence. In some embodiments, the stuffer sequence can bifurcate at least one region such that 40% of the region is 5' of the stuffer sequence and 60% of the region is 3' of the stuffer sequence. In some embodiments, the stuffer sequence can bifurcate at least one region such that 50% of the region is 5' of the stuffer sequence and 50% of the region is 3' of the stuffer sequence. In some embodiments, the stuffer sequence can bifurcate at least one region such that 60% of the region is 5' of the stuffer sequence and 40% of the region is 3' of the stuffer sequence. In some embodiments, the stuffer sequence can bifurcate at least one region such that 70% of the region is 5' of the stuffer sequence and 30% of the region is 3' of the stuffer sequence. In some embodiments, the stuffer sequence can bifurcate at least one region such that 80% of the region is 5' of the stuffer sequence and 20% of the region is 3' of the stuffer sequence. In some embodiments, the stuffer sequence can bifurcate at least one region such that 90% of the region is 5' of the stuffer sequence and 10% of the region is 3' of the stuffer sequence.

[0202] In some embodiments, the viral genome comprises a stuffer sequence after the 5' ITR.

[0203] In some embodiments, the viral genome comprises a stuffer sequence after the promoter region. In some embodiments, the viral genome comprises a stuffer sequence after the payload region. In some embodiments, the viral genome comprises a stuffer sequence after the intron region. In some embodiments, the viral genome comprises a stuffer sequence after the enhancer region. In some embodiments, the viral genome comprises a stuffer sequence after the polyadenylation signal sequence region. In some embodiments, the viral genome comprises a stuffer sequence after the exon region.

[0204] In some embodiments, the viral genome comprises a stuffer sequence before the promoter region. In some embodiments, the viral genome comprises a stuffer sequence before the payload region. In some embodiments, the viral genome comprises a stuffer sequence before the intron region. In some embodiments, the viral genome comprises a stuffer sequence before the enhancer region. In some embodiments, the viral genome comprises a stuffer sequence before the polyadenylation signal sequence region. In some embodiments, the viral genome comprises a stuffer sequence before the exon region.

[0205] In some embodiments, the viral genome comprises a stuffer sequence before the 3' ITR.

[0206] In some embodiments, the stuffer sequence can be located between two regions, such as but not limited to between the 5' ITR and the promoter region. In some embodiments, the stuffer sequence can be located between two regions, such as but not limited to between the 5' ITR and the payload region. In some embodiments, the stuffer sequence can be located between two regions, such as but not limited to between the 5' ITR and the intron region. In some embodiments, the stuffer sequence can be located between two regions, such as but not limited to between the 5' ITR and the enhancer region. In some embodiments, the stuffer sequence can be located between two regions, such as but not limited to between the 5' ITR and the polyadenylation signal sequence region.

[0207] In some embodiments, the stuffer sequence can be located between two regions, such as but not limited to between the 5' ITR and the exon region.

[0208] In some embodiments, the stuffer sequence can be located between two regions, such as but not limited to between the promoter region and the payload region. In some embodiments, the stuffer sequence can be located between two regions, such as but not limited to between the promoter region and the intron region. In some embodiments, the stuffer sequence can be located between two regions, such as but not limited to between the promoter region and the enhancer region. In some embodiments, the stuffer sequence can be located between two regions, such as but not limited to between the promoter region and the polyadenylation signal sequence region. In some embodiments, the stuffer sequence can be located between two regions, such as but not limited to between the promoter region and the exon region. In some embodiments, the stuffer sequence can be located between two regions, such as but not limited to between the promoter region and the 3' ITR.

[0209] In some embodiments, a stuffer sequence can be located between two regions, such as but not limited to between a payload region and an intron region. In some embodiments, a stuffer sequence can be located between two regions, such as but not limited to between a payload region and an enhancer region. In some embodiments, a stuffer sequence can be located between two regions, such as but not limited to between a payload region and a polyadenylation signal sequence region. In some embodiments, a stuffer sequence can be located between two regions, such as but not limited to between a payload region and an exon region.

[0210] In some embodiments, a stuffer sequence can be located between two regions, such as but not limited to between a payload region and a 3' ITR. Viral genome component: payload

[0211] In some embodiments, the disclosure provides an AAV particle comprising a viral genome encoding a GBA1 protein, e.g., a GCase protein, encoded by a nucleotide sequence of SEQ ID NO: 2001 or SEQ ID NO: 2002. In some embodiments, the viral genome comprises a promoter operably linked to a nucleotide sequence encoding a GBA1 protein, e.g., SEQ ID NO: 2001 or SEQ ID NO: 2002. In some embodiments, the viral genome comprises a nucleotide sequence of SEQ ID NO: 2002.

[0212] In some embodiments, the disclosure provides constructs that enable improved expression of a GCase protein delivered by a gene therapy vector.

[0213] In some embodiments, the disclosure provides constructs that enable improved biodistribution of a GCase protein delivered by a gene therapy vector.

[0214] In some embodiments, the disclosure provides constructs that enable improved subcellular distribution or trafficking of a GCase protein delivered by a gene therapy vector.

[0215] In some embodiments, the disclosure provides constructs that enable improved trafficking of a GCase protein delivered by a gene therapy vector to the lysosomal membrane.

[0216] In some embodiments, the disclosure relates to a composition containing or comprising a nucleic acid sequence encoding a GBA1 protein or a functional fragment or variant thereof and methods of administering the composition in vitro or in vivo in a subject, e.g., a human subject and / or an animal model of a disease, e.g., a disease associated with GBA expression.

[0217] The AAV particles of the present disclosure can comprise a nucleic acid sequence encoding at least one "payload." As used herein, a "payload" or "payload region" refers to one or more polynucleotides or regions of polynucleotides encoded by or within a viral genome or expression products of such polynucleotides or regions of polynucleotides, e.g., transgenes, polynucleotides encoding polypeptides or multi-polypeptides, e.g., GBA1 proteins or functional fragments or variants thereof. The payload can comprise any nucleic acid known in the art suitable for expression of a GBA1 protein in a target cell (by supplementing a protein product or using a regulatory nucleic acid) transduced or contacted with a AAV particle carrying the payload.

[0218] In some embodiments, the present disclosure provides a nucleotide sequence encoding a GBA1 protein for use in an AAV genome, wherein the nucleotide sequence comprises a codon-optimized, CpG-reduced (e.g., CpG-depleted) GBA1-encoding sequence. In some embodiments, the CpG-reduced (e.g., CpG-depleted) GBA1-encoding sequence provides improved in vivo toxicity, e.g., reduced immunogenicity in a human or animal subject. In some embodiments, the nucleotide sequence further comprises one or more (e.g., all) 5' ITR sequences, CMVie sequences, CB promoter sequences, intron sequences, signal sequences, polyA sequences, and 3' ITR sequences. In some embodiments, the GBA1 protein encoded by the nucleotide sequence has an amino acid sequence that is 100% identical to a wild-type GBA1 protein. In some embodiments, the wild-type GBA1-encoding sequence is provided by NCBI Reference Sequence NP_000148.2 (SEQ ID NO: 14 of International Publication No. WO2019070893, which is incorporated herein by reference).

[0219] In some embodiments, the AAV genome encodes a payload construct comprising a combination of coding and non-coding nucleic acid sequences.

[0220] In some embodiments, the viral genome encodes more than one payload. As a non-limiting example, a viral genome encoding more than one payload can be replicated and packaged into a viral particle. A target cell transduced with a viral particle comprising more than one payload can express each of the payloads in a single cell.

[0221] In some embodiments, the viral genome can encode a coding RNA or a non-coding RNA. In certain embodiments, the adeno-associated viral vector particle further comprises at least one cis-element selected from the group consisting of: a Kozak sequence, a backbone sequence, and an intron sequence.

[0222] In some embodiments, the payload is a polypeptide comprising a secreted protein, an intracellular protein, an extracellular protein, and / or a membrane protein. In some embodiments, the encoded protein can be structural or functional. In some embodiments, the proteins encoded by the viral genome include, but are not limited to, mammalian proteins. In certain embodiments, the AAV particle comprises a viral genome encoding a GBA1 protein or a functional fragment or variant thereof. The AAV particles described herein can be useful in the field of human disease, veterinary applications, and various in vivo and in vitro situations.

[0223] In some embodiments, the payload comprises a polypeptide that functions as a marker protein to analyze cell transformation and expression, a fusion with a desired biological activity, a gene product that can complement a genetic deficiency, an RNA molecule, a transcription factor, and / or other gene product related to gene regulation and / or expression.

[0224] In some embodiments, the payload comprises a gene therapy product including, but not limited to, a polypeptide, an RNA molecule, or other gene product that provides a desired therapeutic effect when expressed in a target cell. In some embodiments, the gene therapy product can comprise a replacement for a non-functional gene or a gene that is absent, expressed in insufficient amounts, or mutated. In some embodiments, the gene therapy product can comprise a replacement for a non-functional protein or polypeptide or a protein or polypeptide that is absent, expressed in insufficient amounts, abnormally folded, degraded too rapidly, or mutated. For example, the gene therapy product can comprise a polynucleotide encoding a GBA1 protein to treat a GCase deficiency or a GBA1 -related disorder. In some embodiments, the gene therapy product includes a polynucleotide sequence encoding a GBA1 protein.

[0225] In some embodiments, the payload encodes a messenger RNA (mRNA). As used herein, the term "messenger RNA" (mRNA) refers to any polynucleotide that encodes a polypeptide of interest and is capable of being translated to produce the encoded polypeptide of interest in vitro, in vivo, in situ, or ex vivo. Certain embodiments provide an mRNA encoding a GCase or a variant thereof.

[0226] In some embodiments, the protein or polypeptide encoded by the payload construct encoding a GCase or functional variant thereof is between about 50 and about 4500 amino acid residues in length (hereinafter in this context, "X amino acids in length" means X amino acid residues). In some embodiments, the encoded protein or polypeptide is between 50 and 2000 amino acids in length. In some embodiments, the encoded protein or polypeptide is 50 to 1000 amino acids in length. In some embodiments, the encoded protein or polypeptide is 50 to 1500 amino acids in length. In some embodiments, the encoded protein or polypeptide is 50 to 1000 amino acids in length. In some embodiments, the encoded protein or polypeptide is 50 to 800 amino acids in length. In some embodiments, the encoded protein or polypeptide is 50 to 600 amino acids in length. In some embodiments, the encoded protein or polypeptide is between 50 and 400 amino acids in length. In some embodiments, the encoded protein or polypeptide is 50 to 200 amino acids in length. In some embodiments, the encoded protein or polypeptide is 50 to 100 amino acids in length. In some embodiments, the encoded protein or polypeptide is 497 amino acids in length.

