Method for obtaining phyllostachys edulis microorganisms serving as staple food of pandas

Abstract

The invention discloses a panda staple food phyllostachys edulis microorganism obtaining method, and belongs to the technical field of microorganism identification. Comprising the following steps: S1, sampling; s2, microorganism enrichment: putting the bamboo leaf sample into a sterile plastic package bag, and adding a buffer solution to carry out vortex and ultrasonic treatment on the sample. After washing is finished, the bamboo leaves are taken out, liquid in the sterile plastic package bag is centrifuged, supernatant is discarded, thalli are collected, then a buffer solution is added for resuspending the thalli, then secondary centrifugation is carried out, finally supernatant is removed, resuspending and centrifuging are carried out again, bacterial sludge is collected, and cryopreservation is carried out at the temperature of-80 DEG C for standby application. S3, microbial culture: taking the bacterial sludge in the step S2, and culturing in a manner of combining solid culture plate culture and liquid shaking culture; bamboo leaf lixivium, plant hormone analogues and the like are added into the solid culture medium and the liquid culture medium; s4, microbial identification. According to the method, comprehensive analysis of phyllostachys edulis microorganisms from an original sample to a culture flora is realized, and the community diversity covered by an identification result is ensured.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of microbial identification, and specifically relates to a method for obtaining phyllosphere microorganisms of bamboo leaves as the main food of giant pandas. BACKGROUND

[0002] The phyllosphere microbial community of the bamboo leaves as the main food of giant pandas is a key ecological link connecting bamboo growth and food source quality of giant pandas, and the composition and function of the phyllosphere microbial community directly affect the nutrient metabolism, stress resistance of bamboo and the intestinal microecological balance of giant pandas. Therefore, systematic analysis of the diversity and functional potential of the phyllosphere microorganisms has important scientific significance and application value for the ecological protection of the habitat of giant pandas, the optimization of food sources and the development of microbial resources.

[0003] However, the current research on the phyllosphere microorganisms of the bamboo leaves as the main food of giant pandas faces the following technical bottlenecks:

[0004] Firstly, the integrity of the microorganisms is not obtained: the traditional enrichment methods (such as shaking elution and simple homogenization) cannot effectively release the microorganisms tightly attached to the wax layer, stomata and epidermal folds of the bamboo leaves, resulting in the omission of part of the antibacterial analysis and the distortion of the analysis of the community structure.

[0005] Secondly, the proportion of cultivable microorganisms is extremely low: the existing technology does not include the cultivation step in the process of obtaining microorganisms, and the phyllosphere microorganisms usually depend on special microenvironments (such as plant-derived signal molecules) for survival, and the conventional culture medium (such as LB and R2A) cannot meet the physiological needs of the microorganisms, so it is difficult to effectively culture the microorganisms.

[0006] Thirdly, the multi-dimensional analysis system is missing: the traditional method only analyzes the composition of the enriched microorganisms, and lacks independent identification and functional mining of the cultivable microorganisms.

[0007] Therefore, it is extremely important to provide a method for efficiently obtaining the complete phyllosphere microbial community, improving the proportion of cultivable microorganisms and establishing a multi-dimensional analysis system. SUMMARY

[0008] The application aims to provide a method for obtaining phyllosphere microorganisms of bamboo leaves as the main food of giant pandas, which aims to obtain the phyllosphere microorganisms of bamboo leaves as the main food of giant pandas, and can realize the integrity analysis of the phyllosphere microbial community and the directional mining of functional bacteria by constructing two complete technical systems of “sampling-enrichment-cultivation-identification” and “sampling-enrichment-identification”.

[0009] The application is achieved by the following technical scheme:

[0010] A method for obtaining phyllosphere microorganisms of bamboo leaves as the main food of giant pandas, comprising the following steps:

[0011] S1. Sampling;

[0012] S2. Microorganism enrichment: The bamboo leaf sample is added to a sterile plastic bag, and buffer is added, followed by vortexing and ultrasonic treatment of the sterile plastic bag in sequence, and after the treatment is completed, ultrasonic washing is performed, the bamboo leaf is then taken out, and the liquid in the sterile plastic bag is subjected to first centrifugation, after the centrifugation is completed, the supernatant is removed, and then buffer is added to resuspend the cells at the bottom of the tube for second centrifugation, and after the cells are resuspended by adding buffer, third centrifugation is performed, and finally the supernatant is removed to obtain a microbial slurry, which is stored by freezing;

[0013] S3. Microorganism culture: The microbial slurry in step S2 is cultured by combining solid plate culture and liquid shaking culture; the solid culture medium and the liquid culture medium both contain bamboo leaf extract, plant hormone analogs, and a mixed phosphate and carbonate buffer system;

[0014] S4. Microorganism identification:

[0015] S41. DNA extraction: DNA is extracted from the frozen microbial slurry in step S2, and DNA is extracted from part or all of the microorganisms cultured in step S3;

[0016] S42. Amplification and sequencing: 16S rRNA gene and ITS sequence are amplified by PCR technology, and the amplified PCR products are detected by agarose gel electrophoresis, and the qualified PCR products are sequenced; the sequencing results are compared and analyzed in the NCBI database, and a species phylogenetic tree is constructed to determine the species of the microorganism.

[0017] The present application innovatively develops an integrated method of "enrichment-culture-dual-track identification": in the enrichment step, the gradient centrifugation and ultrasonic synergistic technology are used to improve the release efficiency and integrity of microorganisms; in the culture step, a customized culture medium containing bamboo leaf extract and plant hormone analogs is introduced to simulate the leaf micro-ecological environment and activate dormant bacteria and specific symbiotic bacteria; at the same time, an alignment system of "enrichment microorganism metagenome analysis" and "cultured bacteria pure culture identification" is established to realize the integrity analysis of leaf microbial community and the directional mining of functional bacteria. This method breaks through the limitations of the prior art in retaining microbial activity and functional research, and provides key technical support for monitoring the health of the giant panda's main diet bamboo, developing microbial agents, and tracing source microorganisms of human-animal symbiosis.

[0018] As some embodiments of the present application, in step S1, the sampling area is selected from the natural growth area and the artificial planting area of the bamboo species eaten by the giant panda;

[0019] The sampling method comprises the following steps:

[0020] S11. Four sample lines are set in each sampling area, respectively, and the sample lines are distributed from low altitude to high altitude, the distance between the sample lines is not less than 200 m and is approximately parallel, 3-5 20 m x 20 m investigation quadrats are set on each sample line at intervals, the altitude distance between adjacent quadrats on the same sample line is not less than 50 m; one 1 m x 1 m bamboo quadrat is set at the center point of each investigation quadrat and 5 m away from the center point in the east and south directions, respectively;

[0021] S12. Bamboo leaf samples are collected in the bamboo quadrats, the sampling time is in the early morning of April-May and October-November when the dew on the surface of the bamboo leaves has not completely evaporated, and the collected bamboo leaf samples are stored at low temperature immediately after sampling.

