Lactobacillus rhamnosus JWS01 and application thereof in preparation of viable bacterium type probiotic beverage

By screening out Lactobacillus rhamnosus JWS01, which has strong acid resistance, and combining it with other probiotics to ferment pineapple, the problems of easy spoilage and poor resistance to gastric acid in liquid live probiotic products have been solved. This has resulted in the production of a highly efficient pineapple fermented beverage with a long shelf life, suitable for a wide range of consumers.

CN120905075APending Publication Date: 2025-11-07GUANGDONG YUEHAO BIOTECHNOLOGY (QINGYUAN) CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511111390.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-08
Publication Date
2025-11-07

AI Technical Summary

Technical Problem

Existing liquid live probiotic products are prone to spoilage and have a short shelf life. Furthermore, many probiotics cannot withstand stomach acid to reach the intestines. The market lacks strains with good acid resistance and high yield of functional components from fermented pineapple. Therefore, fermented pineapple drinks are not suitable for the elderly and children.

Method used

Lactobacillus rhamnosus JWS01, which has good acid resistance, was screened from breast milk and fermented with other probiotics in fruits and vegetables such as pineapple to produce high levels of functional substances such as γ-aminobutyric acid, vitamin B1, and phenyllactic acid, forming an acidic protective barrier with a pH value of 2-3 to inhibit the growth of miscellaneous bacteria.

Benefits of technology

The prepared live probiotic beverage has a high survival rate in the gastrointestinal tract, a long shelf life, is not easily spoiled, and has significant antibacterial and health benefits, making it suitable for a wide range of consumers.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120905075A_ABST
    Figure CN120905075A_ABST
Patent Text Reader

Abstract

The invention provides a lactobacillus rhamnosus JWS01 strain and an application of the lactobacillus rhamnosus JWS01 strain in preparation of a viable bacterium type probiotic beverage. The lactobacillus rhamnosus JWS01 is preserved in Guangdong Microbial Culture Collection Center on July 4, 2025, and the preservation number of the lactobacillus rhamnosus JWS01 is GDMCC (China General Microbiological Culture Collection Center) NO: 66639. The strain is good in acid resistance and capable of resisting gastric acid, the amount of viable bacteria entering intestinal tracts after drinking is high, functional substances are generated by fermenting fruits and vegetables such as pineapples, gamma-aminobutyric acid (GABA), vitamin B1 and phenyllactic acid are high in yield, functional enzymes such as superoxide dismutase (SOD) can also be generated in the liquid fermentation process, and a good health-care effect is achieved; the viable bacterium type beverage produced by the bacterium is rich in taste, has the pH value of about 2-3, is easier to preserve and unlikely to deteriorate compared with the existing liquid viable bacterium beverage, can be preserved for half a year at low temperature, and has important value.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of probiotic food. More particularly, it relates to a strain of Lactobacillus rhamnosus GG (Lactobacillus rhamnosus GG) Lacticaseibacillus rhamnosus ) JWS01 and its application in preparing live probiotic beverage. BACKGROUND

[0002] Lactobacillus rhamnosus (Lactobacillus rhamnosus) Lactobacillus rhamnosus ) is mainly present in the intestines of humans and animals, and is a non-toxic and side-effect-free probiotic bacteria. Its functional characteristics mainly include regulating intestinal flora, preventing and treating diarrhea, expelling toxins, and enhancing immune function, and it has high application value and meets the basic needs of modern human health care. Therefore, it is mainly applied to sour milk products, and is also widely used in cheese, infant food, various fruit juices and beverages, and medicines in many fields. The National Health Commission released the "List of Bacteria for Food" and the "List of Bacteria for Infant Food" update announcement in 2022, renaming Lactobacillus rhamnosus (Lactobacillus rhamnosus) Lactobacillus rhamnosus ) to Lactobacillus rhamnosus GG (Lactobacillus rhamnosus GG) Lacticaseibacillus rhamnosus ).

[0003] Live probiotic products, especially lactic acid bacteria beverages, are sweet and sour in taste, and also have the health care effect of maintaining and repairing intestinal health, and are deeply loved by people. At present, most of the live probiotic products are powdery, and there are few liquid products, because liquid products are not easy to store, are prone to spoilage, and the shelf life of the filled product is at most 60 days, and after a long time of storage, the probiotics have basically died. For example, the shelf life of probiotic beverages on the market is mostly 30 days. Moreover, the viable count of many products does not meet the standard, and in order to extend the shelf life, high-temperature sterilization process (such as conventional 60-85℃ pasteurization) is often used, and probiotics with poor heat resistance are often killed together. In addition, many probiotics are difficult to escape the "torture" of gastric acid, and the pH value of gastric acid can reach 1.5~3, and many probiotics cannot "survive" to reach the intestine.