[0227] The payload construct encoding a payload can comprise or encode a selectable marker. The selectable marker can comprise a genetic sequence or a protein or polypeptide encoded by a genetic sequence expressed in the host cell that allows for the identification, selection, and / or purification of the host cell from a population of cells in which the selectable marker can or can not be expressed. In some embodiments, the selectable marker provides resistance to undergo a selection process (such as treatment with an antibiotic) that would otherwise kill the host cell. In some embodiments, the antibiotic selectable marker can comprise one or more antibiotic resistance factors including, but not limited to, neomycin resistance (e.g., neo), hygromycin resistance, kanamycin resistance, and / or puromycin resistance.

[0228] In some embodiments, a payload construct encoding a payload can include an optional marker, including but not limited to beta-lactamase, luciferase, beta-galactosidase, or any other reporter gene, as that term is understood in the art, including cell surface markers such as CD4 or truncated nerve growth factor (NGFR) (see WO 96 / 23810; Heim et al., Current Biology 2: 178-182 (1996); Heim et al., Proc. Natl. Acad. Sci. USA (1995); or Heim et al., Science 373:663-664 (1995) for GFP; and WO 96 / 30540 for beta-lactamase); the contents of each of such documents are incorporated herein by reference in their entirety.

[0229] In some embodiments, a payload construct encoding an optional marker can include a fluorescent protein. A fluorescent protein as described herein can include any fluorescent marker, including but not limited to green, yellow, and / or red fluorescent proteins (GFP, YFP, and / or RFP). In some embodiments, a payload construct encoding an optional marker can include a human influenza hemagglutinin (HA) tag.

[0230] In certain embodiments, the nucleic acid for expressing a payload in a target cell will be incorporated into a viral genome and located between two ITR sequences.

[0231] In some embodiments, a payload construct further comprises a nucleic acid sequence encoding a peptide that binds with high affinity to the cation-independent mannose 6-phosphate (M6P) receptor (CI-MPR), as described in International Patent Application Publication No. WO2019213180A1, the disclosure of which is incorporated herein by reference in its entirety. The CI-MPR binding peptide can be, for example, an IGF2 peptide or a variant thereof. Binding to CI-MPR can facilitate cellular uptake or delivery and intracellular or subcellular targeting of a therapeutic protein provided by a gene therapy vector. Payload component: signal sequence

[0232] In some embodiments, a nucleic acid sequence comprising a transgene encoding a payload (e.g., a GBA1 protein) comprises a nucleic acid sequence encoding a signal sequence (e.g., a signal sequence region herein).

[0233] In some embodiments, the nucleotide sequence encoding a signal sequence is 5' of the nucleotide sequence encoding a GBA1 protein. In some embodiments, the encoded GBA1 protein comprises a signal sequence at the N-terminus, wherein the signal sequence is optionally cleaved during cellular processing and / or localization of the GBA1 protein and / or a potentiation element.

[0234] In some embodiments, the signal sequence comprises SEQ ID NO:2005 or a sequence that is at least 85% identical (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical). In some embodiments, the signal sequence comprises the amino acid sequence of SEQ ID NO:1853 or an amino acid sequence that is at least 90% identical (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical). Exemplary GCase (GBA1) protein payload

[0235] In some implementations, the payload, such as the viral genome payload described herein, is a wild-type GBA1 protein, for example, the wild-type GBA1 protein.

[0236] Tables 2A and 2B provide exemplary polynucleotide sequences encoding the GBA1 protein and exemplary polypeptide sequences of the GBA1 protein that can be used in the viral genome disclosed herein and constitute a GBA1 protein payload. In some embodiments, the GBA1 protein suitable for delivery in the AAV disclosed herein is encoded by the nucleotide sequence of SEQ ID NO:2001 or SEQ ID NO:2002. Table 2A. Exemplary GCase sequences SEQ ID NO: Type Species Description 1740 Protein Homo sapiens GBA1 Protein NP_000148.2 1741 DNA Homo sapiens GBA1 mRNA Transcript Variant 1 NM_000157.4 1742 Protein Homo sapiens GBA1 Protein NP_001005741.1 1743 DNA Homo sapiens GBA1 mRNA Transcript Variant 2 NM_01005741.3 1744 Protein Homo sapiens GBA1 Protein NP_001005742.1 1745 DNA Homo sapiens GBA1 mRNA Transcript Variant 3 NM_001005742.3 1746 Protein Homo sapiens GBA1 Protein NP_001165282.1 1747 DNA Homo sapiens GBA1 mRNA Transcript Variant 4 NM_001171811.2 1748 Protein Homo sapiens GBA1 Protein NP_001165283.1 1749 DNA Homo sapiens GBA1 mRNA Transcript Variant 5 NM_001171812.2 Table 2B. Exemplary GCase sequences

[0237] In some embodiments, the nucleotide sequence encoding the GBA1 protein described herein contains, for example, a reduced number of CpG motifs (e.g., lacking all CpG motifs) relative to the nucleotide sequence of SEQ ID NO: 1776 or 1777.

[0238] In some embodiments, the encoded GBA1 protein comprises the amino acid sequence of SEQ ID NO: 1774 or SEQ ID NO: 1775.

[0239] In some embodiments, the nucleotide sequence encoding a GBA1 protein or functional variant thereof comprises the nucleotide sequence of SEQ ID NO: 2002. In some embodiments, the nucleotide sequence encoding a GBA1 protein comprises the sequence of SEQ ID NO: 2001, wherein the encoded GBA1 protein comprises a signal sequence, wherein the signal sequence is encoded by the nucleotide sequence of SEQ ID NO: 2005.

[0240] In some embodiments, a codon-optimized nucleotide sequence encoding a GBA1 protein described herein (e.g., SEQ ID NO: 2001 or SEQ ID NO: 2002) is replaced with a nucleotide sequence encoding a GBA1 protein comprising the amino acid sequence of SEQ ID NO: 1774 or SEQ ID NO: 1775. In some embodiments, the nucleotide sequence encoding a GBA1 protein described herein (e.g., SEQ ID NO: 2001 or SEQ ID NO: 2002) is replaced with a nucleotide sequence encoding a GBA1 protein comprising the amino acid sequence of SEQ ID NO: 1774 or SEQ ID NO: 1775. ​In some embodiments, the codon-optimized nucleotide sequence of a GBA1 protein described herein (e.g., SEQ ID NO: 2001 or SEQ ID NO: 2002) contains more than 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, or more unique modifications, e.g., mutations, compared to the nucleotide sequence of SEQ ID NO: 1776. In some embodiments, the codon-optimized nucleotide sequence of a GBA1 protein described herein (e.g., SEQ ID NO: 2001 or SEQ ID NO: 2002) comprises a unique GC content profile. Without wishing to be bound by theory, it is believed that in some embodiments, altering the GC content of the nucleotide sequence of a GBA1 protein described herein can enhance expression of the codon-optimized nucleotide sequence in a cell, e.g., a human cell or a neuronal cell. In some embodiments, the codon-optimized nucleotide sequence of a GBA1 protein described herein (e.g., SEQ ID NO: 2001 or SEQ ID NO: 2002) has a reduced GC content relative to the wild-type GBA1 nucleotide sequence. In some embodiments, the codon-optimized nucleotide sequence of a GBA1 protein described herein (e.g., SEQ ID NO: 2001 or SEQ ID NO: 2002) comprises a reduced number of CpG motifs (e.g., lacks all CpG motifs) compared to the wild-type GBA1 coding sequence (e.g., comprising the nucleotide sequence of SEQ ID NO: 1776 or 1777). In some embodiments, the codon-optimized nucleotide sequence of a GBA1 protein described herein (e.g., SEQ ID NO: 2001 or SEQ ID NO: 2002) does not contain CpG motifs. Without wishing to be bound by theory, in some embodiments, sequences with depleted CpG nucleotides can reduce toxicity, e.g., immunogenicity, in vivo.

[0241] In some embodiments, the viral genome comprises a payload region encoding a GCase protein. The encoded GCase protein can be derived from any species, such as, but not limited to, a human, a non-human primate, or a rodent.

[0242] In some embodiments, the viral genome comprises a payload region encoding a human (Homo sapiens) GCase protein. In some embodiments, the methods disclosed herein can be used to make a GCase protein. Payload component: augmentation element

[0243] In some embodiments, the viral genome described herein encoding a GBA1 protein comprises a potentiation element or a functional variant thereof. In some embodiments, the encoded potentiation element comprises a prosaposin (PSAP) protein, a saposin C (SapC) protein, or a functional variant thereof; a cell-penetrating peptide (e.g., an ApoE II peptide, a TAT peptide, and / or an ApoB peptide), or a functional variant thereof; or a lysosomal targeting signal, or a functional variant thereof.

[0244] In some embodiments, the viral genome comprises a payload region further encoding a prosaposin (PSAP) protein or a saposin C (SapC) protein, or a functional variant thereof, e.g., as described herein, e.g., in Tables 3A or 3B. Table 3A. Exemplary PSAP and saposin sequences Table 3B. Exemplary potentiation elements Exemplary GBA1 AA V viral genome sequence regions and ITR-to-ITR sequences

[0245] In some embodiments, the viral genome described herein (e.g., an AAV viral genome or vector genome) comprises a promoter operably linked to a transgene encoding a GBA1 protein. In some embodiments, the viral genome further comprises an inverted terminal repeat region, an enhancer, an intron, a miR binding site, a polyA region, or a combination thereof. Exemplary sequence regions within the ITR-to-ITR sequence of a viral genome according to the specification are provided in Table 4. Table 4. Exemplary viral genome sequence regions in ITR-to-ITR constructs

[0246] In some embodiments, the viral genome comprises an inverted terminal repeat sequence region (ITR) provided in Table 4, or a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity to any of the ITR sequences in Table 5.

[0247] In some embodiments, this disclosure also provides a GBA1 protein encoded by a nucleotide sequence of SEQ ID NO 2001 or having at least 93%, 94%, 95%, 97%, 98%, or 99% sequence identity therewith, or by SEQ ID NO 2002 or having at least 94%, 95%, 96%, 97%, 98%, or 99% sequence identity therewith. In some embodiments, the viral genome includes a promoter comprising a nucleotide sequence of SEQ ID NO 1834 or having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity therewith.