[0022] In the above scheme, the natural growth and artificial planting areas are delimited as sampling sites, covering the main food bamboo species of the giant panda in different ecological environments, ensuring that the collected bamboo leaf microbial samples are more comprehensive and can truly reflect the community characteristics of microorganisms in different environments. By setting multiple sample lines and quadrats, bamboo leaf samples at different altitudes are systematically collected, fully considering the influence of altitude on microbial distribution, making the research results more representative and reliable. By limiting sampling in the early morning of a specific season and timely low-temperature storage, the microbial activity and community structure of the bamboo leaves at this time are close to the natural state, which maximally reduces the interference of external factors, providing high-quality original samples for subsequent microbial enrichment, culture and identification.

[0023] As some implementable manners of the present application, in step S3, the carbon-nitrogen ratio of the solid culture medium and the liquid culture medium is (20:1)-(30:1). In the present scheme, a suitable carbon-nitrogen ratio can provide sufficient and balanced nutrition for microbial growth, promoting microbial metabolism and reproduction. If the carbon-nitrogen ratio is too high or too low, the microorganisms may not be able to synthesize key substances such as proteins due to lack of nitrogen source, or may not be able to provide sufficient energy due to insufficient carbon source, resulting in slow growth or even unable to grow. The present scheme defines the carbon-nitrogen ratio range, creates a suitable nutrient environment for bamboo leaf microbial, improves the microbial culture effect, and ensures that the cultured microorganisms can truly reflect the characteristics and functions of bamboo leaf microbial.

[0024] As some implementable manners of the present application, in step S3, the bamboo leaf extract is an extract treated by a composite resin; the composite resin includes modified macroporous adsorption resin, Zn-MOFs, modified ACF (activated carbon fiber)-CNT (carbon nanotube) composite material, imino diacetic acid type chelating resin, and modified strong basic anion exchange resin;

[0025] The modified macroporous adsorption resin is obtained by grafting polyaniline and PEG on a macroporous resin;

[0026] The modified ACF-CNT composite material is obtained by modifying ACF-CNT composite material by KH-560 and grafting zwitterionic polymer.

[0027] The modified strong basic anion exchange resin is obtained by grafting PEG on a strong basic anion exchange resin.

[0028] The traditional bamboo leaf extract often contains secondary metabolites such as polyphenols, tannins and metal ions, etc., which may inhibit the growth of intermicroorganisms of bamboo leaves, resulting in low success rate of culture and lack of microbial species. In order to solve this problem, the extract is treated by composite resin for targeted treatment, effectively removing harmful substances that have adverse effects on microbial culture, and effectively improving the quality of culture medium.

[0029] The functions of each component in the composite resin are as follows:

[0030] ① Modified macroporous adsorption resin: the macroporous adsorption resin as the basic framework has a special pore structure and a large specific surface area, and can capture macromolecular phenolic compounds, tannins and other harmful substances by physical adsorption;

[0031] After grafting polyaniline, the π-π conjugated structure can not only capture macromolecular phenolic compounds, tannins, flavones and other substances by physical adsorption, but also can use the redox effect to transfer electrons with some refractory organic harmful substances, promote their adsorption and decomposition.

[0032] After grafting polyethylene glycol segments, the hydrophilicity of PEG has good adsorption capacity for polar impurities (such as some polyphenols, organic acids), and can reduce the hydrophobic interaction between the surface of the macroporous adsorption resin and the microorganisms, reduce the non-specific adsorption of microorganisms, and avoid the interception and adsorption of microorganisms.

[0033] ② Zn-MOFs:

[0034] Zn-MOFs have super high specific surface area and rich pore structure, and the zinc ions can coordinate with metal ions, which can efficiently adsorb harmful metal ions in the extract. In addition, the pore can selectively capture small molecular impurities (such as some low molecular weight organic acids), and optimize the composition of the extract.

[0035] ③ Modified ACF-CNT composite material:

[0036] ACF has abundant microporous structure and large specific surface area, which can adsorb small molecule organic harmful substances and some heavy metal ions. CNT has excellent mechanical properties and electrical conductivity, which can enhance the mechanical strength of the material. The combination of the two can play a synergistic effect, improve the adsorption capacity of small molecule organic matter and enhance the mechanical properties. However, because the hydroxyl group (-OH) on the surface of ACF and the carboxyl group (-COOH) on the surface of CNT are only connected by weak hydrogen bonds, under high flow rate or acid-base impact, CNT is easy to fall off from the surface of ACF, causing micropore blockage and reducing the adsorption effect. At the same time, the hydrophobic aromatic ring structure on the surface of CNT is exposed, which causes microbial adhesion.

[0037] Based on this, the amphoteric ion polymer is modified and grafted by 3-glycidyloxypropyl trimethoxysilane (KH-560).

[0038] KH-560 contains both epoxy and methoxy silane. After hydrolysis, methoxy silane will be converted into silicon hydroxyl, which can react with the polar groups such as hydroxyl and carboxyl on the surface of ACF to form stable Si-O-C covalent bond. This covalent bond connection enables KH-560 to be firmly anchored on the surface of ACF, providing a stable basis for subsequent reactions.

[0039] The epoxy group has high reactivity and can react with the large number of hydroxyl groups generated on the surface of CNT after hydroxylation, as well as the amino and hydroxyl groups in the subsequently grafted amphoteric ion polymer. When reacting with CNT hydroxyl groups, ether bonds are formed; when reacting with amino groups, ring-opening addition reactions occur, thereby tightly connecting CNT or other functional polymers with ACF, significantly enhancing the interfacial bonding force between ACF and CNT, and making the overall structure of the composite material more stable.

[0040] The amphoteric ion polymer is synthesized by free radical copolymerization of dimethylaminoethyl methacrylate and sulfobetaine. After grafting the amphoteric ion polymer, the hydrophilicity is significantly improved, and the amount of microbial adhesion is significantly reduced.

[0041] (4) Imido diacetic acid type chelating resin: The chelating resin still uses imido diacetic acid type, and on the basis of introducing a side chain group with large steric hindrance (such as tert-butyl), the crosslinking degree of the resin is further optimized to improve its mechanical strength and adsorption stability.