[0004] In addition, pineapple is a common fruit in southern China, mainly cultivated in Hainan, Fujian and other provinces, and is one of the four famous fruits in Lingnan. The fruit is attractive and rich in dietary fiber, vitamins and other nutrients. Producing beverages with pineapple as raw material is a major direction of the pineapple industry. For example, pineapple beer is a low-alcohol fruit beer made from pineapple, malt and rice through fermentation process. It has a unique flavor and is deeply loved by people, especially in the southern region of China, it has a significant market influence. However, this product is not suitable for the elderly, children and people who cannot drink alcohol. Therefore, the development of non-alcoholic pineapple fermented beverages will have a better market, and it is also of great significance to the pineapple planting related industry. SUMMARY

[0005] This invention aims to explore a high-yield fermentation bacterium capable of fermenting fruits and vegetables such as pineapple to produce functional components, resistant to stomach acid. This invention screens and domesticates a strain of *Lactobacillus rhamnosus* from breast milk that is resistant to stomach acid and produces high yields of functional components from pineapple. The pH value of pineapple fermented with this bacterium can reach 2-3, making it easy to preserve and less prone to spoilage.

[0006] The purpose of this invention is to provide a strain of Lactobacillus rhamnosus (Lactobacillus casei). Lacticaseibacillus rhamnosus JWS01 and its inoculants.

[0007] Another objective of this invention is to provide the application of Lactobacillus rhamnosus JWS01 in the preparation of live probiotic beverages.

[0008] Another objective of this invention is to provide a live probiotic beverage.

[0009] The above-mentioned objective of this invention is achieved through the following technical solution: This invention studies and isolates a strain of Lactobacillus rhamnosus derived from breast milk. Lacticaseibacillus rhamnosus JWS01 was deposited at the Guangdong Provincial Center for Microbial Culture Collection on July 4, 2025, with accession number GDMCC NO: 66639.

[0010] This bacterium exhibits good acid resistance, including stomach acid, and produces a high number of live bacteria in the intestines after consumption, making it highly valuable for fermentation in food preparation. Therefore, this invention seeks to protect this bacterium, probiotic combinations containing it, probiotic products, and their fermentation broth.

[0011] Specifically, the present invention provides a probiotic combination containing *Lactobacillus rhamnosus* JWS01, and any or more of *Bifidobacterium adolescentis*, *Lactobacillus plantarum*, *Lactobacillus acidophilus*, *Lactobacillus casei*, and *Lactobacillus delbrueckii* subsp. bulgaricus.

[0012] Specifically, each strain is combined in a mass ratio of (1-2):(1-2) (optimal 1:1, but can fluctuate within the normal range).

[0013] As an optional preferred embodiment, the probiotic combination contains Lactobacillus rhamnosus JWS01 and Bifidobacterium adolescentis.

[0014] Preferably, the mass ratio of Lactobacillus rhamnosus JWS01 to Bifidobacterium adolescentis is (1-2):(1-2).

[0015] More preferably, the mass ratio of Lactobacillus rhamnosus JWS01 to Bifidobacterium adolescentis is 1:1.

[0016] The present invention provides a probiotic fermentation broth, which is the fermentation broth of the above-mentioned Lactobacillus rhamnosus JWS01 or the above-mentioned probiotic combination.

[0017] The present application also provides a bacterial agent containing the above-mentioned Lactobacillus rhamnosus JWS01 or the above-mentioned probiotic combination.

[0018] The present application also provides a bacterial agent containing the above-mentioned fermentation liquor.

[0019] And the bacteria ferment fruits and vegetables such as pineapples to produce functional substances such as gamma-aminobutyric acid (GABA), vitamin B1, phenyllactic acid, and the like, at a high yield, and functional enzymes such as superoxide dismutase (SOD) are also produced in the process of liquid fermentation, which have good health care effects; the live bacteria type beverage produced by the bacteria not only has a pH value of about 2-3, but also has good bacteriostatic effects of phenyllactic acid, is easier to store and less likely to deteriorate than existing liquid live bacteria beverages, and has important value.

[0020] Therefore, the present application also claims the use of the above-mentioned Lactobacillus rhamnosus JWS01 or the above-mentioned probiotic combination or the above-mentioned fermentation liquor or the above-mentioned bacterial agent in the preparation of a live bacteria type probiotic beverage.

[0021] Specifically, the present application provides a live bacteria type probiotic beverage containing the above-mentioned Lactobacillus rhamnosus JWS01 or the above-mentioned probiotic combination or the above-mentioned fermentation liquor or the above-mentioned bacterial agent; or prepared by fermentation of the above-mentioned Lactobacillus rhamnosus JWS01 or the above-mentioned probiotic combination or the above-mentioned bacterial agent.

[0022] More specifically, the present application provides a live bacteria type probiotic beverage prepared from components containing the following components by weight: probiotics 30-80 parts, prebiotics 1-5 parts, fruits and vegetables 150-200 parts, sugar 50-100 parts, edible salt 1-10 parts, and water 650-800 parts; the probiotics are the above-mentioned Lactobacillus rhamnosus JWS01 or the above-mentioned probiotic combination.