[0248] In some embodiments, the viral genome of the AAV particle described herein contains nucleotide sequences, such as the nucleotide sequences of SEQ ID NO:2006 and SEQ ID NO:2007, or nucleotide sequences from 5'ITR to 3'ITR that are at least 97%, at least 98%, or at least 99% identical to those sequences.

[0249] In some embodiments, this disclosure also provides a GBA1 protein (e.g., GBA1 protein) encoded by a sequence of SEQ ID NO:2001 or at least 93% identical thereto, or by a sequence of SEQ ID NO:2002 or at least 94% identical thereto.

[0250] In some embodiments, the viral genome encoding the GBA1 protein is the wtGBA1 viral genome, wherein the viral genome contains a codon-optimized nucleotide sequence encoding the wild-type GBA1 protein, wherein the nucleotide sequence contains a reduced number of CpG nucleotides (e.g., lacking all CpG motifs) compared to the wild-type GBA1 coding sequence (e.g., the nucleotide sequence containing SEQ ID NO: 1776 or 1777). In some embodiments, the viral genome encoding the GBA1 protein is the wtGBA1 viral genome, wherein the viral genome contains a codon-optimized nucleotide sequence encoding the wild-type GBA1 protein, wherein the nucleotide sequence does not contain any CpG nucleotides. Table 5. Exemplary viral genome (ITR to ITR) sequences Table 6. Exemplary ITR-to-ITR sequences encoding GBA1 proteins

[0251] In some embodiments, the viral genome of an AAV particle described herein comprises a nucleotide sequence comprising one or more (e.g., all) of the components provided in Table 9 or Table 10, or a sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity thereto.

[0252] In some embodiments, the viral genome of an AAV particle described herein comprises a GBA1 variant nucleotide sequence of SEQ ID NO: 2002 (e.g., shown in Table 9), or a sequence having at least 95% identity thereto. In some embodiments, the AAV particle comprises improved GC content and reduced immunogenicity compared to an AAV particle comprising a GBA1 variant nucleotide sequence of SEQ ID NO: 1773 (e.g., shown in Table 7). In some embodiments, the viral genome of an AAV particle described herein comprises a signal sequence of SEQ ID NO: 2005 and a GBA1 variant nucleotide sequence of SEQ ID NO: 2002 (e.g., shown in Table 9), or a sequence having at least 95% identity thereto. In some embodiments, the AAV particle comprises improved GC content and reduced immunogenicity compared to an AAV particle comprising a signal sequence of SEQ ID NO: 1850 and a GBA1 variant nucleotide sequence of SEQ ID NO: 1773 (e.g., shown in Table 7). In some embodiments, the viral genome of an AAV particle described herein comprises a nucleotide sequence of SEQ ID NO: 2006 (e.g., shown in Table 9), or a sequence having at least 95% identity thereto. In some embodiments, the AAV particle comprises improved GC content and reduced immunogenicity compared to an AAV particle comprising a nucleotide sequence of SEQ ID NO: 1812 (e.g., shown in Table 7).

[0253] In some embodiments, the viral genome of an AAV particle described herein comprises a GBA1 variant nucleotide sequence comprising SEQ ID NO: 2002 (e.g., shown in Table 10) or a sequence with at least 95% identity thereto. In some embodiments, the AAV particle comprises an improved GC content and reduced immunogenicity compared to an AAV particle comprising a GBA1 variant nucleotide sequence comprising SEQ ID NO: 1773 (e.g., shown in Table 8). In some embodiments, the viral genome of an AAV particle described herein comprises a signal sequence comprising SEQ ID NO: 2005 and a GBA1 variant nucleotide sequence comprising SEQ ID NO: 2002 (e.g., shown in Table 10) or a sequence with at least 95% identity thereto. In some embodiments, the AAV particle comprises an improved GC content and reduced immunogenicity compared to an AAV particle comprising a signal sequence comprising SEQ ID NO: 1850 and a GBA1 variant nucleotide sequence comprising SEQ ID NO: 1773 (e.g., shown in Table 8). In some embodiments, the viral genome of an AAV particle described herein comprises a nucleotide sequence comprising SEQ ID NO: 2007 (e.g., shown in Table 10) or a sequence with at least 95% identity thereto. In some embodiments, the AAV particle comprises an improved GC content and reduced immunogenicity compared to an AAV particle comprising a nucleotide sequence comprising SEQ ID NO: 1828 (e.g., shown in Table 8). Table 7. Sequence regions in ITR-to-ITR sequences Table 8. Sequence regions in ITR-to-ITR sequences Table 9. Sequence regions in ITR-to-ITR sequences

[0254] In some embodiments, the AAV particle comprises a nucleotide sequence encoding a wild-type GBA1 protein, wherein the nucleotide sequence comprises the sequence of SEQ ID NO: 2002 or a sequence with at least 93% identity thereto.

[0255] In some embodiments, the AAV particle comprising the nucleotide sequence of SEQ ID NO: 2002 further comprises an ITR sequence 130 nucleotides in length, wherein optionally the ITR sequence comprises the nucleotide sequence of SEQ ID NO: 1829 or SEQ ID NO: 1830, or a sequence at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the AAV particle comprises a 5’ ITR comprising the nucleotide sequence of SEQ ID NO: 1829 or a sequence at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, and / or a 3’ ITR comprising the nucleotide sequence of SEQ ID NO: 1830 or a sequence at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.

[0256] In some embodiments, the AAV particle comprising the nucleotide sequence of SEQ ID NO: 2002 further comprises a CMVie sequence and / or a CB promoter operably linked to the nucleotide sequence encoding the GBA1 protein, wherein optionally the CMVie sequence comprises the nucleotide sequence of SEQ ID NO: 1831 or a sequence at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, and the CB promoter comprises the nucleotide sequence of SEQ ID NO: 1834 or a sequence at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.

[0257] In some embodiments, the AAV particle comprising the nucleotide sequence of SEQ ID NO: 2002 further comprises a sequence encoding a signal peptide, wherein the sequence encoding the signal peptide comprises the nucleotide sequence of SEQ ID NO: 2005 or a sequence at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, wherein the sequence encoding the signal peptide is 5’ of the sequence encoding the GBA1 protein.

[0258] In some embodiments, the AAV particle comprising the nucleotide sequence of SEQ ID NO: 2002 further comprises an intron region comprising the nucleotide sequence of SEQ ID NO: 1842 or a sequence at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.

[0259] In some embodiments, the AAV particle comprising the nucleotide sequence of SEQ ID NO: 2002 further comprises a polyA sequence comprising the nucleotide sequence of SEQ ID NO: 1846 or a sequence at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.

[0260] In some embodiments, the AAV particle containing the nucleotide sequence of SEQ ID NO:2002 further comprises, from 5' to 3', one or more (e.g., all) of the following: an ITR containing the nucleotide sequence of SEQ ID NO:1829 or a sequence identical to it at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%); a CMVie sequence containing the nucleotide sequence of SEQ ID NO:1831 or a sequence identical to it at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%); and a CB promoter containing SEQ ID NO:1829. The nucleotide sequence of SEQ ID NO:1834 or a sequence that is at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to it; an intron comprising the nucleotide sequence of SEQ ID NO:1842 or a sequence that is at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to it; a signal sequence comprising SEQ ID NO:1842. The nucleotide sequence of SEQ ID NO:2005 or a sequence that is at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to it; a polyA sequence comprising the nucleotide sequence of SEQ ID NO:1846; and / or an ITR comprising the nucleotide sequence of SEQ ID NO:1830 or a sequence that is at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to it.

[0261] In some embodiments, the AAV particle comprises a viral genome comprising a sequence encoding a GBA1 protein, wherein the sequence comprises SEQ ID NO: 2002 or a sequence at least 93% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the AAV particle comprises a viral genome comprising the nucleotide sequence of SEQ ID NO: 2006 (GBA_VG35) or a nucleotide sequence at least 97% (e.g., at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the viral genome comprising the nucleotide sequence of SEQ ID NO: 2006 comprises, in 5' to 3' order: a 5' ITR sequence, a nucleotide sequence comprising SEQ ID NO: 1829 or a nucleotide sequence at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; a CMVie enhancer, a nucleotide sequence comprising SEQ ID NO: 1831 or a nucleotide sequence at least 95% identical thereto; a CB promoter, a nucleotide sequence comprising SEQ ID NO: 1834 or a nucleotide sequence at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; an intron, a nucleotide sequence comprising SEQ ID NO: 1842 or a nucleotide sequence at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; a nucleotide sequence encoding a signal sequence, a nucleotide sequence comprising SEQ ID NO: 2005 or a nucleotide sequence at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; a nucleotide sequence encoding a GBA1 protein, a nucleotide sequence comprising SEQ ID NO: 2002 or a nucleotide sequence at least 94% (e.g., at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to the nucleotide sequence of SEQ ID NO: 2002; a polyadenylation sequence, a nucleotide sequence comprising SEQ ID NO: 1846 or a nucleotide sequence at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and / or a 3' ITR sequence region, a nucleotide sequence comprising SEQ ID NO: 1830 or a nucleotide sequence at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.

[0262] In some embodiments, the AAV viral genome does not comprise a miR-183 binding site.

[0263] In some embodiments, the nucleotide sequence encoding a GBA1 protein comprises a sequence that is at least 94% identical to SEQ ID NO: 2002. In some embodiments, the nucleotide sequence encoding a GBA protein comprises a sequence that is at least 95% identical to SEQ ID NO: 2002. In some embodiments, the nucleotide sequence encoding a GBA1 protein comprises a sequence that is at least 96% identical to SEQ ID NO: 2002. In some embodiments, the nucleotide sequence encoding a GBA1 protein comprises a sequence that is at least 97% identical to SEQ ID NO: 2002. In some embodiments, the nucleotide sequence encoding a GBA1 protein comprises a sequence that is at least 98% identical to SEQ ID NO: 2002. In some embodiments, the nucleotide sequence encoding a GBA1 protein comprises a sequence that is at least 99% identical to SEQ ID NO: 2002. In some embodiments, the nucleotide sequence encoding a GBA1 protein comprises SEQ ID NO: 2002.