[0042] (5) Modified strong basic anion exchange resin: The quaternary ammonium group functional group of the strong basic anion exchange resin can undergo ion exchange reaction with organic acid root ions to adsorb and remove organic acids such as oxalic acid and citric acid. After grafting PEG, the resin surface will be wrapped with a layer of hydration layer to reduce the surface energy of the resin surface, making it difficult for microbial cells to adhere to the resin surface, thereby reducing the adsorption of microorganisms.

[0043] As some embodiments of the present application, the modified macroporous adsorption resin is further modified by 3-aminopropyl triethoxysilane.

[0044] In the modified macroporous resin, the chemical bonding of polyaniline grafted on the surface of the macroporous adsorption resin is not firm enough, and when the macroporous resin is in long-term contact with complex components in bamboo leaf extract, the polyaniline may fall off, resulting in weakening of the oxidation-reduction function and seriously affecting the adsorption effect of harmful substances. Based on this, the macroporous resin is modified by 3-aminopropyl triethoxysilane (APTS), one end of the APTS molecule is an amino group, and the other end is an ethoxysilane group, which can react with polyaniline and the silicon hydroxyl group on the surface of the macroporous resin, respectively, effectively improving the bonding force between polyaniline and the macroporous resin and prolonging the service life.

[0045] As some embodiments of the present application, in the modified ACF-CNT composite material, PEG is further introduced between KH-560 and the zwitterionic polymer.

[0046] Because the reaction between the epoxy group of KH-560 in the modified ACF-CNT composite material and the amino group of the zwitterionic polymer may form a rigid crosslinking network, the composite material becomes brittle. The brittle characteristic makes the material prone to crack and accelerate the crack propagation when subjected to external forces, such as liquid flow impact, frequent loading and unloading, or pressure fluctuation, seriously damaging the structural integrity of the composite material, greatly reducing the adsorption efficiency of harmful substances in bamboo leaf extract, and shortening the service life.

[0047] Based on this, by further introducing PEG between KH-560 and the zwitterionic polymer, the excellent flexibility and good hydrophilicity of the PEG molecular chain are used to effectively disperse the stress generated by the rigid crosslinking network. The long chain structure of PEG can be inserted into the crosslinking network, reducing the crosslinking density and increasing the flexibility of the material; at the same time, PEG can also improve the interfacial compatibility of the composite material, making the combination between KH-560, the zwitterionic polymer, and ACF-CNT more uniform, reducing the generation of cracks caused by stress concentration, and effectively solving the problem of brittleness caused by the rigid crosslinking network.

[0048] As some embodiments of the present application, the composite resin comprises modified macroporous adsorption resin, Zn-MOFs, modified ACF-CNT composite material, imino-diacetic acid type chelate resin, and modified strong basic anion exchange resin, wherein the mass ratio of each component in the composite resin is as follows:

[0049] Modified macroporous adsorption resin: Zn-MOFs: modified ACF-CNT composite material: imino-diacetic acid type chelate resin: modified strong basic anion exchange resin = (40-50): (20-30): (20-30): (8-15): (5-10).

[0050] As some embodiments of the present application, the mass ratio of each component in the composite resin is as follows:

[0051] Modified macroporous adsorption resin: Zn-MOFs: modified ACF-CNT composite: iminodiacetic acid type chelating resin: modified strong basic anion exchange resin = 45:25:25:10:7.

[0052] As some embodiments of the present application, the macroporous resin in the modified macroporous adsorption resin is AB-8 type styrene macroporous adsorption resin, and the strong basic anion exchange resin in the modified strong basic anion exchange resin is 201x7 type anion exchange resin.

[0053] Compared with the prior art, the present application has the following advantages:

[0054] The present application takes the leaf-intermicroorganism of the giant panda staple bamboo as the target, and constructs two complete technical systems of "sampling-enrichment-cultivation-identification" and "sampling-enrichment-identification". In the microbial enrichment link, the physical treatment mode of vortex and ultrasonic combination is adopted to efficiently elute the microorganisms on the surface of the bamboo leaves, and the bacterial slurry is purified through multiple centrifugation steps, so that the enriched microorganisms can be directly used for cultivation and also used for subsequent DNA extraction and identification; in the microbial cultivation stage, the cultivation mode of combining solid plate and liquid oscillation is used, so that whether the microorganism likes to grow on the surface of the solid or likes to swim in the liquid, the microorganism can be cultivated, and the cultivated microorganism can also be included in the identification process. The design realizes the comprehensive analysis of the leaf-intermicroorganism from the original sample to the cultivated bacterial flora, and ensures that the identification result covers the community diversity.

[0055] The innovative ideas of the present application mainly reflect in two aspects: first, the enrichment strategy simulating the natural environment. The traditional single physical separation method is broken through, the mechanical force of vortex and the cavitation effect of ultrasonic are used in cooperation, the microorganisms are efficiently separated from the surface of the bamboo leaves, the physical damage is reduced, the bamboo debris and secondary metabolites are removed through multiple centrifugation steps, so that the enriched microorganisms are closer to the original community state, and high-purity samples are provided for subsequent research.

[0056] Secondly, the construction of the bionic cultivation system. The bamboo leaf extract is added in the solid and liquid culture medium to simulate the natural nutrient components of the leaf-intermicroorganism; the plant hormone analog is introduced to restore the signal interaction environment of the bamboo leaf-intermicroorganism and the plant; the phosphate and carbonate mixed buffer system is used to accurately control the pH value to the natural range of the bamboo leaf-intermicroorganism. The cultivation environment can specifically promote the growth of the microorganisms symbiotic with the bamboo, significantly improve the cultivability of the difficult-to-cultivate strains, improve the cultivation success rate, effectively solve the technical problem that the leaf-intermicroorganism is difficult to survive due to the separation from the original ecological niche, and provide a breakthrough method for the resource excavation of the bamboo leaf-intermicroorganism of the giant panda staple bamboo. BRIEF DESCRIPTION OF DRAWINGS

[0057] Figure 1 Figure 2: Relative abundance of leaf-associated bacteria at the phylum level in three bamboo species (ERZ, Phyllostachys nidularis; SMYSZ, Phyllostachys nidularis; FSJZ, Phyllostachys pubescens);

[0058] Figure 2 Figure 3: Relative abundance of leaf-associated bacteria at the phylum level in different seasons in three bamboo species.

