Bacillus amyloliquefaciens and application thereof in cigar tobacco leaves

By using Bacillus amyloliquefaciens HY6 for fermentation in cigar tobacco leaves, the problem of excessive protein and starch content in cigar tobacco leaves was solved, resulting in effective quality improvement, reducing the grassy and irritating smell of the tobacco leaves, and enhancing the aroma.

CN120905053APending Publication Date: 2025-11-07CROP RES INST GUANGDONG ACAD OF AGRI SCI +1
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510515915.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-23
Publication Date
2025-11-07

AI Technical Summary

Technical Problem

In existing technologies, the protein and starch content in cigar tobacco leaves is too high, which affects the aroma quality and safety of the tobacco leaves, and there is a lack of effective means of microbial improvement.

Method used

Bacillus amyloliquefaciens HY6 was used to ferment and culture cigar tobacco leaves by spraying a bacterial suspension onto the surface of the leaves, thereby degrading proteins and starches and improving the quality of the tobacco leaves.

Benefits of technology

It effectively degrades proteins and starches in cigar tobacco leaves, reduces grassy and irritating odors, significantly improves aroma, and enhances tobacco quality.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120905053A_ABST
    Figure CN120905053A_ABST
Patent Text Reader

Abstract

The invention relates to bacillus amyloliquefaciens and application thereof in cigar tobacco leaves, and belongs to the technical field of agricultural microorganisms. The bacillus amyloliquefaciens strain HY6 has the function of degrading protein and starch at the same time and can effectively degrade protein and starch in cigar tobacco leaves and accelerate the fermentation process, green offensive odor and irritation of the tobacco leaves treated by adding the strain HY6 are obviously relieved, the fragrance is improved, and the bacillus amyloliquefaciens strain HY6 has important significance in improving the quality of tobacco products and has broad application prospects. Good popularization and application values are realized.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of agricultural microorganisms, in particular to a Bacillus amyloliquefaciens and its application in cigar tobacco leaves. BACKGROUND

[0002] China has a wide tobacco planting area, and it is an important economic crop. In recent years, due to factors such as variety degeneration, excessive fertilization and climate variability, some tobacco leaves have certain defects in quality, such as high content of protein, starch and nitrite in tobacco leaves, which seriously affects the aroma quality and safety of tobacco leaves. In order to improve the quality of tobacco leaves, tobacco industry enterprises often use measures such as threshing, re-drying, industrial fermentation and aging. Among them, fermentation and aging are important means to improve the quality of tobacco leaves. With the in-depth study of the mechanism of tobacco fermentation and aging, researchers have found that the metabolic activity of original or environmental microorganisms in tobacco plays an important role in improving the quality of tobacco. Therefore, the use of functional microbial flora for targeted improvement of tobacco quality has attracted increasing attention from the tobacco industry.

[0003] Bacillus amyloliquefaciens is an important functional strain in the genus Bacillus, which has the characteristics of wide-spectrum antibacterial, strong stress resistance, high biological safety and promoting plant growth, and is a hot spot for current research and development. In the tobacco industry, research and application of Bacillus amyloliquefaciens mainly focuses on disease control. For example, in the patent CN119410541A, the inventors screened Bacillus amyloliquefaciens W1, which has ideal control effect on tobacco mildew caused by Aspergillus tubigensis, Talaromyces trachelospermoides, Aspergillus niger and Aspergillus flavus; in the patent CN119331748A, Bacillus amyloliquefaciens JQ-4 has good antagonistic effect on Alternaria alternata, Phytophthora capsici, Sclerotium rolfsii and Pseudomonas syringae.

[0004] At present, the application of Bacillus amyloliquefaciens in improving the quality of tobacco leaves is relatively lacking. The applicant screened a Bacillus amyloliquefaciens HY6 in cigar tobacco leaves, which has the functions of degrading protein and starch, and has important significance for improving the quality of tobacco products, and has good popularization and application value. SUMMARY

[0005] Therefore, the present application aims to provide a Bacillus amyloliquefaciens HY6 with the functions of degrading protein and starch and its application in cigar tobacco leaves.

[0006] The present application provides a bacillus amyloliquefaciens HY6, which has been preserved in Guangdong Microbial Culture Collection Center on December 3, 2024, with a preservation number of GDMCC NO.65580, is screened from cigar tobacco leaves, and can simultaneously degrade protein and starch.

[0007] A second object of the present application is to provide the use of the above-mentioned bacillus amyloliquefaciens HY6 in the preparation of tobacco products.

[0008] In an embodiment of the present application, the tobacco product is cigar tobacco leaves.