[0264] In some embodiments, a viral genome comprising a nucleotide sequence of SEQ ID NO: 2006, or a nucleotide sequence at least 97% (e.g., at least 97%, at least 98%, or at least 99%) identical thereto, encodes a GBA1 protein comprising an amino acid sequence of SEQ ID NO: 1775. Table 10. Sequence regions in ITR-to-ITR sequences

[0265] In some embodiments, the AAV particle comprises a nucleotide sequence encoding a wild-type GBA1 protein, wherein the nucleotide sequence comprises a nucleotide sequence of SEQ ID NO: 2002, or a sequence at least 93% (e.g., at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.

[0266] In some embodiments, the AAV particle comprising a sequence of SEQ ID NO: 2002 further comprises at least one miR183 binding site. In some embodiments, the AAV particle comprising a sequence of SEQ ID NO: 2002 further comprises four miR183 binding sites, wherein each miR 183 binding site comprises a sequence of SEQ ID NO: 1847, or a sequence at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.

[0267] In some embodiments, the AAV particle comprising the sequence of SEQ ID NO: 2002 further comprises at least one spacer sequence between the two miR binding sites, wherein each spacer sequence comprises the sequence of SEQ ID NO: 1848 or a sequence at least 75% identical (e.g., at least 75%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto).

[0268] In some embodiments, the AAV particle comprising the sequence of SEQ ID NO: 2002 further comprises a series of miR binding sites comprising SEQ ID NO: 1849 or a sequence at least 70% identical (e.g., at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto).

[0269] In some embodiments, an AAV particle comprising the nucleotide sequence of SEQ ID NO: 2002 further comprises one or more (e.g., all of) the following, from 5’ to 3’: an ITR, a nucleotide sequence comprising SEQ ID NO: 1829 or a sequence at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; a CMVie sequence, a nucleotide sequence comprising SEQ ID NO: 1831 or a sequence at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; a CB promoter, a nucleotide sequence comprising SEQ ID NO: 1834 or a sequence at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; an intron, a nucleotide sequence comprising SEQ ID NO: 1842 or a sequence at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; a signal sequence, a nucleotide sequence comprising SEQ ID NO: 2005 or a sequence at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; a series of miR183 binding sites, a nucleotide sequence comprising SEQ ID NO: 1849 or a sequence at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; a polyA sequence, a nucleotide sequence comprising SEQ ID NO: 1846; and / or an ITR, a nucleotide sequence comprising SEQ ID NO: 1830 or a sequence at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.

[0270] In some embodiments, the AAV particle comprises a viral genome comprising a sequence encoding a GBA1 protein, wherein the sequence comprises SEQ ID NO: 2002 or a sequence at least 93% identical thereto (e.g., at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto). In some embodiments, the AAV particle comprises a viral genome comprising the nucleotide sequence of SEQ ID NO: 2007 (GBA_VG36) or a nucleotide sequence at least 97% identical thereto (e.g., at least 97%, at least 98%, or at least 99% identical thereto).In some embodiments, the viral genome comprising the nucleotide sequence of SEQ ID NO: 2007 comprises, in 5' to 3' order: a 5' ITR sequence region comprising the nucleotide sequence of SEQ ID NO: 1829 or a nucleotide sequence at least 95% identical (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto); a CMVie enhancer comprising the nucleotide sequence of SEQ ID NO: 1831 or a nucleotide sequence at least 95% identical (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto); a CB promoter comprising the nucleotide sequence of SEQ ID NO: 1834 or a nucleotide sequence at least 95% identical (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto); an intron comprising the nucleotide sequence of SEQ ID NO: 1842 or a nucleotide sequence at least 95% identical (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto); a nucleotide sequence encoding a signal sequence comprising the nucleotide sequence of SEQ ID NO: 2005 or a nucleotide sequence at least 95% identical (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto); a nucleotide sequence encoding a GBA1 protein comprising the nucleotide sequence of SEQ ID NO: 2002 or a nucleotide sequence at least 93% (e.g., at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to the nucleotide sequence of SEQ ID NO: 2002; a miR183 binding site series comprising the sequence of SEQ ID NO: 1849 or a sequence at least 95% identical (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto); a polyadenylation sequence comprising the nucleotide sequence of SEQ ID NO: 1846 or a nucleotide sequence at least 95% identical (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto); and a 3' ITR sequence region comprising the nucleotide sequence of SEQ ID NO: 1830 or a nucleotide sequence at least 95% identical (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto).

[0271] In some embodiments, the viral genome comprising the nucleotide sequence of SEQ ID NO: 2007 or a nucleotide sequence at least 97% identical (e.g., at least 97%, at least 98%, or at least 99% identical thereto) encodes a GBA1 protein comprising the amino acid sequence of SEQ ID NO: 1775.

[0272] In some embodiments, the AAV viral genome further comprises a nucleic acid encoding a capsid protein, e.g., a structural protein. In some embodiments, the capsid protein comprises a VP1 polypeptide, a VP2 polypeptide, and / or a VP3 polypeptide. In some embodiments, the VP1 polypeptide, the VP2 polypeptide, and / or the VP3 polypeptide is encoded by at least one Cap gene. In some embodiments, the AAV viral genome further comprises a nucleic acid encoding a Rep protein, e.g., a non-structural protein. In some embodiments, the Rep protein comprises a Rep78 protein, a Rep68 protein, a Rep52 protein, and / or a Rep40 protein. In some embodiments, the Rep78 protein, the Rep68 protein, the Rep52 protein, and / or the Rep40 protein is encoded by at least one Rep gene.

[0273] In some embodiments, the AAV particle comprises a viral genome comprising the nucleotide sequence of SEQ ID NO: 2006 or SEQ ID NO: 2007, or a sequence having at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 2006 or SEQ ID NO: 2007. In some embodiments, the viral genome is encapsidated in a capsid protein having a serotype selected from Table 1, or a functional variant thereof. In some embodiments, the capsid protein comprises VOY101, VOY201, AAVPHP.N (PHP.N), AAVPHP.B (PHP.B), AAVPHP.A (PHP.A), PHP.B2, PHP.B3, G2B4, G2B5, AAV5, AAV9, AAVrh10, or a functional variant thereof. In some embodiments, the capsid protein comprises a VOY101 capsid protein, or a functional variant thereof. In some embodiments, the capsid protein comprises an AAV9 capsid protein, or a functional variant thereof. In some embodiments, the capsid protein comprises an AAV5 capsid protein, or a functional variant thereof.

[0274] In some embodiments, an AAV particle comprising a viral genome comprising a nucleotide sequence of SEQ ID NO: 2006 or SEQ ID NO: 2007, or a sequence having at least 97%, at least 98%, or at least 99% sequence identity thereto, comprises a capsid protein comprising an amino acid sequence of SEQ ID NO: 138, or a sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity thereto. In some embodiments, the capsid protein comprises an amino acid sequence having at least one, two or three modifications, but not more than 30, 20 or 10 modifications, of the amino acid sequence of SEQ ID NO: 138. In some embodiments, the capsid protein is encoded by a nucleotide sequence of SEQ ID NO: 137, or a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity thereto. In some embodiments, the capsid protein comprises an amino acid substitution at position K449, e.g., a K449R substitution, according to the numbering of SEQ ID NO: 138. In some embodiments, the capsid protein comprises an insert comprising an amino acid sequence of TLAVPFK (SEQ ID NO: 1262), wherein the insert is present immediately after position 588 with respect to the reference sequence according to the numbering of SEQ ID NO: 138. In some embodiments, the capsid protein comprises an amino acid other than “A” at position 587 and / or an amino acid other than “Q” at position 588 according to the numbering of SEQ ID NO: 138. In some embodiments, the capsid protein comprises an amino acid substitution of A587D and / or Q588G according to the numbering of SEQ ID NO: 138. In some embodiments, the capsid protein comprises an insert comprising an amino acid sequence of PLNGAVHLY (SEQ ID NO: 3648), wherein the amino acid sequence of PLNGAVHLY (SEQ ID NO: 3648) is present immediately after position 586 with respect to the reference sequence according to the amino acid sequence numbering of SEQ ID NO: 138. In some embodiments, the AAV capsid comprises an amino acid sequence of SEQ ID NO: 3636.

[0275] In some embodiments, an AAV particle comprising a viral genome comprising SEQ ID NO: 2006 or SEQ ID NO: 2007, or a sequence having at least 97%, at least 98%, or at least 99% identity thereto, comprises a capsid protein comprising the amino acid sequence of SEQ ID NO: 1 or a sequence substantially identical thereto (e.g., having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity). In some embodiments, the capsid protein comprises an amino acid sequence having at least one, two, or three modifications but not more than 30, not more than 20, or not more than 10 modifications of the amino acid sequence of SEQ ID NO: 1. In some embodiments, the capsid protein is encoded by the nucleotide sequence of SEQ ID NO: 2 or a nucleotide sequence substantially identical thereto (e.g., having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity).

[0276] In some embodiments, the present disclosure provides vectors, cells, and / or AAV particles comprising the viral genomes identified above. Self-complementary and single-stranded vectors

[0277] In some embodiments, the AAV vectors used in the present disclosure are single- stranded vectors (ssAAV).

[0278] In some embodiments, the AAV vectors can be self-complementary AAV vectors (scAAV). See, e.g., U.S. Patent No. 7,465,583. scAAV vectors contain two DNA strands that are annealed together to form double-stranded DNA. By skipping the second strand synthesis, scAAV achieves rapid expression in cells.

[0279] In some embodiments, the AAV vectors used in the present disclosure are scAAV.

[0280] Methods for producing and / or modifying AAV vectors are disclosed in the art, such as pseudotyped AAV vectors (International Patent Publication Nos. WO200028004, WO200123001, WO2004112727, WO 2005005610, and WO2005072364, the contents of each of which are incorporated herein by reference in their entirety). Viral genome size

[0281] In some embodiments, the viral genome of the AAV particle of the present disclosure can be single-stranded or double-stranded. The size of the vector genome can be small, medium, large, or maximum.

[0282] In some embodiments, the vector genome comprising a nucleic acid sequence encoding a GCase protein described herein can be a small single-stranded vector genome. The size of the small single-stranded vector genome can be about 2.7 kb to about 3.5 kb, such as about 2.7, about 2.8, about 2.9, about 3.0, about 3.1, about 3.2, about 3.3, about 3.4, or about 3.5 kb in size. In some embodiments, the size of the small single-stranded vector genome can be 3.2 kb.