[0059] Figure 3 Figure 4: Relative distribution of leaf-associated bacteria at the genus level in three bamboo species (ERZ, Phyllostachys nidularis; SMYSZ, Phyllostachys nidularis; FSJZ, Phyllostachys pubescens);

[0060] Figure 4 Figure 5: Relative distribution of leaf-associated bacteria at the genus level in different seasons in three bamboo species. DETAILED DESCRIPTION

[0061] Example 1

[0062] S1. Sampling preparation and implementation

[0063] S11. Selection of sampling area: Select natural growth areas and artificial planting areas of main bamboo species consumed by giant pandas (such as Phyllostachys nidularis, Phyllostachys nidularis, and Phyllostachys pubescens). In each area, 4 sample lines are set up, with a distance of no less than 200m and roughly parallel. On each sample line, 3-5 20m x 20m survey plots are set up at intervals, with a distance of no less than 50m between adjacent plots on the same sample line.

[0064] S12. Sample collection: In the center of each survey plot and 5m east and south of the center, set up a 1m x 1m bamboo plot. Collect bamboo leaf samples from these plots, with one sample per plot, and control the weight of each sample to be 200-400g. The sampling time is divided into spring and summer (April-May) and autumn and winter (October-November) in the morning, when the humidity of the bamboo leaf surface is suitable and the distribution of microorganisms is stable. During the collection process, record the bamboo species, latitude and longitude, altitude, and other relevant habitat variable data in the plot, and transport the collected bamboo leaf samples to the laboratory within 2h and store them in a -4°C freezer.

[0065] In this study, 50 samples were collected in spring and summer, including 17 Phyllostachys nidularis, 17 Phyllostachys nidularis, and 16 Phyllostachys pubescens; 51 samples were collected in autumn and winter, including 20 Phyllostachys nidularis, 17 Phyllostachys nidularis, and 16 Phyllostachys pubescens.

[0066] S2. Leaf-associated microorganism enrichment

[0067] S21. Buffer preparation: weigh 1.2114 g Tris (10 mM), 0.29225 g EDTA (1 mM), add 1000 mL ultrapure water to dissolve, then add 500 μL Tween-80 with a pipette, mix thoroughly, and store the buffer at 4°C for later use.

[0068] S22. Enrichment operation: take 50 bamboo leaves from the -4°C freezer, and put them into different sterile plastic bags, add buffer at a ratio of 1:2, and vortex the sterile plastic bags in a vortexer for about 4 min to make the microorganisms fully detach from the surface of the bamboo leaves; then put the plastic bags into an ultrasonic cleaner and wash them at 4°C and 40 Hz for 2 min to further separate the microorganisms; take out the bamboo leaves with sterile tweezers, pour the liquid in the sterile plastic bags into a test tube, and centrifuge at 4°C and 2200g for 15 min; remove the supernatant, transfer the cell pellets at the bottom of the tube to a 2 mL centrifuge tube with a pipette, and resuspend and centrifuge again; after adding an appropriate amount of buffer to resuspend the cell pellets, centrifuge again at 4°C and 2200g for 15 min; finally remove the supernatant to obtain the bacterial slurry, label the bamboo species, date, and number, and immediately freeze at -80°C.

[0069] S3. DNA extraction

[0070] S31. Buffer pretreatment: add 10 mL of 100% isopropyl alcohol to the HBC buffer for later use; add 80 mL of anhydrous ethanol to the DNA wach buffer for later use.

[0071] Add 80 mL of anhydrous ethanol to the DNA wach buffer for later use.

[0072] Set the water bath to 70°C, heat the Elution buffer to 70°C, prepare an ice box, and place the P2 buffer in the ice box for pre-cooling.

[0073] S32. DNA extraction steps:

[0074] The cell pellets stored at -80°C were added to 1 mL kit-supplied SLX plus buffer containing 500 mg glass beads, and grinded for 90 s at 65 Hz on a full-automatic sample quick grinder. After grinding, 725 μL of SLX plus buffer was added, and vortexed for 3-5 min. 500 g centrifugation was performed for 5 s to concentrate the liquid at the bottom of the tube. 72 μL of DS buffer was added, and vortexed until complete fusion. Incubation was performed at 70°C water bath for 10 min, with a brief vortexing once during the incubation. Centrifugation was performed at 10000 g for 5 min, and 400 μL of supernatant was transferred to a new 1.5 mL centrifuge tube. 135 μL of pre-cooled P2 buffer was added, and vortexed to mix, and then placed in an ice box for 3 min. Centrifugation was performed at the maximum centrifugal speed (≥ 13000 g) for 1 min, and the supernatant was transferred to another clean 1.5 mL centrifuge tube. 200 μL of cHTR Reagent (shaken well before use) was added, and vortexed to mix, and then placed at room temperature for 2 min. Centrifugation was performed again at the maximum centrifugal speed for 1 min, and more than 500 μL of supernatant was transferred (if the supernatant color is too deep, repeat this step). An equal amount of XP1 buffer was added, and vortexed to mix. The HiBind DNA adsorption column was inserted into a 2 mL centrifuge tube, and 700 μL of liquid was injected into the adsorption column, and centrifuged at 10000 g for 1 min, and the filtrate was discarded. The above step was repeated until all the dissolved substances passed through the adsorption column. 500 μL of HBC buffer was added, and centrifuged at 10000 g for 1 min, and the filtrate was discarded. The adsorption column was inserted into a new 2 mL centrifuge tube, and 70 μL of DNA wash buffer was added, and centrifuged at 10000 g for 1 min, and the filtrate was discarded. This washing step was repeated once. The adsorption column was centrifuged at the maximum centrifugal speed for 2 min to remove residual ethanol. The adsorption column was inserted into a 1.5 mL centrifuge tube, and 50 μL of 70°C preheated Elution buffer was added to the center of the adsorption column, and placed at room temperature for 1-2 min. The filtrate was added again to the center of the adsorption column, and placed at room temperature for 1 min, and then centrifuged at the maximum centrifugal speed, and the filtrate was collected and stored at -20°C.

[0075] S4. Amplification and Sequencing

[0076] The extracted DNA samples were sent to a professional sequencing company. The DNA purity was detected by NanoDrop2000, and the DNA integrity was detected by agarose gel electrophoresis. The samples meeting the standard were used for subsequent experiments. For bacterial microorganisms, the 16S rRNA V3-V4 hypervariable region sequence was amplified by PCR, and the primers were 338F (ACTCCTACGGGAGGCAGCAG) and 806R (GGACTACHVGGGTWTCTAAT). For eukaryotic microorganisms, the first internal transcribed spacer (ITS1) region sequence was amplified, and the primers were ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC). The PCR reaction parameters were set as follows: 95°C initial denaturation for 3 min; 35 cycles of 95°C for 30 s, 58°C for 30 s, and 72°C for 30 s; 72°C extension for 10 min, and 10°C storage. After the amplification product was detected, high-throughput sequencing and data optimization processing were performed by the sequencing company.