[0023] As an alternative embodiment, the above-mentioned live bacteria type probiotic beverage is prepared from components containing the following components by weight: probiotics 40-60 parts, prebiotics 1-5 parts, fruits and vegetables 160-190 parts, sugar 70-90 parts, edible salt 3-7 parts, and water 700-750 parts; the probiotics are the above-mentioned Lactobacillus rhamnosus JWS01 or the above-mentioned probiotic combination.

[0024] As an alternative embodiment, the above-mentioned live bacteria type probiotic beverage is prepared from components containing the following components by weight: probiotics 50 parts, prebiotics 3 parts, fruits and vegetables 180 parts, sugar 87 parts, edible salt 5 parts, and water 726 parts; the probiotics are the above-mentioned Lactobacillus rhamnosus JWS01 or the above-mentioned probiotic combination.

[0025] Preferably, the prebiotics are selected from the group consisting of fructooligosaccharides, galactooligosaccharides, xylooligosaccharides, isomaltooligosaccharides, soybean oligosaccharides, and inulin.

[0026] Optionally, the fruits and vegetables are selected from any one or more of pineapple, apple, grape, lemon, orange, carrot, cucumber.

[0027] Optionally, the sugar is any one or more of brown sugar, white sugar, syrup.

[0028] As an alternative embodiment, the edible salt is sea salt.

[0029] As an alternative embodiment, the above-mentioned live probiotic drink is prepared from components comprising: 30-80 parts of probiotics, 1-5 parts of prebiotics, 150-200 parts of fruits and vegetables, 50-100 parts of sugar, 1-10 parts of edible salt, 1-5 parts of edible essence, 650-800 parts of water; the probiotics are the above-mentioned Lactobacillus rhamnosus JWS01 or the above-mentioned probiotic combination.

[0030] As an alternative embodiment, the above-mentioned live probiotic drink is prepared from components comprising: 40-60 parts of probiotics, 1-5 parts of prebiotics, 160-190 parts of fruits and vegetables, 70-90 parts of sugar, 3-7 parts of edible salt, 1-3 parts of edible essence, 700-750 parts of water; the probiotics are the above-mentioned Lactobacillus rhamnosus JWS01 or the above-mentioned probiotic combination.

[0031] As an alternative embodiment, the above-mentioned live probiotic drink is prepared from components comprising: 50 parts of probiotics, 3 parts of prebiotics, 180 parts of fruits and vegetables, 77 parts of sugar, 5 parts of edible salt, 2 parts of edible essence, 726 parts of water; the probiotics are the above-mentioned Lactobacillus rhamnosus JWS01 or the above-mentioned probiotic combination.

[0032] The present application has the following beneficial effects: The present application obtains a Lactobacillus rhamnosus JWS01 from breast milk. Lacticaseibacillus rhamnosus The experiment proves that the bacteria have good acid resistance and can resist gastric acid, and the amount of live bacteria entering the intestinal tract after drinking is high, and the strain can efficiently generate a variety of functional metabolites, including gamma-aminobutyric acid (GABA), vitamin B1, phenyllactic acid, during the fermentation of fruits and vegetables such as pineapple, with a high yield.

[0033] The live bacteria type probiotic beverage prepared by the strain can not only be stably maintained at pH 2-3 after fermentation to form a natural acid protective barrier, but also help the survival of probiotics in the gastrointestinal tract; the benzyl lactic acid produced by the lactic acid bacteria is rich in the product and has a significant bacteriostatic effect, which can effectively inhibit the growth of miscellaneous bacteria, thereby significantly improving the microbial stability of the product. Compared with existing liquid live bacteria beverages, the product is easier to store, less likely to deteriorate, has a longer shelf life, has outstanding application value and broad market prospects. BRIEF DESCRIPTION OF DRAWINGS

[0034] Figure 1 The colony morphology of Lactobacillus rhamnosus JWS01 in a culture medium plate culture.

[0035] Figure 2 The phylogenetic tree of Lactobacillus rhamnosus JWS01.

[0036] Figure 3 The lactic acid bacteria detection analysis result of the live bacteria type probiotic beverage fermented by the probiotic combination (page 1).

[0037] Figure 4 The lactic acid bacteria detection analysis result of the live bacteria type probiotic beverage fermented by the probiotic combination (result page). DETAILED DESCRIPTION

[0038] The present application will be further described below in combination with the drawings of the specification and specific examples, but the examples do not limit the present application in any form.

[0039] Unless otherwise specified, the reagents, methods and equipment used in the present application are conventional reagents, methods and equipment in the technical field.

[0040] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0041] The MRS liquid medium used in the following experiments: hydrolyzed casein 10 g / L, beef extract powder 10 g / L, yeast powder 4.0 g / L, ammonium citrate 2.0 g / L, sodium acetate 5.0 g / L, magnesium sulfate heptahydrate 0.2 g / L, manganese sulfate heptahydrate 0.05 g / L, potassium phosphate dibasic 2.0 g / L, glucose 20 g / L, Tween-80 1.08 g / L. pH: 5.7.

[0042] MRS solid culture medium: add 15 g of agar powder to 1 L of MRS liquid medium.