[0009] In an embodiment of the present application, the preparation method of the cigar tobacco leaves is to spray the bacterial suspension of the bacillus amyloliquefaciens HY6 on the surface of the cigar tobacco leaves to be fermented and then perform fermentation culture.

[0010] In an embodiment of the present application, the inoculation amount of the bacterial suspension of the bacillus amyloliquefaciens HY6 is 1x10 6 CFU / g.

[0011] In an embodiment of the present application, the fermentation culture is performed at a temperature of 37 DEG C and a humidity of 80% for 15 days.

[0012] In an embodiment of the present application, the preparation method of the bacterial suspension of the bacillus amyloliquefaciens HY6 is to inoculate the preserved strain HY6 into fresh beef extract peptone liquid medium for culture, then collect the bacterial bodies from the cultured bacterial liquid, resuspend the collected bacterial bodies with an equal volume of sterile normal saline to obtain the bacterial suspension of the strain HY6.

[0013] In an embodiment of the present application, the culture method of the strain HY6 is to culture on a shaker at 200 rpm / min and 37 DEG C until the bacterial liquid concentration OD600 is 0.6.

[0014] In an embodiment of the present application, the step of collecting the bacterial bodies is to centrifuge the cultured bacterial liquid at 4 DEG C and 4000 rpm for 10 min on a refrigerated centrifuge.

[0015] Compared with the prior art, the above-mentioned at least one technical solution adopted by the embodiments of the present application can achieve the beneficial effects at least including:

[0016] 1. effectively degrading the protein and starch content in cigar tobacco leaves, and accelerating the fermentation process.

[0017] 2. significantly reducing the green and irritating odor of cigar tobacco leaves and significantly improving the aroma.

[0018] In order to better understand and implement, the present application is described in detail below with reference to the accompanying drawings. Attached Figure Description

[0019] Figure 1 A colony photograph of Bacillus amyloliquefaciens HY6;

[0020] Figure 2 To decipher the phylogenetic tree of Bacillus amyloliquefaciens HY6. Detailed Implementation

[0021] The specific embodiments of the present invention are described below with reference to the accompanying drawings. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods; the materials and reagents used are commercially available unless otherwise specified.

[0022] The specific method for preparing the culture medium used in the embodiments of the present invention is as follows:

[0023] (1) Beef extract peptone liquid culture medium: 3g beef extract, 10g peptone, 5g sodium chloride, add distilled water to 1L, pH is natural.

[0024] (2) Beef extract peptone solid culture medium: 3g beef extract, 10g peptone, 5g sodium chloride, 18g agar powder, add distilled water to 1L, pH is natural.

[0025] (3) Casein culture medium: glucose 0.5g, sodium chloride 5g, dipotassium hydrogen phosphate 0.5g, potassium dihydrogen phosphate 0.5g, casein 10g, agar 18g, add distilled water to 1L, pH natural.

[0026] (4) Starch culture medium: 1.0g dipotassium hydrogen phosphate, 1.0g magnesium sulfate, 1.0g sodium chloride, 2.0g ammonium sulfate, 2.0g calcium carbonate, 0.001g ferrous sulfate, 0.001g manganese chloride, 0.001g zinc sulfate, 10.0g soluble starch, 18g agar, add distilled water to 1L, pH is natural.

[0027] Example 1: Isolation and purification of bacteria from tobacco leaves

[0028] Weigh 5.0g of cigar tobacco leaves and add them to an Erlenmeyer flask containing 100mL of sterile water. Incubate at 37℃ with shaking for 30min. Use a serial dilution method (10... -1 10 -2 10 -3 10 -4 10 -5 The cultures were incubated in beef extract peptone solid medium and observed every 24 hours. When single colonies grew on the beef extract peptone solid medium, each colony was picked and streaked onto fresh beef extract peptone solid medium for purification at least three times.

[0029] Example 2: Screening of protein and starch-degrading bacteria

[0030] The purified and isolated strain of Example 1 was respectively inoculated in casein medium and starch medium, and cultured at 37°C for 24h. Whether there was a hydrolysis ring around the colony was observed to screen the strain HY6 capable of degrading protein and starch. Then the screened strain HY6 was inoculated into beef extract protein peptone liquid medium, and shaken to grow to the exponential growth phase of bacteria, and then stored in 25% glycerol aqueous solution and frozen in a -80°C refrigerator for standby.

[0031] Example 3: Strain identification

[0032] (1) Colony morphological characteristics

[0033] The strain HY6 screened in Example 2 was inoculated on beef extract protein peptone solid medium and cultured for 24h, and then observed and photographed. The colony photograph results are shown in Figure 1 , the colony is milky white, nearly round, spreading, the edge is irregular, opaque, and the mycelium surface is dry and lusterless.