[0077] S5. Sequence analysis and data processing

[0078] For the 16S rRNA V3-V4 region sequence, the genus composition was counted, and the unique tag sequence was aligned in the database. After removing the chloroplast and mitochondrial tags, the statistics were re-counted. For the ITS1 sequence, it was aligned in the database to determine whether there were related fungal tags of bamboo species. If there were no related tags, subsequent analysis was performed. Using Mothur software, the sequences were clustered into OTUs at a similarity of 97%. The specific steps included removing duplicate sequences in the optimized sequence, extracting non-redundant sequences and removing single sequences, clustering non-redundant sequences (without single sequences) at a similarity of 97%, removing chimeras, obtaining OTU representative sequences, and finally generating an OTU table for data analysis, forming a microbial column chart at different classification levels.

[0079] The experimental results of Example 1 are as follows.

[0080] 1. Composition analysis at the door level

[0081] According to the above description, each bamboo leaf sample in Example 1 was analyzed, and others were removed. It was found that the bacteria mainly included 6 phyla (Firmicutes, Proteobacteria, Actinobacteria, Bacteroidetes, Deinococcus-Thermus, and Cyanobacteria). Figure 1 , Figure 2), respectively, are Proteobacteria, Acidobacteriota, Bacteroidota, Actinobacteriota, Planctomycetota, Myxococcota. Through the above data analysis, the genus of each bamboo leaf sample can be obtained (reflecting the practicability of the present application, this method is also suitable for identifying the microorganisms after the culture of Example 2), but because the data of the bamboo leaf samples is too much, the microorganism species in each sample are not recorded one by one, only the phylum and genus of the microorganisms included in each of the three bamboos are recorded (such as Tables 1-4 and Figures 1-4 ).

[0082] As shown in Table 1, the dominant phylum in the phylum of Oligostachyum, Phyllostachys edulis, and Dendrocalamopsis oldhami is Proteobacteria, followed by Acidobacteriota. The percentage of Bacteroidota, Actinobacteriota, Planctomycetota, and Myxococcota is the largest in Phyllostachys edulis. In spring and summer and in autumn and winter (Table 2), the percentage of Acidobacteriota in the three bamboos in spring and summer is greater than that in autumn and winter; the percentage of Proteobacteria in Oligostachyum and Phyllostachys edulis in autumn and winter is greater than that in spring and summer; the percentage of Bacteroidota and Actinobacteriota in Phyllostachys edulis and Oligostachyum in spring and summer is greater than that in autumn and winter. It shows that the phylum has seasonal differences, but there is no regular change.

[0083] Table 1: Relative percentage of bacteria in the phylum level of three bamboo species

[0084]

[0085] Table 2: Relative percentage of bacteria in the phylum level of three bamboo species in different seasons

[0086]

[0087] 2. Community composition analysis at the genus level

[0088] It is found that there are many uncategorized bacterial groups at the genus level. In addition to the groups classified into the others category, we found that there are 24 bacterial groups at the genus level ( Figure 3 、 Figure 4). Among the three bamboo species (Table 3), the genus 1174-901-12 was found to have the highest percentage in the three bamboo species; among the Acetobacteraceae, there were four species, Acidiphilium sp., unclassified_f__Acetobacteraceae sp., norank_f__Acetobacteraceae sp., and Terriglobus sp., and the abundance of the Acetobacteraceae in Bambusa emeiensis was the highest, and the abundance of the Acetobacteraceae in Dendrocalamus farinosus was the lowest; Methylocella sp. and Methylobacterium-Methylorubrum sp. were not contained in Yushania albociliata. Among the genera, there were large differences in the composition of the genera among the bamboo species. In spring and summer and in autumn and winter (Table 4), the abundance of the Acetobacteraceae in spring and summer was greater than that in autumn and winter; the P3OB-42 genus was not contained in Y. albociliata in spring and summer, the Serratia sp. was contained only in Y. albociliata in spring and summer, and the Erwinia sp. was contained only in Y. albociliata. The distribution of the genera in different seasons also showed the seasonal differences in the bacterial flora.

[0089] Table 3: Changes in the bacterial flora of the genera of the three bamboo species

[0090]

[0091] Table 4: Changes in the bacterial flora of the genera of the three bamboo species in different seasons

[0092]

[0093]

[0094] Example 2

[0095] The enriched bacterial slurry is taken for culture, and if multiple bacterial species are taken for culture, the culture method is the same.

[0096] The specific steps of the culture are as follows:

[0097] S1. Preparation of culture medium: Based on the existing ordinary culture medium (such as LB), the carbon-nitrogen ratio is adjusted to 25:1, the carbon source is a mixture of glucose, sucrose and bamboo leaf polysaccharide (mass ratio of 2:1:1), and the nitrogen source is a combination of protein peptone, yeast extract and ammonium salt (mass ratio of 3:1:1). Then, bamboo leaf extract (15%, volume percentage), naphthalene acetic acid (concentration 0.01 mg / L), 6-benzylaminopurine (concentration 0.1 mg / L), phosphate buffer (0.05-0.1 M) and carbonate buffer (concentration 0.01-0.05 M) are added to the medium. The initial pH of the medium is adjusted to 6.0-7.0.

[0098] Both solid and liquid culture media contain the same components, and agar is additionally added to the solid culture medium (this is a prior art).

[0099] S2. Culture: The enriched bacterial slurry is diluted with sterile buffer and inoculated into the solid and liquid culture media prepared in S1. The combination of solid plate culture and liquid shaking culture is used. The solid plate culture is used for isolation and purification of microorganisms, the culture temperature is 20-28°C, and the culture time is 2-7 days (determined according to the actual growth conditions). The liquid shaking culture is used for expanding the culture of microorganisms, the shaking speed is 120-180 rpm, the culture temperature is also 20-28°C, and the culture time is 2-7 days. The growth of microorganisms is observed regularly during the culture process.

[0100] After culture, an appropriate amount of colonies is picked from the solid culture medium plate (different types of single colonies are selected according to colony morphology and color), inoculated into a 1.5 mL centrifuge tube containing 500 μL sterile water, vortexed, centrifuged at 10000 g for 2 min, and the supernatant was discarded.