[0043] Bifidobacterium adolescentis is commercially available Bifidobacterium adolescentis CICC®6178, purchased from China Industrial Microbial Culture Collection Center, and the strain preservation number is CICC 6178.

[0044] In the following examples, the GABA content determination method is referred to the reference Liu Zongle, Gao Linsen, Zhang Dongdong, Han Junhua, Zhao Juanjuan, Gao Wenhui. Determination of γ-aminobutyric acid in lactic acid bacteria fermentation broth by high performance liquid chromatography [J]. China Brewing, 2022, 41(11): 233-238.

[0045] The test method of phenyllactic acid content is referred to the reference Zhang Wen, Lin Yikant, Xie Jiayu, et al. A method for determining phenyllactic acid in lactic acid bacteria fermentation broth by reversed-phase high performance liquid chromatography and its evaluation [J]. Food Industry Science and Technology, 2020(023): 041.

[0046] The detection method of vitamin B1 is referred to the reference Chang Ruoyi, Lv Jiaolu, Yu Fang. Research on the production of vitamins B1 and B6 by lactic acid bacteria fermentation [J]. China Condiment, 2018, 43(2): 4-711.

[0047] The method for determining the number of live bacteria in probiotic drinks is referred to the lactic acid bacteria counting method in the National Standard of the People's Republic of China GB4789.35-2023.

[0048] Example 1 Isolation of gastric acid-resistant strains I. Sample source In October 2024, breast milk samples were collected from volunteers at a certain maternal center in Qingyuan City, Guangdong Province.

[0049] II. Isolation and purification of strains (1) Primary enrichment culture Take the breast milk sample, add breast milk to the MRS liquid medium at a mass ratio of 1:100, shake well, and incubate at 37°C for 48 hours to obtain the initial bacterial solution.

[0050] (2) Primary acclimation Take 1 mL of the bacterial solution obtained in step (1) and inoculate it into MRS liquid medium with gradient pH (pH 5, 4, 3, 2, and 1, respectively) for acclimation culture. Finally, the obtained bacterial solution was cultured in MRS liquid medium with pH 1, and then plated on MRS solid medium plate and incubated at 37°C for 48 hours. Typical single colonies were picked (multiple repeats were picked), and the plate was streaked and purified repeatedly. Gram-positive strains were selected; the selected multiple strains were then cultured in MRS liquid medium at 37°C for 24 hours.

[0051] (3) Secondary acclimation Take 1 mL of the bacteria solution obtained in step (2) and inoculate it into MRS liquid medium containing different concentrations of pineapple juice (pineapple juice concentrations are 5%, 10%, 20%, and 30% by volume, respectively, and the pineapple juice is obtained by washing, peeling, juicing, and sterilizing fresh pineapples). Finally, the obtained bacteria solution is cultured in MRS liquid medium containing 30% pineapple juice, and then it is spread on MRS solid medium plates and cultured at 37°C for 48 hours. Typical Lactobacillus colonies are picked and inoculated into MRS solid medium for streak purification. After purification, multiple single colonies are picked and inoculated into MRS liquid medium, which is cultured at 37°C for 48 hours. The 30% glycerol is stored in a -80°C ultra-low temperature freezer.

[0052] After multiple rounds of domestication as described above, a total of 10 morphologically stable single colony strains are obtained, which are numbered a, b, c, d, e, f, g, h, i, and j, respectively.

[0053] III. Screening of strains by simulated gastric acid resistance experiment Resisting gastric acid environment and maintaining activity are prerequisites for probiotics to successfully reach the intestinal tract, and are the primary key factors for live probiotic products. Therefore, the gastric acid resistance performance is used as the first indicator for strain screening.

[0054] Preparation of simulated gastric juice: simulated gastric juice containing 0.1 mol / L HCl and 0.3% pepsin by mass ratio, pH = 1, and sterilized.

[0055] Gastric acid resistance experiment method: the stored strains a-j are taken out from -80°C, inoculated into MRS liquid medium, and cultured at 37°C for 24 hours. The bacteria solution at the late logarithmic growth phase (OD 600= 0.6-0.8) is used as the inoculum. 1 mL of the inoculum of each of the 10 strains a-j (concentration of 1.0 x 10 8 CFU / mL) is mixed with 9 mL of artificial gastric juice and incubated at 37°C in an anaerobic state. Samples are taken at 0, 3, and 6 hours, respectively. The viable cell count is determined by plate counting method, and the survival rate is calculated. The survival rate formula is as follows: ; In the formula, Ni is the viable cell count at the corresponding determination time, and N0 is the initial viable cell count at 0 h.

[0056] The experimental results are shown in Table 1. The results show that after 3 hours of culture in simulated gastric juice, the survival rates of most strains decrease significantly. The 6-hour survival rates of strains b, c, e, f, i, and j are all lower than 50%, indicating that their acid resistance is weak. In contrast, strains a, d, g, and h exhibit excellent acid resistance, with 6-hour survival rates higher than 75%. Among them, strain g has the most outstanding acid resistance, with a 6-hour survival rate of 90.5%.