[0034] 2) Molecular biology identification

[0035] The strain HY6 screened in Example 2 was sent to Wuhan Tianyi Huayu Gene Technology Co., Ltd. for sequencing, and the primers were rpoB-F (5'-GGAAACCGCCGTTTACGTTC-3') and rpoB-R (5'-CCATGAGGCACACGAAGAGA-3'). The amplified strain HY6 rpoB gene CDS sequence length is 735bp, and the sequence is shown in Seq ID:NO.1. The sequence was blast compared with the rRNA / ITS database in NCBI, and the results showed that HY6 had the highest similarity with Bacillus amyloliquefaciens DSM7, which was 99.46%. Further, the MEGA software was used to construct the phylogenetic tree of HY6 using the adjacent method, and the phylogenetic tree results are shown in Figure 2 , the strain HY6 and Bacillus amyloliquefaciens DSM7 are in the same branch, and the confidence is 100%. Combined with the morphological characteristics, the strain HY6 was identified as Bacillus amyloliquefaciens. The strain has been preserved in Guangdong Microbial Culture Collection Center on December 03, 2024, and the preservation number is GDMCC NO.65580.

[0036] Seq ID:NO.1

[0037] 735bp

[0038] GTGTTAGAATTACCAAATCTCATTGAAATTCAAACCTCTTCTTATCAGTGGTTTCTTGATGAGGGTCTTAGAGAGATGTTTCAAGACATATCACCAATTGAGGATTTCACTGGTAACCTCTCTCTTGAGTTCATTGACTACAGTTTAGGAGATCCTAAGTATCCCGTTGAAGAGTCAAAAGAACGTGATGTGACTTACTCAGCTCCGCTGAGAGTGAAGGTTCGTTTAATTAACAAAGAAACTGGAGAGGTAAAAGACCAGGATGTCTTCATGGGTGATTTCCCTATTATGACAGATACCGGTACTTTTATCATCAACGGTGCAGAACGTGTTATCGTATCTCAGCTTGTTCGGTCTCCAAGTGTATATTTCAGTGGTAAAGTAGACAAAAACGGTAAAAAAGGTTTTACCGCGACTGTCATTCCAAACCGTGGCGCATGGTTAGAATACGAAACTGATGCGAAAGATGTTGTGTATGTCCGCATTGATCGCACACGTAAGTTGCCGGTTACGGTTCTTTTGCGTGCTCTCGGCTTCGGTTCCGACCAAGAGATTCTCGATCTCATTGGTGAGAACGAATATCTCCGCAATACACTGGATAAGGACAACACTGAAAACAGTGACAAAGCGCTTCTTGAAATCTATGAGCGCCTTCGTCCCGGAGAGCCGCCTACAGTAGAAAACGCAAAAAGCTTGCTGGATTCCCGTTTCTTCGATCCGAAGCGATACGATCTT

[0039] Example 4: Analysis of protease and amylase activities of strain HY6 under different conditions

[0040] The preserved strain HY6 was inoculated into fresh beef extract peptone liquid medium and cultured in a shaker at 200 rpm / min and 37°C until the bacterial liquid concentration reached OD600=0.6. Then the cultured bacterial liquid was centrifuged at 4°C and 4000 rpm for 10 min in a refrigerated centrifuge to collect the bacterial cells, which were resuspended with an equal volume of sterile normal saline to obtain a bacterial suspension of strain HY6.

[0041] (1) The bacteria suspension was inoculated into liquid beef extract peptone medium with different pH values (6.0, 6.5, 7.0 and 7.5) at an inoculation amount of 3%, and was cultured at 37°C for 12 hours. The supernatant obtained by centrifugation at 4°C and 4000 rpm for 10 minutes was the crude enzyme solution. The mixed solution was prepared according to Table 1, and the absorbance was measured at 660 nm. The standard curve of starch content was prepared with the starch content as the abscissa and the absorbance as the ordinate. The mixed solution was prepared according to tube No. 6, and the absorbance was measured. According to the standard curve, the starch degradation rate under different pH conditions was calculated. 1 mL of the crude enzyme solution was added to 4 mL of a diluent containing 1% casein, and was incubated at 37°C for 1 hour. The protein content was determined by using a BCA protein concentration determination kit (Bi Yun Tian).

[0042]

[0043] Table 1

[0044] (2) The bacteria suspension was inoculated into beef extract peptone medium with natural pH value at an inoculation amount of 3%, and was cultured at 16°C, 28°C, 37°C and 40°C for 12 hours. The supernatant obtained by centrifugation at 4°C and 4000 rpm for 10 minutes was the crude enzyme solution. The amylase and protease activities of HY6 at different temperatures were determined according to the method described in (1). The results of the starch degradation rate and the protein degradation rate of strain HY6 under different pH and temperature conditions are shown in Table 2.