[0283] In some embodiments, the vector genome comprising a nucleic acid sequence encoding a GCase protein described herein can be a small double-stranded vector genome. The size of the small double-stranded vector genome can be about 1.3 to about 1.7 kb, such as about 1.3, about 1.4, about 1.5, about 1.6, or about 1.7 kb in size. In some embodiments, the size of the small double-stranded vector genome can be 1.6 kb.

[0284] In some embodiments, the vector genome comprising a nucleic acid sequence encoding a GCase protein described herein can be a medium single-stranded vector genome. The size of the medium single-stranded vector genome can be about 3.6 to about 4.3 kb, such as about 3.6, about 3.7, about 3.8, about 3.9, about 4.0, about 4.1, about 4.2, or about 4.3 kb in size. In some embodiments, the size of the medium single-stranded vector genome can be 4.0 kb.

[0285] In some embodiments, the vector genome comprising a nucleic acid sequence encoding a GCase protein described herein can be a medium double-stranded vector genome. The size of the medium double-stranded vector genome can be about 1.8 to about 2.1 kb, such as about 1.8, about 1.9, about 2.0, or about 2.1 kb in size. In some embodiments, the size of the medium double-stranded vector genome can be 2.0 kb. Additionally, the vector genome can comprise a promoter and a polyA tail.

[0286] In some embodiments, the vector genome comprising a nucleic acid sequence encoding a GCase protein described herein can be a large single-stranded vector genome. The size of the large single-stranded vector genome can be 4.4 to 6.0 kb, such as about 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, and 6.0 kb in size. As a non-limiting example, the size of the large single-stranded vector genome can be 4.7 kb. As another non-limiting example, the size of the large single-stranded vector genome can be 4.8 kb. As another non-limiting example, the size of the large single-stranded vector genome can be 6.0 kb.

[0287] In some embodiments, the vector genome comprising a nucleic acid sequence encoding a GCase protein described herein can be a large double-stranded vector genome. The size of the large double-stranded vector genome can be 2.2 to 3.0 kb, such as about 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, and 3.0 kb in size. As a non-limiting example, the size of the large double-stranded vector genome can be 2.4 kb. backbone

[0288] In certain embodiments, a cis-element such as a vector backbone is incorporated into a viral particle encoding, for example, a GBA1 protein or a GBA1 protein and a booster element described herein. Without wishing to be bound by theory, it is believed that in some embodiments, the backbone sequence can promote stability of GBA1 protein expression and / or expression levels of GBA1 protein.

[0289] In some embodiments, the disclosure also provides a nucleic acid encoding a viral genome (e.g., a viral genome comprising a nucleotide sequence of any of Tables 18-21 or 29-32 or a nucleotide sequence substantially identical (e.g., having at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% sequence identity) thereto) and a backbone region suitable for replication of the viral genome in a bacterial cell (e.g., a bacterial cell) (e.g., wherein the backbone region comprises one or both of a bacterial origin of replication and an optional marker). II. Virus production Universal virus production method

[0290] In some embodiments, the cells used to produce AAV (e.g., rAAV) particles can comprise mammalian cells (such as HEK293 cells) and / or insect cells (such as Sf9 cells).

[0291] In various embodiments, AAV production includes processes and methods for producing AAV particles and vectors, such AAV particles or vectors can contact target cells to deliver a payload, e.g., a recombinant viral construct, which includes nucleotides encoding a payload molecule. In certain embodiments, the viral vector is an adeno-associated virus (AAV) vector, such as a recombinant adeno-associated virus (rAAV) vector. In certain embodiments, the AAV particle is an adeno-associated virus (AAV) particle, such as a recombinant adeno-associated virus (rAAV) particle.

[0292] In some embodiments, disclosed herein is a cell comprising a viral genome of the disclosure. In some embodiments, the cell is a bacterial cell, a mammalian cell (e.g., a HEK293 cell), or an insect cell (e.g., a Sf9 cell).

[0293] In some embodiments, disclosed herein is a method of making a viral genome. The method comprises providing a nucleic acid encoding a viral genome described herein and a backbone region suitable for replication of the viral genome in a cell (e.g., a bacterial cell) (e.g., wherein the backbone region comprises one or both of a bacterial origin of replication and an optional marker), and excising the viral genome from the backbone region, e.g., by cleaving the nucleic acid molecule upstream and downstream of the viral genome. In some embodiments, the viral genome comprising a promoter operably linked to a nucleic acid comprising a transgene encoding a GBA1 protein (e.g., a GBA1 protein described herein) is incorporated into an AAV particle produced by a cell. In some embodiments, the cell is a bacterial cell, a mammalian cell (e.g., a HEK293 cell), or an insect cell (e.g., a Sf9 cell).

[0294] In some embodiments, disclosed herein is a method for making a recombinant AAV particle of the disclosure, the method comprising (i) providing a host cell comprising a viral genome described herein, and incubating the host cell under conditions suitable for encapsidation of the viral genome in a capsid protein (e.g., a capsid protein described herein (e.g., a capsid protein listed in Table 1, e.g., a VOY101 capsid protein or a functional variant thereof)), thereby making a recombinant AAV particle. In some embodiments, the method comprises, prior to step (i), introducing a first nucleic acid comprising the viral genome into the cell. In some embodiments, the host cell comprises a second nucleic acid encoding a capsid protein. In some embodiments, the second nucleic acid is introduced into the host cell prior to, simultaneously with, or after the first nucleic acid molecule. In some embodiments, the host cell is a bacterial cell, a mammalian cell (e.g., a HEK293 cell), or an insect cell (e.g., a Sf9 cell).

[0295] In various embodiments, provided herein are methods of producing AAV particles or vectors by: (a) contacting a virus production cell with one or more viral expression constructs encoding at least one AAV capsid protein and one or more payload constructs encoding a payload molecule, which can be selected from the group consisting of: a transgene, a polynucleotide encoding a protein, and a regulatory nucleic acid; (b) culturing the virus production cell under conditions such that at least one AAV particle or vector is produced, and (c) isolating the AAV particle or vector from the production material stream.

[0296] In such methods, the viral expression construct can encode at least one structural protein and / or at least one non-structural protein. The structural protein can include any of the native or wild-type capsid proteins VP1, VP2, and / or VP3 or chimeric proteins thereof. The non-structural protein can include any of the native or wild-type Rep78, Rep68, Rep52, and / or Rep40 proteins or chimeric proteins thereof.

[0297] In certain embodiments, the contacting occurs via transient transfection, viral transduction, and / or electroporation.

[0298] In certain embodiments, the virus production cell is selected from the group consisting of a mammalian cell and an insect cell. In certain embodiments, the insect cell includes a Spodoptera frugiperda insect cell. In certain embodiments, the insect cell includes an Sf9 insect cell. In certain embodiments, the insect cell includes an Sf21 insect cell.

[0299] In various embodiments, the payload construct vectors of the present disclosure can include at least one inverted terminal repeat sequence (ITR) and can include mammalian DNA.

[0300] Also provided are AAV particles and viral vectors produced according to the methods described herein.

[0301] In various embodiments, the AAV particles of the present disclosure can be formulated with one or more acceptable excipients into a pharmaceutical composition.

[0302] In certain embodiments, the AAV particles or viral vectors can be produced by the methods described herein.

[0303] In certain embodiments, AAV particles can be produced by contacting a virus production cell (e.g., an insect cell or a mammalian cell) with at least one viral expression construct encoding at least one capsid protein and at least one payload construct carrier. The virus production cell can be contacted by transient transfection, viral transduction, and / or electroporation. The payload construct carrier can include a payload construct encoding a payload molecule, such as, but not limited to, a transgene, a polynucleotide encoding a protein, and a regulatory nucleic acid. The virus production cell can be cultured under conditions such that at least one AAV particle or vector is produced, isolated (e.g., using temperature-induced lysis, mechanical lysis, and / or chemical lysis), and / or purified (e.g., using filtration, chromatography, and / or immunoaffinity purification). As a non-limiting example, the payload construct carrier can include mammalian DNA.

[0304] In certain embodiments, AAV particles are produced in insect cells (e.g., Spodoptera frugiperda (Sf9) cells) using the methods described herein. As a non-limiting example, the insect cells can be contacted using viral transduction that can include baculovirus transduction.

[0305] In certain embodiments, AAV particles are produced in mammalian cells (e.g., HEK293 cells) using the methods described herein. As a non-limiting example, the mammalian cells can be contacted using viral transduction that can include multi-plasmid transient transfection, such as triple plasmid transient transfection.

[0306] In certain embodiments, the AAV particle production methods described herein produce greater than 10 1 , greater than 10 2 , greater than 10 3 , greater than 10 4 , or greater than 10 5 AAV particles in a virus production cell.

[0307] In certain embodiments, the processes of the disclosure include producing viral particles in a virus production cell using a viral production system that includes at least one viral expression construct and at least one payload construct. The at least one viral expression construct and the at least one payload construct can be co-transfected (e.g., dual transfection, triple transfection) into the virus production cell. Transfection is accomplished using standard molecular biology techniques known and routinely practiced by those of skill in the art. The virus production cell provides the cellular machinery required for protein expression and other biological materials required for production of AAV particles, including Rep proteins that replicate the payload construct and Cap proteins that assemble into a capsid that encapsidates the replicated payload construct. The resulting AAV particles are extracted from the virus production cell and processed into a pharmaceutical preparation for administration.

[0308] In various embodiments, without being bound by theory, upon administration, the AAV particles disclosed herein can contact target cells and enter the cells, e.g., into endosomes. Subsequently, the AAV particles, e.g., AAV particles released from endosomes, can contact the nucleus of the target cell to deliver the payload construct. The payload construct, e.g., a recombinant viral construct, can be delivered to the nucleus of the target cell, where the payload molecule encoded by the payload construct can be expressed.

[0309] In certain embodiments, the process for producing viral particles utilizes a seed culture of virus production cells, which includes one or more baculovirus (e.g., baculovirus expression vector (BEV) or baculovirus infected insect cells (BIIC) that have been transfected with a viral expression construct and a payload construct carrier). In certain embodiments, the seed culture is harvested, divided into aliquots and frozen, and can be used at a later time point to initiate infection of a production cell naive population.