[0057] The strains a, d, g, and h with excellent gastric acid resistance were selected as candidate strains for further study.

[0058] Table 1 Survival rate of each strain in simulated gastric acid environment

[0059] Example 2 Screening of JWS01 strain I. Screening of γ-aminobutyric acid (GABA), phenyllactic acid, and vitamin B1 production ability Example 1 After screening by the first indicator of gastric acid resistance, strains a, d, g, and h with excellent gastric acid resistance were obtained.

[0060] γ-aminobutyric acid (GABA) is a four-carbon non-protein amino acid that is an important inhibitory neurotransmitter widely present in vertebrates, plants, and microorganisms. Numerous studies have shown that GABA has the effects of lowering blood pressure, improving sleep, improving liver, kidney, and brain function, increasing food flavor, skin moisturizing, and antioxidant, and has been widely used in food with high safety. Therefore, the GABA production ability was used as the second indicator for strain screening in this study.

[0061] Phenyllactic acid is a natural small molecule organic acid produced by microorganisms such as lactic acid bacteria, which has multiple antibacterial mechanisms and broad-spectrum antibacterial properties. Moreover, the pH stability and thermal stability of this substance are superior to traditional preservatives, making it a high-safety biological preservative for food. Therefore, the phenyllactic acid production ability was used as the third indicator for strain screening in this study.

[0062] Vitamin B1 (also known as thiamine) is a water-soluble vitamin and one of the essential nutrients for the human body. It plays an important role in various physiological processes, especially in energy metabolism and nervous system function. Therefore, the vitamin B1 production ability was used as the fourth indicator for strain screening in this study.

[0063] II. Test method The preserved strains a-j were recovered from -80°C, inoculated in MRS liquid medium, and cultured at 37°C for 24 hours. The bacterial solution at the late logarithmic growth phase (OD 600= 0.6-0.8) was used as the inoculum. 1 mL of the inoculum of strains a, d, g, and h (bacterial solution concentration: 1.0 × 10 8 CFU / mL) was inoculated in 49 mL of MRS liquid medium containing 10% (v / v) pineapple juice (inoculation ratio: 2% v / v), and fermented at 37°C for 72 h. The γ-aminobutyric acid (GABA), phenyllactic acid, and vitamin B1 contents in the MRS liquid medium were measured before and after inoculation.

[0064] 1. GABA content determination method (high performance liquid chromatography) (1) Preparation of standard solution Preparation of GABA standard solution: accurately weigh 10.0 mg of GABA standard into a 10 mL volumetric flask, dissolve with water, dilute to volume, obtain a stock solution with a mass concentration of 1.00 mg / ml, and sequentially dilute to 0.05 μg / mL, 0.1 μg / mL, 3 μg / mL, 50 μg / mL, 100 μg / mL, 250 μg / mL, 400 μg / mL and 500 μg / ml, and store at 0~4 ℃ for standby.

[0065] Preparation of boric acid buffer solution: weigh 2.47 g of boric acid into 85 mL of water, adjust pH to 10.4 with sodium hydroxide, dilute to 100 mL, and store at 0~4 ℃ for 7 days.

[0066] Preparation of OPA derivative solution: accurately weigh 5.0 mg of OPA, ultrasonically dissolve in 2.5 mL of acetonitrile, then add 10 μL of B-mercaptoethanol, and store at 0~4 ℃ in the dark for 7 days.

[0067] (2) Chromatographic conditions Chromatographic column: XBridge C18 chromatographic column (4.6 mm × 250 mm, 5 μm); Detector: diode array detector (DAD), detection wavelength is 228 nm; Mobile phase: acetonitrile: 20 mmol / L crystalline sodium acetate solution = 21:79 (V / V); Flow rate: 0.8 mL / min; Column temperature: 30 ℃; Injection volume: 20 μL.

[0068] (3) Sample pretreatment Centrifuge 1 mL of fermentation broth at 10000 × g for 10 min, pass the supernatant through a 0.22 μm organic filter membrane to obtain a sample solution.

[0069] (4) Pre-column derivatization operation and detection Take 400 μL of boric acid buffer solution, 80 μL of OPA derivative solution, and 80 μL of GABA standard solution or sample solution, mix, and then derivatize for 5 min, pass through a 0.22 μm organic filter membrane, wash the needle, and then inject the derivatized solution into the liquid chromatograph, detect and analyze according to the chromatographic conditions of the method, and detect the GABA content.

[0070] 2. Phenyllactic acid content test method (high performance liquid chromatography) (1) Solution preparation Phenyllactic acid standard stock solution preparation: accurately weigh 0.01 g of phenyllactic acid into a 10 mL volumetric flask, dissolve with water, and dilute to volume to obtain a 100 mg / L standard stock solution, store at 4°C in the dark. Take an appropriate amount of standard stock solution, dilute with water to obtain standard working solutions with concentrations of 0.2, 0.4, 0.8, 1.0, 2.0, and 5.0 mg / mL, respectively, for HPLC analysis.