[0045] As can be seen from Table 2, under the conditions of 37°C and pH 6.0-7.5, the starch degradation rate of strain HY6 was the highest at pH 6.5, which was 40.29%, and the protein degradation rate was the highest at pH 7.5, which was 83.71%. Under the natural pH value and 28°C culture conditions, the starch and protein degradation rates of strain HY6 were the highest, which were 43.81% and 81.03%, respectively.

[0046]

[0047] Table 2 Starch degradation rate and protein degradation rate of strain HY6 under different pH and temperature conditions

[0048] Example 5: Application of strain HY6 in improving the quality of modified cigar tobacco leaves

[0049] The HY6 bacteria suspension obtained in Example 4 was uniformly sprayed on the surface of the test cigar tobacco leaves, and the inoculation amount was 1×10 6CFU / g, and the control was treated with an equal amount of sterile water. The moisture content of the cigar leaves was balanced to about 40%, and then the cigar leaves were placed in a constant temperature and humidity box at 37°C and 80% humidity for fermentation for 15 days. After fermentation, part of the tobacco leaves were dried, ground and sieved through a 40-mesh sieve. The protein content of the tobacco leaves was determined by the BCA-TCA method (Zhai Yuchen et al., 2017), and the starch content of the tobacco leaves was determined by the iodine colorimetric method (He Qifang et al., 2012). The results showed that the protein contents of the tobacco leaves treated with the bacterial solution and sterile water were 7.63% and 9.38%, respectively, and the degradation rates of the protein contents of the tobacco leaves before fermentation were 30.89% and 15.04%, respectively. The starch contents of the tobacco leaves treated with the bacterial solution and sterile water were 0.91% and 1.26%, respectively, and the degradation rates of the starch contents of the tobacco leaves before fermentation were 38.51% and 14.86%, respectively. It was indicated that the addition of strain HY6 could effectively degrade the protein and starch contents in the cigar leaves and accelerate the fermentation process. The remaining tobacco leaf samples were rolled into cigar sticks with a 35-ring diameter and a length of 10 cm for sensory evaluation. After sensory evaluation, it was found that the addition of strain HY6 could significantly reduce the green and harsh odor of the tobacco leaves and improve the aroma.

[0050] The above-described embodiments only express several embodiments of the present application, and the description is more specific and detailed, but it should not be understood as limiting the scope of the patent. It should be noted that for ordinary skilled persons in the art, without departing from the concept of the present application, several modifications and improvements can be made, and the present application also intends to include these modifications and improvements.

Claims

1. A Bacillus amyloliquefaciens HY6, characterized in that: The Bacillus amyloliquefaciens HY6 has been preserved in the Guangdong Microbial Culture Collection Center on December 3, 2024, with a preservation number of GDMCC NO. 65580, and the Bacillus amyloliquefaciens HY6 is screened from cigar tobacco leaves and can simultaneously degrade protein and starch.

2. The Bacillus amyloliquefaciens HY6 of claim 1 is used in the preparation of tobacco products.

3. Use according to claim 2, wherein: The tobacco product is cigar tobacco leaves.

4. Use according to claim 3, wherein: The preparation method of the cigar tobacco leaves is to spray the bacterial suspension of the Bacillus amyloliquefaciens HY6 on the surface of the cigar tobacco leaves to be fermented and then perform fermentation culture.

5. Use according to claim 4, wherein: The Bacillus amyloliquefaciens HY6 bacterial suspension inoculation amount is 1 x 10 6 CFU / g.

6. The use according to claim 4, wherein: The fermentation culture is performed at a temperature of 37℃ and a humidity of 80% for 15 days.

7. The use according to claim 4, wherein: The preparation method of the bacterial suspension of the Bacillus amyloliquefaciens HY6 is to inoculate the preserved strain HY6 into a culture medium for culture, collect the bacterial bodies from the cultured bacterial liquid, resuspend the collected bacterial bodies with an equal volume of sterile normal saline to obtain the bacterial suspension of the strain HY6.

8. Use according to claim 7, wherein: The culture method of the strain HY6 is to perform culture on a shaker at 200 rpm / min and 37℃ until the bacterial liquid concentration OD600 is 0.

6.

9. The use according to claim 7, wherein: The step of collecting the bacterial bodies is to centrifuge the cultured bacterial liquid on a refrigerated centrifuge at 4℃ and 4000 rpm for 10 min.

Citation Information

Patent Citations

  • Bacillus amyloliquefaciens JQ-4 for antagonizing pathogenic bacteria of tobacco target leaf spot and application of bacillus amyloliquefaciens JQ-4

    CN119331748A