[0310] In some embodiments, large-scale production of AAV particles utilizes a bioreactor. Without being bound by theory, use of a bioreactor can allow for precise measurement and / or control of variables that support the growth and viability of virus production cells, such as mass, temperature, mixing conditions (impeller RPM or wave agitation), C02concentration, 02concentration, gas sparging rate and volume, gas overlay rate and volume, pH, viable cell density (VCD), cell viability, cell diameter, and / or optical density (OD). In certain embodiments, a bioreactor is used for batch production, in which the entire culture is harvested at a time point determined empirically and AAV particles are purified. In some embodiments, a bioreactor is used for continuous production, in which a portion of the culture is harvested at a time point determined empirically for purification of AAV particles, and the remaining culture in the bioreactor is replenished with additional growth media components.

[0311] In various embodiments, AAV viral particles can be extracted from virus production cells in a process that includes cell lysis, clarification, sterilization, and purification. Cell lysis includes any process that disrupts the structure of the virus production cells, thereby releasing AAV particles. In certain embodiments, cell lysis can include thermal shock, chemical, or mechanical lysis methods. Clarification can include rough purification of the mixture of lysed cells, media components, and AAV particles. In certain embodiments, clarification includes centrifugation and / or filtration, including but not limited to depth end, tangential flow, and / or hollow fiber filtration.

[0312] In various embodiments, the end result of virus production is a collection of purified AAV particles comprising two components: (1) a payload construct (e.g., a recombinant AAV vector genome construct), and (2) a viral capsid.

[0313] In certain embodiments, the virus production system or method of the present disclosure comprises the steps of using virus production cells (VPCs) and plasmid constructs to produce baculovirus infected insect cells (BIICs). Virus production cells (VPCs) from a cell bank (CB) are thawed and expanded to a target working volume and VPC concentration. The resulting VPC pool is split into a Rep / Cap VPC pool and a payload VPC pool. One or more Rep / Cap plasmid constructs (viral expression constructs) are processed into Rep / Cap bacmid (Bacmid) polynucleotides and transfected into the Rep / Cap VPC pool. One or more payload plasmid constructs (payload constructs) are processed into payload bacmid polynucleotides and transfected into the payload VPC pool. Both VPC pools are incubated to produce P1 Rep / Cap baculovirus expression vectors (BEVs) and P1 payload BEVs. Both BEV pools are expanded into a plaque (Plaque) collection, with a single plaque selected for clonal plaque (CP) purification (also known as single plaque expansion). The method can comprise a single CP purification step or can comprise multiple CP purification steps, either consecutively or separated by other processing steps. The one or more CP purification steps provide a CP Rep / Cap BEV pool and a CP payload BEV pool. Both BEV pools can then be stored and used for future production steps, or they can then be transfected into VPCs to produce a Rep / Cap BIIC pool and a payload BIIC pool.

[0314] In certain embodiments, the virus production system or process of the present disclosure comprises the steps of using virus production cells (VPCs) and baculovirus infected insect cells (BIICs) to produce AAV particles. Virus production cells (VPCs) from a cell bank (CB) are thawed and expanded to a target working volume and VPC concentration. The working volume of virus production cells is seeded into a production bioreactor and can be further expanded to a 200 to 2000 L working volume with a target VPC concentration for BIIC infection. The working volume of VPCs in the production bioreactor is then co-infected with Rep / Cap BIICs and payload BIICs at a target VPC:BIIC ratio and a target BIIC:BIIC ratio. VCD infection can also utilize BEVs. The co-infected VPCs are incubated and expanded in the production bioreactor to produce a batch harvest of AAV particles and VPCs. Viral expression construct

[0315] In various embodiments, the virus production system of the present disclosure includes one or more viral expression constructs that can be transfected / transduced into a virus production cell. In certain embodiments, the viral expression construct or payload construct of the present disclosure can be a bacmid, also known as a baculovirus plasmid or recombinant baculovirus genome. In certain embodiments, the viral expression includes a ...

Claims

1. An isolated nucleic acid comprising a nucleotide sequence encoding a β-glucocerebrosidase 1 (GBA1) protein and being at least 93% identical (e.g., at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the nucleotide sequence of SEQ ID NO:2002.

2. The isolated nucleic acid of claim 1, wherein the nucleotide sequence encoding the GBA1 protein comprises a nucleotide sequence that is at least 95% identical (e.g., at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to SEQ ID NO:2002.

3. The isolated nucleic acid as claimed in claim 1 or claim 2, wherein the nucleotide sequence encoding the GBA1 protein comprises SEQ ID NO:2002.

4. The isolated nucleic acid according to any one of claims 1 to 3, further comprising a signal sequence comprising a nucleotide sequence that is at least 90% identical (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to SEQ ID:2005.

5. The isolated nucleic acid as claimed in claim 4, wherein the signal sequence comprises the nucleotide sequence of SEQ ID NO:2005.

6. An isolated nucleic acid comprising a nucleotide sequence encoding a β-glucocerebrosidase 1 (GBA1) protein and being at least 94% identical (e.g., at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the nucleotide sequence of SEQ ID NO:2001.

7. The isolated nucleic acid of claim 6, wherein the nucleotide sequence encoding the GBA1 protein comprises the nucleotide sequence of SEQ ID NO:2001.

8. A recombinant viral genome comprising a nucleotide sequence encoding a β-glucocerebrosidase 1 (GBA1) protein, wherein the recombinant viral genome further comprises a miRNA (miR) binding site regulating the expression of the encoded GBA1 protein in cells or tissues of the DRG, liver, hematopoietic lineage, or combinations thereof; wherein the recombinant viral genome comprises a nucleotide sequence encoding GBA1 that is at least 93% identical (e.g., at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the nucleotide sequence of SEQ ID NO:2002.

9. The recombinant viral genome of claim 8, wherein the nucleotide sequence encoding the GBA1 protein comprises a nucleotide sequence that is at least 95% identical (e.g., at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the nucleotide sequence of SEQ ID NO:2002.

10. The recombinant viral genome of claim 8 or claim 9, wherein the nucleotide sequence encoding the GBA1 protein comprises or consists of the nucleotide sequence of SEQ ID NO:2002.

11. The recombinant viral genome of any one of claims 8 to 10, further comprising a promoter operatively linked to a nucleic acid containing the nucleotide sequence encoding the GBA protein, wherein optionally, the promoter comprises a nucleotide sequence that is at least 90% identical (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the nucleotide sequence of SEQ ID NO: 1834, wherein further optionally, the promoter comprises or is composed of the nucleotide sequence of SEQ ID NO: 1834.

12. The recombinant viral genome according to any one of claims 8 to 11, further comprising an enhancer.

13. The recombinant viral genome of claim 12, wherein the enhancer comprises a CMVie enhancer; wherein optionally, the CMVie enhancer comprises a nucleotide sequence that is at least 90% identical (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the nucleotide sequence of SEQ ID NO:1831; wherein further optionally, the CMVie enhancer comprises or is composed of the nucleotide sequence of SEQ ID NO:1831.

14. The recombinant viral genome of any one of claims 8 to 13, further comprising an intron sequence; wherein optionally, the intron sequence comprises a nucleotide sequence that is at least 90% identical (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the nucleotide sequence of SEQ ID NO: 1842; wherein further optionally, the intron sequence comprises or is composed of the nucleotide sequence of SEQ ID NO: 1842.

15. The recombinant viral genome of any one of claims 8 to 14, further comprising a polyadenylated (polyA) sequence; wherein optionally, the polyA sequence comprises a nucleotide sequence that is at least 90% identical (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the nucleotide sequence of SEQ ID NO:1846; wherein further optionally, the polyA sequence comprises or is composed of the nucleotide sequence of SEQ ID NO:1846.

16. The recombinant viral genome of any one of claims 8 to 15, further comprising an ITR sequence; wherein optionally, the ITR sequence comprises a nucleotide sequence that is at least 90% identical (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the nucleotide sequence of SEQ ID NO:1829 or SEQ ID NO:1830; wherein, more preferably, the ITR sequence comprises or is composed of the nucleotide sequence of SEQ ID NO:1829 or SEQ ID NO:1830.

17. The recombinant viral genome of claim 16, comprising a 5' ITR sequence and a 3' ITR sequence, wherein the 5' ITR sequence comprises or is composed of the nucleotide sequence of SEQ ID NO:1829, and the 3' ITR comprises or is composed of the nucleotide sequence of SEQ ID NO:1830.

18. The recombinant viral genome of any one of claims 8 to 17, further comprising one or more miR183 binding sites; wherein optionally, the viral genome comprises four miR183 binding sites; wherein further optionally, each of the four miR183 binding sites comprises or consists of the following: The nucleotide sequence of SEQ ID NO:1847 or the nucleotide sequence having up to 3 modifications relative to SEQ ID NO:1847.

19. The recombinant viral genome of any one of claims 8 to 17, further comprising a miR183 binding site series comprising a nucleotide sequence that is at least 95% identical (e.g., at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the nucleotide sequence of SEQ ID NO: 1849; wherein optionally, the miR183 binding site series comprises or consists of the nucleotide sequence of SEQ ID NO: 1849.

20. The recombinant viral genome of any one of claims 8 to 17, wherein the viral genome does not contain a miR183 binding site.

21. A recombinant viral genome, comprising, in 5' to 3' order: (i) 5' gland-associated (AAV) ITR, which comprises or is composed of the following: The nucleotide sequence of SEQ ID NO:1829 or a nucleotide sequence that is at least 95% identical (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical) to the nucleotide sequence of SEQ ID NO:1829; (ii) CMVie enhancer, comprising or consisting of the following: the nucleotide sequence of SEQ ID NO:1831 or a nucleotide sequence that is at least 95% identical (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical) to the nucleotide sequence of SEQ ID NO:1831; (iii) A CB promoter comprising or consisting of the following: a nucleotide sequence of SEQ ID NO:1834 or a nucleotide sequence that is at least 95% identical (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical) to the nucleotide sequence of SEQ ID NO:1834; (iv) Introns comprising or consisting of the following: a nucleotide sequence of SEQ ID NO:1842 or a nucleotide sequence that is at least 95% identical (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical) to the nucleotide sequence of SEQ ID NO:1842; (v) A nucleotide sequence encoding a signal sequence, wherein the nucleotide sequence comprises or consists of the following: the nucleotide sequence of SEQ ID NO:2005 or a nucleotide sequence that is at least 95% identical (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical) to the nucleotide sequence of SEQ ID NO:2005; (vi) A nucleotide sequence encoding the GBA1 protein, wherein the nucleotide sequence encoding the GBA1 protein comprises or consists of the following: the nucleotide sequence of SEQ ID NO:2002 or a nucleotide sequence that is at least 93% identical (e.g., at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical) to the nucleotide sequence of SEQ ID NO:2002; (vii) The polyA signal region, comprising or consisting of the following: the nucleotide sequence of SEQ ID NO:1846 or a nucleotide sequence that is at least 95% identical (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical) to the nucleotide sequence of SEQ ID NO:1846; and (viii) 3'AAVITR, which comprises or consists of the following: the nucleotide sequence of SEQ ID NO:1830 or a nucleotide sequence that is at least 95% identical (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical) to the nucleotide sequence of SEQ ID NO:1830.