[0071] (2) Chromatographic analysis conditions Chromatographic column: Agilent Eclipse XDB-C chromatographic column (4.6 mm x 250 mm, 5 um, double-sealed chromatographic column); Detector: ultraviolet detector, detection wavelength 210 nm; Mobile phase: 0.05% TFA-acetonitrile, 0.05% TFA: acetonitrile = 75:25 (V / V); TFA is trifluoroacetic acid; Flow rate 1 m / min; Column temperature 30°C; Injection volume 10 μL.

[0072] (3) Sample pretreatment Take 1 mL of fermentation supernatant (obtained by centrifugation at 10,000 x g for 10 min), pass the obtained supernatant through a 0.22 μm organic filter membrane to obtain a sample solution.

[0073] Inject the sample solution into the liquid chromatograph, and detect and analyze the content of phenyllactic acid according to the chromatographic conditions of the method.

[0074] 3. Test method for vitamin B1 content (high performance liquid chromatography) (1) Preparation of standard stock solution Accurately weigh the vitamin B1 standard into a volumetric flask, dissolve with 0.1 mol / L hydrochloric acid and dilute to volume to obtain a vitamin B1 standard stock solution with a mass concentration of 1 g / L.

[0075] (2) Chromatographic conditions Chromatographic column: C18 (with ultraviolet detector), mobile phase: 0.05 mol / L KH2PO4 (pH 6.0)-methanol (volume ratio 85:15), flow rate: 1.0 mL / min, column temperature: 30°C, wavelength: 265 nm, injection volume: 20 μL.

[0076] (3) Preparation of standard curve Prepare vitamin B1 standard solutions with mass concentrations of 10, 20, 30, 40, and 50 mg / L, respectively, and inject to obtain the linear relationship between the peak area A of vitamin B1 and the mass concentration C (mg / L) according to the chromatographic conditions.

[0077] (4) Sample processing Take 5 mL of fermentation broth and add 40 mL of 0.1 mol / L hydrochloric acid and mix uniformly by ultrasonic. Then use 0.1 mol / L hydrochloric acid to make up to 50 mL, mix uniformly by ultrasonic, and then stand, centrifuge, and take the supernatant to obtain the extraction solution of vitamin B1. The sample solution is injected into the liquid chromatograph, and the content of vitamin B1 is detected and analyzed according to the chromatographic conditions of the method.

[0078] III. Experimental results The experimental results are shown in Table 2, and the results show that GABA, phenyllactic acid and vitamin B1 are not detected in the culture medium before fermentation of all strains, indicating that GABA, phenyllactic acid and vitamin B1 are derived from the fermentation broth of the bacterial strain rather than the culture medium itself.

[0079] The four candidate strains all have the ability to synthesize GABA, among which strain a has the highest yield, reaching 950 μg / mL, which is significantly higher than that of other strains. In terms of phenyllactic acid production, strain g performs best, reaching 260 μg / mL. There is no significant difference in the production of vitamin B1 among the four strains.

[0080] In summary, strain a has the most advantages in GABA production, and also has stable vitamin B1 production capacity; although its phenyllactic acid production is slightly lower than that of d and h, it is still at a high level (230 μg / mL), and has good comprehensive functional potential. Combined with the results of the gastric acid resistance experiment in Table 1 (the survival rate of strain a at 6 hours is 88.6%), it not only has excellent gastric acid resistance, but also performs best in the production of key functional metabolites GABA. Therefore, the superior functional strain a is finally selected as the target strain, named JWS01. The strain produces phenyllactic acid at a concentration of about 230 mg / L, which is sufficient to provide antibacterial and preservative effects, but far from reaching the level that completely inhibits the growth of lactic acid bacteria (usually the concentration needs to reach more than 1000 mg / L to have obvious inhibitory effect on lactic acid bacteria).

[0081] Table 2: Contents of GABA, phenyllactic acid and vitamin B in fermentation broth of each group

[0082] Note: ND means not detected (below the detection limit); data is the average value ± standard deviation of three independent experiments.

[0083] Example 3: Identification of strain JWS01 (1) Morphological characteristics The colony morphology of strain JWS01 cultured on MRS medium plate is as follows: Figure 1White, opaque, round, smooth, moist, regular, raised in the center. Gram stain is typically positive. Microscopic observation of cells as long rods, non-flagellated, non-motile.

[0084] (2) Molecular identification Strain JWS01 was sequenced for 16S ribosomal RNA. The primers used were universal primers 27F / 1492R.

[0085] 27F: AGAGTTTGATCCTGGCTCAG 1492R: GGTTACCTTGTTACGACTT PCR amplification system: 2 × Rapid Taq Master Mix (Novozyme) 10 μL, primer 27F 0.5 μL, primer 1492R 0.5 μL, test bacteria solution 1 μL, ddH2O 8 μL.

[0086] PCR amplification reaction conditions: 95°C for 3 min; 30 cycles (95°C for 15 s; 50°C for 30 s; 72°C for 2 min).

[0087] The PCR amplification product was sequenced by Guangzhou Genes Co., Ltd.