[0101] Then 200 μL kit-supplied SLX plus buffer and 200 mg glass beads are added, and the sample is ground on a full-automatic sample rapid grinder at 65 Hz for 60 s. The subsequent steps are the same as the DNA extraction steps of the enriched bacterial slurry. From the addition of 725 μL SLX plus buffer, the above steps are sequentially performed until the DNA filtrate is obtained and stored at -20°C. Then, the amplification and sequencing, sequence analysis and data processing steps in Example 1 are followed to obtain the microbial species, which are compared with the species information obtained from the bacterial slurry in Example 1, and the microbial groups that are successfully cultured only in Example 2 are screened out. Combined with the known microbial function database, functional strains with potential application value, such as plant growth-promoting bacteria for promoting the growth and development of bamboo, are predicted and mined.

[0102] The preparation method of the above-mentioned bamboo leaf extract is as follows:

[0103] Bamboo leaves (the bamboo leaves are the same as the bamboo leaves sample to which the fungus mud belongs in the present embodiment) and water were extracted at a mass ratio of 1:5 and 40°C for 12h to obtain a bamboo leaf extract, which was purified by a composite resin to obtain a bamboo leaf extract solution.

[0104] The composite resin is obtained by fully mixing modified macroporous adsorption resin, Zn-MOFs, modified ACF-CNT composite material, imino diacetic acid type chelating resin, and modified strong basic anion exchange resin, wherein the modified macroporous adsorption resin: Zn-MOFs (the preparation method is prior art, which can refer to the method in the patent with the application number CN202210512072.9): modified ACF-CNT composite material: imino diacetic acid type chelating resin (purchased, and D401 is selected in the present embodiment): modified strong basic anion exchange resin = 45:20:30:10:8 (mass ratio).

[0105] The preparation method of the modified macroporous resin is as follows:

[0106] S1. Grafting polyaniline: 10g of AB-8 type styrene macroporous adsorption resin (crosslinking degree 8%, specific surface area 480-520m 2 / g, average pore size 13-14nm) was added to a flask, 150mL of 1M hydrochloric acid was poured, and the system was stirred at room temperature for 1h; then 5mL of aniline monomer was added, the temperature was lowered to 5±2°C in an ice water bath, and the stirring was started (600rpm); then the APS solution (APS 11.4g dissolved in 50mL of 1M hydrochloric acid) was added at a constant speed through a dropping funnel within 30min, and the temperature of the system was maintained at ≤10°C; after the addition was completed, the reaction was continued for 8h (ice water was supplemented during the reaction to maintain low temperature). Then the product was filtered, washed, and dried at 60°C under vacuum for 6h to obtain a polyaniline grafted resin.

[0107] S2. Grafting PEG: 5g of the polyaniline grafted resin was taken into a 100mL four-necked flask, 50mL of DMF was poured, and the system was stirred at 60°C for 2h; then 2.5g of PEG-6000 and 0.05g of AIBN were added, the temperature was raised to 70°C under nitrogen atmosphere, and the system was refluxed in an oil bath for 6h at a stirring speed of 300rpm. After the reaction liquid was cooled, the resin was filtered, and the product was Soxhlet extracted with DMF for 24h, and finally dried at 60°C under vacuum to constant weight to obtain a modified macroporous resin.

[0108] The preparation method of the modified ACF-CNT composite material is as follows:

[0109] S1. Preparation of ACF-CNT composite material:

[0110] S11. CNT (diameter 10-20 nm, length 10-30 μm) was added into mixed acid (concentrated H2SO4, HNO3, volume ratio 3:1) and ultrasonically dispersed for 30 min. After centrifugation and washing, the product was dried at 60°C under vacuum for 12 h. Then 1 g of the dried product was added into 200 mL of deionized water containing 2 g of SDBS, and ultrasonically dispersed for 1 h (power 300 W) to form a CNT suspension.

[0111] 5 g of ACF was cut into millimeter size, added into 100 mL of deionized water, and ball-milled for 30 min (rotation speed 300 rpm) to form an ACF suspension.

[0112] S12. The CNT dispersion was mixed with the ACF suspension at a volume ratio of 1:1, and ultrasonically stirred for 30 min (power 300 W). Then 1 mL of phenolic resin solution (solid content 60%) was added, and the mixture was stirred uniformly, filtered, dried in an oven at 60°C for 2 h, and carbonized in a tube furnace under nitrogen atmosphere at 800°C for 2 h to obtain an ACF-CNT composite material.

[0113] S2. Modification with KH-560: 2 g of the ACF-CNT composite material was added into a hydrolysis solution (KH-560 5 mL, anhydrous ethanol 90 mL and deionized water 5 mL, then the pH of the solution was adjusted to 4.5 with acetic acid, and the mixture was stirred magnetically at room temperature for 30 min), and refluxed at 65°C for 5 h with mechanical stirring at 200 rpm. Then the mixture was extracted with anhydrous ethanol by Soxhlet extraction for 12 h, and dried under vacuum at 80°C to constant weight to obtain a silane-modified composite material.

[0114] S3. Grafting of zwitterionic polymer:

[0115] S31. Methyl dimethylaminoethyl methacrylate 5 mL, 3-sulfopropyl methacrylate potassium salt 10.7 g, KPS 0.1 g and deionized water 100 mL were mixed, and then the mixture was reacted in an oil bath at 75°C under nitrogen atmosphere for 7 h with mechanical stirring at 400 rpm. Then the reaction solution was dialyzed in a dialysis bag (molecular weight cut-off 8000-14000 Da) for 48 h, and freeze-dried to obtain a zwitterionic polymer.

[0116] S32. 1 g of the silane-modified composite material, 0.5 g of the zwitterionic polymer and 50 mL of deionized water were mixed and reacted in an oil bath at 80°C for 5 h under nitrogen atmosphere with mechanical stirring at 250 rpm. Then the mixture was washed and dried under vacuum at 80°C to constant weight to obtain a modified ACF-CNT composite material.

[0117] The preparation method of the modified strong-alkali anion exchange resin is as follows:

[0118] S21. Take 100 g of 201 x 7 type strong basic anion exchange resin (chlorine type, crosslinking degree 7%, water content 40-50%) and soak it in 1 L of 2M NaOH solution for 4 h, then wash it to neutral with deionized water, then pass it through an acetone solution, and after suction filtration, dry it to constant weight at 40°C under vacuum to obtain a pretreated resin;

[0119] S22. Take 20 g of the pretreated resin, 10 g of PEG-4000, 0.3 g of benzoyl peroxide, and 150 mL of anhydrous acetone, mix them, and reflux them at 80°C under a nitrogen atmosphere for 8 h with a mechanical stirring speed of 350 rpm, then Soxhlet extract them with acetone for 24 h, and dry them to constant weight under vacuum at 40°C to obtain a modified strong basic anion exchange resin.