22. The recombinant viral genome of claim 21, wherein: (i) The 5'AAVITR contains or is composed of the nucleotide sequence of SEQ ID NO:1829; (ii) The CMVie enhancer comprises or is composed of the nucleotide sequence of SEQ ID NO:1831; (iii) The CB promoter or a functional variant thereof comprises or is composed of the nucleotide sequence of SEQ ID NO:1834; (iv) The intron comprises or is composed of the nucleotide sequence of SEQ ID NO:1842; (v) The nucleotide sequence encoding the signal sequence comprises or consists of the nucleotide sequence of SEQ ID NO:2005; (vi) The nucleotide sequence encoding the GBA1 protein comprises or consists of the nucleotide sequence of SEQ ID NO:2002; (vii) The polyA signal region contains or is composed of the nucleotide sequence of SEQ ID NO:1846; and (viii) The 3'AAV ITR contains or is composed of the nucleotide sequence of SEQ ID NO:1830.

23. The recombinant viral genome of claim 22, comprising the nucleotide sequence of SEQ ID NO:2006 or a nucleotide sequence that is at least 97% identical (e.g., at least 97%, at least 98%, or at least 99% identical) to the nucleotide sequence of SEQ ID NO:2006.

24. The recombinant viral genome of claim 22 or claim 23, comprising the nucleotide sequence of SEQ ID NO:2006.

25. The recombinant viral genome according to any one of claims 22 to 24, comprising the nucleotide sequence of SEQ ID NO:2006.

26. A recombinant viral genome, comprising, in 5' to 3' order: (i) 5' gland-associated (AAV) ITR, which comprises or is composed of the following: The nucleotide sequence of SEQ ID NO:1829 or a nucleotide sequence that is at least 95% identical (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical) to the nucleotide sequence of SEQ ID NO:1829; (ii) CMVie enhancer, comprising or consisting of the following: the nucleotide sequence of SEQ ID NO:1831 or a nucleotide sequence that is at least 95% identical (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical) to the nucleotide sequence of SEQ ID NO:1831; (iii) A CB promoter comprising or consisting of the following: a nucleotide sequence of SEQ ID NO:1834 or a nucleotide sequence that is at least 95% identical (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical) to the nucleotide sequence of SEQ ID NO:1834; (iv) Introns comprising or consisting of the following: a nucleotide sequence of SEQ ID NO:1842 or a nucleotide sequence that is at least 95% identical (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical) to the nucleotide sequence of SEQ ID NO:1842; (v) A nucleotide sequence encoding a signal sequence, optionally wherein the nucleotide sequence encoding the signal sequence comprises or consists of the following: the nucleotide sequence of SEQ ID NO:2005 or a nucleotide sequence that is at least 95% identical (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical) to the nucleotide sequence of SEQ ID NO:2005; (vi) A nucleotide sequence encoding the GBA1 protein, comprising or consisting of the following: the nucleotide sequence of SEQ ID NO:2002 or a nucleotide sequence that is at least 93% identical (e.g., at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical) to the nucleotide sequence of SEQ ID NO:2002; (vii) miR183 binding site series, comprising or consisting of the following: nucleotide sequence of SEQ ID NO:1849 or nucleotide sequence that is at least 90% identical (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical) to nucleotide sequence of SEQ ID NO:1849; (viii) A polyA signal region comprising or consisting of the following: a nucleotide sequence of SEQ ID NO:1846 or a nucleotide sequence that is at least 95% identical (e.g., at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical) to the nucleotide sequence of SEQ ID NO:1846; and (ix)3'AAV ITR, which comprises or consists of the following: the nucleotide sequence of SEQ ID NO:1830 or a nucleotide sequence that is at least 95% identical (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical) to the nucleotide sequence of SEQ ID NO:1830.

27. The recombinant viral genome of claim 26, wherein: (i) The 5'AAVITR contains or is composed of the nucleotide sequence of SEQ ID NO:1829; (ii) The CMVie enhancer comprises or is composed of the nucleotide sequence of SEQ ID NO:1831; (iii) The CB promoter or a functional variant thereof comprises or is composed of the nucleotide sequence of SEQ ID NO:1834; (iv) The intron comprises or is composed of the nucleotide sequence of SEQ ID NO:1842; (v) The nucleotide sequence encoding the signal sequence comprises the nucleotide sequence of SEQ ID NO:2005; (vi) The nucleotide sequence encoding the GBA1 protein comprises or consists of the nucleotide sequence of SEQ ID NO:2002; (vii) The miR183 binding site series comprises or consists of the nucleotide sequence of SEQ ID NO:1849; (viii) The polyA signal region comprises or is composed of the nucleotide sequence of SEQ ID NO:1846; and (ix) The 3'AAVITR contains or is composed of the nucleotide sequence of SEQ ID NO:1830.

28. The recombinant viral genome of claim 27, comprising the nucleotide sequence of SEQ ID NO:2007 or a nucleotide sequence that is at least 97% identical (e.g., at least 97%, at least 98%, or at least 99% identical) to the nucleotide sequence of SEQ ID NO:2007.

29. The recombinant viral genome of claim 27 or claim 28, comprising the nucleotide sequence of SEQ ID NO:2007.

30. The recombinant viral genome of claim 27 or claim 28, comprising the nucleotide sequence of SEQ ID NO:2007.

31. The recombinant viral genome of any one of claims 8 to 30, further comprising nucleic acid encoding a capsid protein, wherein the capsid protein comprises a VP1 polypeptide, a VP2 polypeptide, and / or a VP3 polypeptide.

32. The recombinant viral genome of claim 31, wherein the VP1 polypeptide, the VP2 polypeptide, and / or the VP3 polypeptide are encoded by at least one Cap gene.

33. The recombinant viral genome according to any one of claims 8 to 32, further comprising nucleic acid encoding a Rep protein, wherein the Rep protein comprises Rep78 protein, Rep68 protein, Rep52 protein and / or Rep40 protein.

34. The recombinant viral genome of claim 33, wherein the Rep78 protein, the Rep68 protein, the Rep52 protein and / or the Rep40 protein are encoded by at least one Rep gene.

35. An AAV particle comprising: (i) capsid protein; and (ii) The recombinant viral genome as described in any one of claims 8 to 30.

36. The AAV particle of claim 35, wherein the capsid protein comprises VOY101, VOY201, AAVPHP.N (PHP.N), AAVPHP.B (PHP.B), AAVPHP.A (PHP.A), PHP.B2, PHP.B3, G2B4, G2B5, AAV5, AAV9, AAVrh10 capsid protein or functional variants thereof.

37. The AAV particle of claim 35 or claim 36, wherein the capsid protein comprises a variant of the AAV5 capsid protein.

38. The AAV particle of claim 35 or claim 36, wherein the capsid protein comprises a variant of the AAV9 capsid protein.

39. A vector comprising the isolated nucleic acid as claimed in any one of claims 1 to 7 or the recombinant viral genome as claimed in any one of embodiments 8 to 34.

40. A cell comprising the isolated nucleic acid as claimed in any one of claims 1 to 7, the recombinant viral genome as claimed in any one of claims 8 to 34, the viral particles as claimed in any one of claims 35 to 38, or the vector as claimed in claim 39, wherein optionally, the cell is a mammalian cell (e.g., HEK293 cell), an insect cell (e.g., Sf9 cell), or a bacterial cell.

41. A nucleic acid comprising a recombinant viral genome as described in any one of embodiments 8 to 34, and a backbone region suitable for replication of the viral genome in a cell, such as a bacterial cell (e.g., wherein the backbone region comprises one or both of a bacterial origin of replication and an optional marker).

42. A method for manufacturing recombinant AAV particles, the method comprising: (i) Providing a host cell comprising the recombinant viral genome as described in any one of claims 8 to 34; and (ii) The host cells are cultured under conditions suitable for encapsulating the viral genome in capsid proteins; This produces separated AAV particles; Optionally, the capsid protein is VOY101 capsid protein.

43. The method of claim 42, further comprising, prior to step (i), introducing a first nucleic acid molecule containing the viral genome into the host cell.

44. The method of claim 43, wherein the host cell comprises a second nucleic acid molecule encoding a capsid protein, wherein optionally, the capsid protein is the VOY101 capsid protein.

45. The method of claim 43, further comprising introducing the second nucleic acid into the cell.

46. ​​The method of claim 44 or claim 45, wherein the second nucleic acid molecule is introduced into the host cell before, simultaneously with, or after the first nucleic acid molecule.

47. The method of any one of claims 42 to 46, wherein the host cell comprises mammalian cells (e.g., HEK293 cells), insect cells (e.g., Sf9 cells), or bacterial cells.

48. A pharmaceutical composition comprising AAV particles as described in any one of claims 35 to 38 and a pharmaceutically acceptable excipient.

49. A method of delivering a nucleic acid sequence encoding a GBA1 protein to a subject, comprising administering an effective amount of the pharmaceutical composition of claim 48, AAV particles of any one of claims 35 to 38, isolated nucleic acid of any one of claims 1 to 7, or recombinant viral genome of any one of claims 8 to 34, thereby delivering the nucleic acid encoding the GBA1 protein to the subject.

50. The method of claim 49, wherein the subject has a disease associated with GBA1 expression, has been diagnosed with a disease associated with GBA1 expression, or is at risk of having a disease associated with GBA1 expression, wherein the GBA1 expression is, for example, abnormal or reduced GBA1 expression, such as the expression of the GBA1 gene, GBA1 mRNA, and / or GBA1 protein.

51. The method of claim 49 or claim 50, wherein the subject suffers from neurodegenerative disease or neuromuscular disease, has been diagnosed with neurodegenerative disease or neuromuscular disease, or is at risk of developing neurodegenerative disease or neuromuscular disease.