[0088] The obtained sequence was compared with the sequence with high homology downloaded from NCBI, and the sequencing alignment result showed that strain JWS01 had the highest similarity of 99.2% with Lactobacillus rhamnosus. Lacticaseibacillus rhamnosus The phylogenetic tree was constructed as shown in Figure 2 .

[0089] Combined with morphology and molecular identification, strain JWS01 was identified as Lactobacillus rhamnosus. Lacticaseibacillus rhamnosus It was preserved in the Guangdong Microbial Culture Collection Center on July 4, 2025, with the preservation number GDMCC NO: 66639.

[0090] Example 4: Live probiotic drink fermented by Lactobacillus rhamnosus JWS01 I. Raw material formula (by mass) The raw material formula of the probiotic drink is shown in Table 3. Except for the probiotic bacteria (Lactobacillus rhamnosus JWS01), all raw materials need to be sterilized before use and cooled for standby.

[0091] Table 3 Raw material formula

[0092] Note: Half of the purified water (i.e. 363 kg) is used for heating and dissolving the syrup and brown sugar, and the remaining 363 kg is used for mixing and preparing the fermentation substrate.

[0093] II. Preparation method of live probiotic beverage The specific steps of the preparation method of the live probiotic beverage of this embodiment are as follows: S1. Pineapple pretreatment and sugar solution preparation S11. Pineapple treatment: select fresh pineapples (180 kg), peel and cut into pieces of about 5-8 cm x 5-8 cm; then mix the pineapple pieces with fructooligosaccharides (3 kg), food flavoring (2 kg), and sea salt (5 kg), and perform infrared sterilization; S12. Sugar solution preparation: add brown sugar (70 kg) and syrup (17 kg) to half of the purified water (363 kg) according to the formula, heat to above 90°C, continuously stir until completely dissolved, keep warm for 10 minutes, cool to 30°C, and then reserve; S2. Fermentation substrate preparation Pour the sugar solution and the remaining purified water (363 kg) into the ingredient tank, stir evenly, then add the pineapple pieces, and mix at low speed to form the fermentation substrate; S3. Strain activation and inoculation The activated seed solution of probiotics (concentration of 1.9 x 10 9 CFU / mL) is inoculated into the fermentation substrate at a ratio of 5% (v / v) with sterile operation, and stirred evenly; S4. Constant temperature fermentation Transfer the inoculated fermentation substrate to the constant temperature fermentation tank, and perform anaerobic fermentation at 30°C. Stir every 5 days in the first month of fermentation, and stir every 10 days in the second month of fermentation. The stirring time is 10 minutes each time. Monitor the fermentation progress through an online pH meter. Stop fermentation when the pH value drops to 2.6 (this process usually lasts about 60 days), and obtain the fermented beverage.

[0094] III. Quality detection of probiotic beverage According to GB4789.35-2023, the viable cell count in the probiotic beverage is determined. According to the method in Example 2, the contents of GABA, phenyl lactic acid, and vitamin B in the live probiotic beverage are detected. The results show that in the obtained live probiotic beverage, the content of GABA is 1280 mg / L, the content of phenyl lactic acid is 330 mg / L, the content of vitamin B is 45 mg / L, the viable cell count is 2.1 x 10 9 CFU / mL, and the pH value is 2.6.

[0095] IV. Beverage shelf life test To evaluate the long-term storage performance of the product, the obtained live bacteria type probiotic beverage was aseptically filled and sealed, and stored at 4°C for cold preservation. The survival rate of the probiotic bacteria in the beverage was determined at 0 day, 1 month, 2 months, 3 months, 4 months, 5 months and 6 months after filling, respectively. Plate counting method was used to determine the number of live bacteria and calculate the survival rate (retain the integer). A certain brand of probiotic beverage purchased on the market was used as a control group, and the same conditions were used for storage and detection.

[0096] The survival rate formula is as follows: ; In the formula, Ni is the number of live bacteria at the corresponding determination time; N0 is the initial number of live bacteria at 0 day.

[0097] The experimental results are shown in Table 4, and the results show that the probiotic beverage prepared by using Lactobacillus rhamnosus JWS01 in the present application exhibits excellent live bacteria stability under 4°C cold storage conditions. Even after 6 months of storage, the survival rate of the probiotic bacteria is as high as 56%, which is significantly better than the commercially available control product (no live bacteria were detected after 6 months). This indicates that Lactobacillus rhamnosus JWS01 has excellent acid and storage resistance properties, and the prepared beverage has a long shelf life and stable and reliable product quality.

[0098] Table 4 Survival rate of probiotic bacteria in the product after storage

[0099] Example 5 Live bacteria type probiotic beverage fermented by probiotic bacteria combination Compared with Example 4, the probiotic bacteria in the raw materials were replaced by a combination of Lactobacillus rhamnosus JWS01 and Bifidobacterium adolescentis (recorded as probiotic bacteria combination liquid) with a mass ratio of 1:1 (probiotic bacteria combination liquid), and other conditions were the same to produce the probiotic beverage.