[0120] Example 3

[0121] On the basis of Example 2, the macroporous resin is modified with 3- aminopropyltriethoxysilane before grafting polyaniline thereon.

[0122] The preparation method of the modified macroporous resin in this example is as follows:

[0123] S1. Prepare a silanized resin: add 10 g of AB-8 resin to a flask, pour in 100 mL of anhydrous toluene, and stir to swell at room temperature for 1 h; then add 5 mL of APTES, and replace the air with nitrogen gas (50 mL / min) for 30 min; then heat to 110°C to reflux for 6 h, and after the reaction is completed, cool it, then wash it, and dry it under vacuum at 60°C for 12 h to obtain a silanized resin.

[0124] S2. Graft polyaniline: take 10 g of the silanized resin, add it to 150 mL of 1M hydrochloric acid, and stir to swell at room temperature for 2 h, then add 0.1 g of hydroquinone, add 5 mL of aniline monomer after stirring thoroughly, and cool it to 5±2°C in an ice water bath, and start stirring (600 rpm); then add an APS solution (APS 11.4 g dissolved in 50 mL of 1M hydrochloric acid) at a constant speed through a dropping funnel within 30 min, and maintain the temperature of the system ≤10°C; after the addition is completed, continue to react for 8 h (during which ice water is supplemented to maintain low temperature). Then, after washing by filtration, dry it under vacuum at 60°C for 6 h to obtain a polyaniline grafted resin.

[0125] S3. Graft PEG, the steps are the same as in Example 2.

[0126] Example 4

[0127] On the basis of Example 3, PEG is also introduced between KH-560 and the zwitterionic polymer of the modified ACF-CNT composite material.

[0128] The preparation method of the modified ACF-CNT composite material in this example is as follows:

[0129] S1, S2 steps are the same as example 2, and the specific steps of S3 and S4 are:

[0130] S3. 1 g of silane modified composite material was added to a four-necked flask containing 100 mL of toluene, and stirred at 60°C for 2 h. 1 g of PEG-2000 and 0.05 g of p-toluenesulfonic acid were added, and nitrogen was introduced to replace the air for 30 min (flow rate 50 mL / min), and the temperature was raised to 110°C, and the oil bath was refluxed for 8 h at a stirring speed of 300 rpm. After the reaction was completed, the reaction solution was cooled, the resin was filtered out, and was washed with toluene and anhydrous ethanol for 3 times, and finally dried at 80°C under vacuum to constant weight to obtain the PEG grafted silane modified composite material.

[0131] S4. The silane modified composite material 1 g, zwitterionic polymer 0.5 g and deionized water 50 mL were mixed and reacted at 80°C oil bath for 5 h, and the mechanical stirring speed was 250 rpm, and then washed and dried at 80°C under vacuum to constant weight to obtain the modified ACF-CNT composite material.

[0132] Comparative Example 1

[0133] On the basis of example 2, the components of the composite resin were changed, and the changed composite resin included 45 parts by weight of AB-8 type styrene macroporous adsorption resin, 20 parts by weight of Zn-MOFs, 30 parts by weight of ACF-CNT composite material, 10 parts by weight of imino diacetic acid type chelating resin, and 8 parts by weight of strong basic anion exchange resin.

[0134] Comparative Example 2

[0135] The composite resin in example 2 was replaced by AB-8 type styrene macroporous adsorption resin.

[0136] Comparative Example 3

[0137] Compared with example 2, only ordinary medium was used for culture, and no bamboo leaf extract, naphthalene acetic acid, 6-benzylaminopurine, etc. were added. Compared with the ordinary medium, the optimized medium of example 2 has advantages.

[0138] Among them, the colony density of the solid medium culture of example 2 after 3 days was 1450 CFU / cm 2 , and the OD600 value of the liquid medium was 0.85; while the colony density of the control group after 4 days of solid medium culture was 480 CFU / cm 2 , and the OD600 value of the liquid medium was 0.29. It can be seen that by customizing the carbon and nitrogen source, plant signal molecule, buffer system and bamboo leaf extract, example 2 can significantly promote the metabolic activity of microorganisms, which indicates that the optimized medium can effectively stimulate the proliferation of microorganisms in the leaves of the main food of giant pandas.

[0139] In addition, the microorganisms cultivated in Example 2 and the cultures cultivated in the control group were identified in the above manner, and finally it was concluded that there were 8 fewer microorganisms isolated in the control group than in Example 2. Thus, it can be seen that the inhibition of microorganisms is weakened and the growth of various microorganisms is effectively promoted by simulating the microecological environment of the phyllosphere in Example 2.

[0140] Experimental Example

[0141] The removal rates of harmful substances in bamboo leaf extract, the adhesion rates of microorganisms, and the removal rates of harmful substances in bamboo leaf extract after 15 cycles of use of the composite resins in Test Examples 2-4 and Comparative Examples 1-2 were tested.

[0142] Among them, the harmful substances in the bamboo leaf extract prepared in Example 2 and the corresponding concentrations are shown in Table 5.

[0143] Table 5:

[0144]

[0145] Before testing, a plurality of resin columns (inner diameter 1.5 cm, height 20 cm) were prepared, and the composite resins in Test Examples 2-4 and Comparative Examples 1-2 were respectively packed, and were respectively packed to 2 / 3 of the volume of the resin column, and then were lightly compacted to avoid air bubbles, and were pre-washed with deionized water until the effluent was clear.

[0146] The specific experiment is as follows:

[0147] 1. Harmful substance removal rate experiment, and the experimental results are shown in Table 6.

[0148] Each bamboo leaf extract was passed through the resin column packed with Test Examples 2-4 and Comparative Examples 1-2 at a flow rate of 1 mL / min, the solution before and after sampling was collected, and heavy metals (determined by atomic absorption spectrometry), pesticide residues and phenols (determined by gas chromatography-mass spectrometry) were detected, and the removal rate was calculated: adhesion rate (%) = [(C0-C1) / C0]x100%.

[0149] (C0: initial concentration, C1: concentration after treatment).

[0150] Table 6:

[0151]

[0152] As can be seen from Table 6, the removal rates of heavy metals, pesticides and phenolic substances in Test Examples 2-4 are all higher, and the removal rates of Comparative Example 1 and Comparative Example 2 are significantly lower. This shows that the composite resins in Test Examples 2-4 can significantly enhance the removal capacity of harmful substances through the synergistic effect of various modified materials.

[0153] 2. Microorganism adhesion rate experiment, and the experimental results are shown in Table 7.