52. A method of treating a subject who has or has been diagnosed with a disease associated with GBA1 expression, comprising administering an effective amount of the pharmaceutical composition of claim 48, AAV particles of any one of claims 35 to 38, isolated nucleic acid of any one of claims 1 to 7, or recombinant viral genome of any one of claims 8 to 34, thereby treating the subject with the disease associated with GBA1 expression.

53. A method of treating a subject suffering from or diagnosed with a neurodegenerative disease or neuromuscular disease, comprising administering an effective amount of the pharmaceutical composition of claim 48, AAV particles of any one of claims 35 to 38, isolated nucleic acid of any one of claims 1 to 7, or recombinant viral genome of any one of claims 8 to 34, thereby treating the subject with the neurodegenerative disease or neuromuscular disease.

54. The method of any one of claims 49 to 53, wherein the disease associated with GBA1 expression or the neurodegenerative or neuromuscular disease is Parkinson's disease (PD).

55. The method of any one of claims 49 to 53, wherein the disease associated with GBA1 expression or the neurodegenerative or neuromuscular disease is Gaucher disease (GD).

56. The method of claim 55, wherein the GD is a type 1 GD (GD1) or a type 3 GD (GD3).

57. The method of any one of claims 49 to 53, wherein the disease associated with GBA1 expression or the neurodegenerative or neuromuscular disorder is Lewy body dementia (DLB).

58. A method of treating a subject who has or has been diagnosed with Parkinson's disease (PD), comprising administering an effective amount of the pharmaceutical composition of claim 48, AAV particles of any one of claims 35 to 38, isolated nucleic acid of any one of claims 1 to 7, or recombinant viral genome of any one of claims 8 to 34, thereby treating the subject's PD.

59. A method of treating a subject who has or has been diagnosed with Gaucher disease (GD), comprising administering an effective amount of the pharmaceutical composition of claim 48, AAV particles of any one of claims 35 to 38, isolated nucleic acid of any one of claims 1 to 7, or recombinant viral genome of any one of claims 8 to 34, thereby treating the subject with GD.

60. The method of claim 59, wherein the GD is GD1 or GD3.

61. A method of treating a subject suffering from or diagnosed with Lewy body dementia (DLB), comprising administering an effective amount of the pharmaceutical composition of claim 48, AAV particles of any one of claims 35 to 38, isolated nucleic acid of any one of claims 1 to 7, or recombinant viral genome of any one of claims 8 to 34, thereby treating the subject's DLB.

62. The method of any one of claims 49 to 61, wherein the subject has a reduced GCase activity level compared to a reference level; wherein optionally, the GCase activity level is measured by 4-MUG analysis or SensoLyte blue glucose cerebroside lipase analysis.

63. The method of claim 62, wherein the reference level comprises the GCase activity level of a healthy subject who does not suffer from diseases associated with GBA1 expression, neuromuscular disorders, and / or neurodegenerative diseases.

64. The method of any one of claims 49 to 63, wherein the treatment comprises preventing the progression of the disease in the subject.

65. The method of any one of claims 49 to 64, wherein the treatment results in improvement of at least one symptom of the subject’s GBA1 expression-related disease, the neurodegenerative condition, and / or the neuromuscular condition.

66. The method of claim 65, wherein the symptoms of the disease associated with GBA1 expression, the neurodegenerative condition, and / or the neuromuscular condition include reduced GCase activity, accumulation of glucocerebrosides and other glycolipids in, for example, immune cells (e.g., macrophages), accumulation of synuclein aggregates (e.g., Lewy bodies), developmental delay, progressive encephalopathy, progressive dementia, ataxia, myoclonus, oculomotor dysfunction, bulbar palsy, general weakness, tremor, depression, visual hallucinations, cognitive decline, or a combination thereof.

67. The method of any one of claims 49 to 66, wherein the subject is a human subject.

68. The method of any one of claims 49 to 67, wherein the subject has one or more mutations in the GBA1 gene, GBA1 mRNA, and / or GBA1 protein.

69. The method of any one of claims 49 to 68, wherein the pharmaceutical composition, the AAV particles, the isolated nucleic acid, or the recombinant viral genome is administered to the subject via intravenous, intracerebral, intrathalamic (ITH), intramuscular, intrathecal, intraventricular, intraparenchymal, focused ultrasound (FUS) such as FUS-MB or MRI-guided FUS-MB, or intracerebellomedullary cistern injection (ICM).

70. The method of any one of claims 49 to 69, wherein the pharmaceutical composition, the AAV particles, the isolated nucleic acid, or the recombinant viral genome is administered to the subject intravenously.

71. The method of any one of claims 49 to 70, wherein the pharmaceutical composition, the AAV particles, the isolated nucleic acid, or the recombinant viral genome is delivered to cells, tissues, or regions of the CNS, such as regions of the brain or spinal cord, such as the parenchyma, cortex, substantia nigra, caudate nucleus, cerebellum, striatum, corpus callosum, cerebellum, brainstem, caudate nucleus-putamen, thalamus, superior colliculus, spinal cord, or combinations thereof.

72. The method of any one of claims 49 to 71, further comprising evaluating, for example, measuring the level of GBA1 expression in the subject, such as the level of GBA1 gene, GBA1 mRNA and / or GBA1 protein expression in the subject's cells, tissues or body fluids, optionally wherein the level of said GBA1 protein is measured by an analysis described herein, such as ELISA, Western blot or immunohistochemical analysis.

73. The method of claim 72, wherein the measurement of the GBA1 expression level is performed before, during, or after treatment with the AAV particles.

74. The method of claim 72 or 73, wherein the cell or tissue is a cell or tissue of the central nervous system (e.g., parenchyma).

75. The method of any one of claims 49 to 74, wherein, relative to a reference level, such as a subject who has not yet received treatment, such as a subject who has not yet been administered the AAV particles, the administration results in an increase in the expression level of the GBA1 protein in the subject's cells or tissues.

76. The method of any one of claims 49 to 75, further comprising evaluating, for example, measuring the level of GCase activity in the subject, such as in the subject's cells or tissues, optionally wherein the level of GCase activity is measured by 4-MUG analysis or SensoLyte blue glucose cerebroside lipase analysis.

77. The method of any one of claims 49 to 76, wherein the application causes at least one, two, or all of the following to increase: (i) the level of GCase activity in the cells, tissues (e.g., cells or tissues of the CNS, such as the cortex, striatum, thalamus, cerebellum and / or brainstem) and / or body fluids (e.g., CSF and / or serum) of the subject, optionally wherein the level of GCase activity is increased by at least 2, 3, 4 or 5 times compared to a reference level, such as a subject who has not received treatment, such as a subject who has not been administered the AAV particles; (ii) the viral genome (VG) level in each cell of the subject's CNS tissues (e.g., cortex, striatum, thalamus, cerebellum, brainstem, and / or spinal cord), optionally wherein the VG level is increased by more than 50 VG per cell compared to the surrounding tissue, wherein the VG level in each cell is at least 4 to 10 times lower than the level in the CNS tissue, as measured, for example, by the analysis described herein; and / or (iii) The level of GBA1 mRNA expression in cells or tissues (e.g., cells or tissues of the CNS, such as the cortex, thalamus, and / or brainstem), optionally wherein the level of GBA1 mRNA is increased by at least 100 to 1300 times compared with a reference level from a subject who has not received the treatment.

78. The method of any one of claims 49 to 77, further comprising administering additional therapeutic agents and / or therapies suitable for treating or preventing the diseases associated with GBA1 expression, the neurodegenerative conditions, and / or the neuromuscular conditions; wherein optionally, the additional therapeutic agents and / or therapies comprise enzyme replacement therapy (ERT) (e.g., imiglucerase, vilazinase α, or talidase α); substrate reduction therapy (SRT) (e.g., ilucostera or miglustat), blood transfusion, levodopa, carbidopa, safenamide, dopamine agonists (e.g., pramipexole, rotigotine, or ropinilol), anticholinergic drugs (e.g., benzalkonium chloride or trihexyphenidyl), cholinesterase inhibitors (e.g., retinomin, donepezil, or galantamine), N-methyl-d-aspartate (NMDA) receptor antagonists (e.g., memantine), or combinations thereof.

79. The pharmaceutical composition of claim 48, the AAV particles of any one of claims 35 to 38, the isolated nucleic acid of any one of claims 1 to 7, or the recombinant viral genome of any one of claims 8 to 34, for use in the manufacture of a pharmaceutical product.

80. The pharmaceutical composition of claim 48, the AAV particles of any one of claims 35 to 38, the isolated nucleic acid of any one of claims 1 to 7, or the recombinant viral genome of any one of claims 8 to 34, for the treatment of diseases associated with GBA1 expression, neuromuscular disorders, and / or neurodegenerative diseases; wherein the diseases associated with GBA1 expression, neuromuscular disorders, and / or neurodegenerative diseases are PD.

81. Use of an effective amount of the pharmaceutical composition of claim 48, AAV particles of any one of claims 35 to 38, isolated nucleic acid of any one of claims 1 to 7, or recombinant viral genome of any one of claims 8 to 34, for the manufacture of a medicament for treating diseases, neuromuscular disorders, and / or neurodegenerative diseases associated with GBA1 expression; wherein the diseases, neuromuscular disorders, and / or neurodegenerative diseases associated with GBA1 expression are PD.

82. The pharmaceutical composition of claim 48, the AAV particles of any one of claims 35 to 38, the isolated nucleic acid of any one of claims 1 to 7, or the recombinant viral genome of any one of claims 8 to 34, for the treatment of diseases, neuromuscular disorders, and / or neurodegenerative diseases associated with GBA1 expression; wherein the diseases, neuromuscular disorders, and / or neurodegenerative diseases associated with GBA1 expression are GD.

83. The pharmaceutical composition, AAV particles, isolated nucleic acid or recombinant viral genome used in claim 82, wherein the GD is GD 1.

84. The pharmaceutical composition, AAV particles, isolated nucleic acid or recombinant viral genome used in claim 82, wherein the GD is GD3.

85. Use of an effective amount of the pharmaceutical composition of claim 48, AAV particles of any one of claims 35 to 38, isolated nucleic acid of any one of claims 1 to 7, or recombinant viral genome of any one of claims 8 to 34, for the manufacture of a medicament for treating diseases, neuromuscular disorders, and / or neurodegenerative diseases associated with GBA1 expression; wherein the diseases, neuromuscular disorders, and / or neurodegenerative diseases associated with GBA1 expression are GD.

86. The use as described in claim 85, wherein the GD is GD1.

87. The use as described in claim 85, wherein the GD is GD3.

Images