[0100] I. Preparation of live bacteria type probiotic beverage The formula of the live bacteria type probiotic beverage of the present example is shown in Table 5. The live bacteria type probiotic beverage was prepared according to the raw material formula of Table 5, and the preparation method was the same as that of Example 4, except that the probiotic bacteria in the raw materials were replaced by the probiotic bacteria combination liquid of the present example.

[0101] Table 5 Raw material formula

[0102] II. Quality detection of probiotic beverage The number of viable bacteria in the probiotic beverage was determined, the contents of GABA, phenyllactic acid and vitamin B in the viable bacteria type probiotic beverage were determined, and the survival rate of the beverage after 6 months of cold storage at 4°C was determined according to the method of Example 5. The GABA content in the produced beverage was 1350 mg / L, the phenyllactic acid content was 320 mg / L, the vitamin B content was 42 mg / L, the number of viable bacteria was 2.2 x 10 9 CFU / mL, and the pH of the product was 2.8. Moreover, after 6 months of cold storage at 4°C, the survival rate of the probiotic bacteria was still 56%.

[0103] In addition, the number of viable bacteria in the probiotic beverage after cold storage was determined by the Guangdong Provincial Microbial Analysis and Detection Center, and the results are shown in Table 6 and Figure 3 and Figure 4 The results show that the content of Lactobacillus in the probiotic beverage is still 1.4 x 10 4 CFU / mL, further confirming that the probiotic beverage still has a certain level of active bacteria during long-term cold storage, and has the potential to continuously exert the probiotic function.

[0104] Example 6 Fermentation of Lactobacillus rhamnosus JWS01 with other fruits and vegetables Compared with Example 4, the fruits and vegetables in the raw material were changed from pineapple to apple, grape and carrot, respectively, and the other conditions were the same to produce the probiotic beverage.

[0105] The test data of the obtained beverage are shown in Table 6: Lactobacillus rhamnosus JWS01 can grow well in the substrate containing various fruits and vegetables and successfully produce GABA. Among them, the GABA yield is the highest when grape is used as the substrate, and when apple and carrot are used as the substrate, the probiotic bacteria also show good stability and high GABA yield, indicating that the JWS01 strain has wide substrate adaptability.

[0106] Table 6 Test data of each beverage

[0107] The above examples are the preferred embodiments of the present application, but the embodiments of the present application are not limited to the above examples, and any changes, modifications, substitutions, combinations and simplifications made without departing from the spirit and principles of the present application shall be equivalent replacement methods and shall be included in the protection scope of the present application.

Claims

1. A Lactobacillus rhamnosus strain (Lactobacillus rhamnosus JWS01) characterized in that, Lacticaseibacillus rhamnosus It was preserved in Guangdong Microbial Culture Collection Center on July 4, 2025, and the preservation number is GDMCC NO: 66639. ​ 2. A probiotic combination, characterized in that, It contains the Lacticaseibacillus rhamnosus JWS01 of claim 1, and any one or several of Bifidobacterium adolescentis, Lactobacillus plantarum, Lactobacillus acidophilus, Lactobacillus casei, Lactobacillus delbrueckii subsp. bulgaricus.

3. A probiotic fermentation broth, characterized in that, It is the fermentation broth of the Lacticaseibacillus rhamnosus JWS01 of claim 1 or the probiotic combination of claim 2.

4. An inoculant characterized in that, It contains the Lacticaseibacillus rhamnosus JWS01 of claim 1 or the probiotic combination of claim 2.

5. An inoculant characterized in that, It contains the fermentation broth of claim 3.

6. The use of the Lacticaseibacillus rhamnosus JWS01 of claim 1 or the probiotic combination of claim 2 or the fermentation broth of claim 3 or the microbial agent of claim 4 or 5 in the preparation of a live bacteria type probiotic beverage.

7. A live probiotic drink, characterized in that, It contains the Lacticaseibacillus rhamnosus JWS01 of claim 1 or the probiotic combination of claim 2 or the fermentation broth of claim 3 or the microbial agent of claim 4 or 5; or is fermented from the Lacticaseibacillus rhamnosus JWS01 of claim 1 or the probiotic combination of claim 2 or the microbial agent of claim 4 or 5.

8. A live probiotic drink, characterized in that, It is made from components containing the following weight parts: probiotics 30-80 parts, prebiotics 1-5 parts, fruits and vegetables 150-200 parts, sugar 50-100 parts, edible salt 1-10 parts, water 650-800 parts; the probiotics are the Lacticaseibacillus rhamnosus JWS01 of claim 1 or the probiotic combination of claim 2.

9. The live format probiotic drink of claim 8, wherein, The prebiotics are selected from the group consisting of fructooligosaccharides, galactooligosaccharides, xylooligosaccharides, isomaltooligosaccharides, soybean oligosaccharides, or inulin.

10. The live strain probiotic drink of claim 8, wherein, The fruits and vegetables are selected from any one or several of pineapples, apples, grapes, lemons, citrus, carrots, cucumbers.