[0154] The microbial strain is Escherichia coli and Staphylococcus aureus.

[0155] The bacterial leaching solution (concentration 10 6 The bacterial leaching solution (concentration 10 CFU / mL) was passed through the resin column at a flow rate of 1 mL / min, and the solutions before and after collection were plated and counted to calculate the adhesion rate: adhesion rate (%) = [(N0-N1) / N0] x 100%.

[0156] (N0: initial bacterial number, N1: bacterial number after treatment).

[0157] Table 7:

[0158]

[0159] As can be seen from Table 7, the adhesion rates of Examples 2-4 to Escherichia coli and Staphylococcus aureus are all low. The adhesion rates of Comparative Examples 1 and 2 are high. This fully reflects that Examples 2-4 effectively weaken the interaction between the material and the microorganism through means such as hydrophilic modification, charge regulation, steric hindrance construction, and functional group directional design, so that the composite resin can adsorb harmful substances while avoiding excessive adhesion of microorganisms, reducing problems such as resin blockage, pollution, and performance degradation caused by microbial adhesion.

[0160] 3. Circulating adsorption experiment, and the experimental results are shown in Table 8.

[0161] After the original bamboo leaf leaching solution was passed through each resin column 15 times, the concentration of pollutants was detected, and the circulating adsorption rate was calculated.

[0162] Table 8:

[0163]

[0164] As can be seen from Table 8, after 15 consecutive adsorption experiments, the removal rates of harmful substances of Examples 2-4 are still high, all higher than 68%. The removal rates of Comparative Examples 1 and 2 are much lower. This shows that the composite resin of Examples 2-4 can still maintain a high adsorption effect and stability after multiple cycles, reflecting its good durability and repeated use performance, and is more suitable for long-term and continuous processing of bamboo leaf leaching solution and other scenes in actual applications than Comparative Examples 1-2.

Claims

1. A method for obtaining a microorganism from the interlamella of a main food bamboo of Ailuropoda melanoleuca, characterized in that, The method comprises the following steps: S1. Sampling; S2. Microorganism enrichment: bamboo leaf samples are added into a sterile plastic bag, buffer solution is added, and then the sterile plastic bag is subjected to vortexing and ultrasonic treatment in sequence, after the treatment, ultrasonic washing is performed, the bamboo leaves are taken out, and the liquid in the sterile plastic bag is subjected to first centrifugation, after the centrifugation, the supernatant is removed, then buffer solution is added to resuspend the cells at the bottom of the tube to perform second centrifugation, after the resuspension of the cell pellets, third centrifugation is performed, and finally the supernatant is removed to obtain microbial slurry, which is stored in a frozen state; S3. Microorganism culture: the microbial slurry in step S2 is cultured by combining solid plate culture and liquid shaking culture; bamboo leaf extract, plant hormone analogs, and mixed phosphate and carbonate buffer systems are added into the solid culture medium and the liquid culture medium; S4. Microorganism identification: S41. DNA extraction: DNA of the frozen microbial slurry in step S2 and DNA of part or all of the microorganisms cultured in step S3 are extracted; S42. Amplification and sequencing: 16S rRNA and ITS sequences are amplified by using PCR technology, and the PCR products after amplification are detected by agarose gel electrophoresis, and the qualified PCR products are sequenced; The sequencing results are compared and analyzed in a database, and a species evolution tree is constructed to determine the species of the microorganisms.

2. The method according to claim 1, wherein the method is characterized by, In step S1, the sampling area is selected from natural growth areas and artificial planting areas of bamboo species eaten by giant pandas; The sampling method comprises the following steps: S11. Four sample lines are arranged in each sampling area, the sample lines are distributed from low altitude to high altitude, the distance between the sample lines is not less than 200 m and is approximately parallel, 3-5 20m*20m investigation sample areas are arranged on each sample line at intervals, the altitude distance between adjacent sample areas on the same sample line is not less than 50 m, and 1m*1m bamboo sample areas are arranged at the center point of each investigation sample area and 5m east and south of the center point; S12. Bamboo leaf samples are collected in the bamboo sample areas, the sampling time is in the early morning of April-May and October-November when the dew on the surface of the bamboo leaves has not completely evaporated, and the collected bamboo leaf samples are stored in a low-temperature state immediately after sampling.

3. The method of claim 1, wherein the method is characterized by, In step S3, the carbon-nitrogen ratio of the solid culture medium and the liquid culture medium is (20:1)-(30:1).

4. The method of claim 1, wherein the method is characterized by, In step S3, the bamboo leaf extract is an extract treated by a composite resin; the composite resin comprises modified macroporous adsorption resin, Zn-MOFs, modified ACF-CNT composite material, imino diacetic acid type chelating resin, and modified strong alkaline anion exchange resin; The modified macroporous adsorption resin is obtained by grafting polyaniline and PEG on macroporous resin; The modified ACF-CNT composite material is obtained by modifying ACF-CNT composite material by KH-560 and grafting zwitterionic polymer; The modified strong alkaline anion exchange resin is obtained by grafting PEG on strong alkaline anion exchange resin.

5. The method according to claim 4, wherein the method is characterized by, The modified macroporous adsorption resin is further modified by 3-aminopropyl triethoxysilane.

6. The method according to claim 4, wherein the method is characterized by, In the modified ACF-CNT composite material, PEG is further introduced between KH-560 and zwitterionic polymer.

7. A method for obtaining bamboo leaf microorganisms from the staple food of giant pandas according to any one of claims 5-7, characterized in that, The composite resin comprises modified macroporous adsorption resin, Zn-MOFs, modified ACF-CNT composite material, imidodiacetic acid type chelating resin, and modified strong basic anion exchange resin, wherein the mass ratio of each component in the composite resin is as follows: modified macroporous adsorption resin: Zn-MOFs: modified ACF-CNT composite material: imidodiacetic acid type chelating resin: modified strong basic anion exchange resin = (40-50):(20-30):(20-30):(8-15):(5-10).

8. The method according to claim 7, wherein the method is characterized by, The mass ratio of each component in the composite resin is as follows: Modified macroporous adsorption resin: Zn-MOFs: modified ACF-CNT composite material: imidodiacetic acid type chelating resin: modified strong basic anion exchange resin = 45:25:25:10:

7.

9. The method according to claim 3, wherein the method is characterized by, The macroporous resin in the modified macroporous adsorption resin is AB-8 type styrene macroporous adsorption resin, and the strong basic anion exchange resin in the modified strong basic anion exchange resin is 201x7 type anion exchange resin.

Images