Bacterial strain with anti-allergic effect and application thereof

By using the Bacterium plantarum Biohalo12 strain, the problem of poor efficacy of existing probiotics in relieving allergic reactions has been solved, achieving rapid and significant anti-allergic effects, reducing sensitization-related antibodies and inflammatory factors, and improving immune response balance.

CN120905090APending Publication Date: 2025-11-07ZHIYU MEDICAL TECH (SHANDONG) CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511394305.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-28
Publication Date
2025-11-07

AI Technical Summary

Technical Problem

Existing probiotics are not very effective in relieving allergic reactions, and there is a lack of strains with excellent anti-allergic properties.

Method used

The microbial agent obtained by culturing Lactiplantibacillus plantarum Biohalo12 strain in culture medium was used to prepare anti-allergy products. It has anti-allergy effects, can reduce the level of sensitization-related antibodies (IgE, IgG1) and IL-4, promote the secretion of IFN-γ and IgG2a, and upregulate the expression of anti-inflammatory factor IL-10.

Benefits of technology

This strain can significantly alleviate allergy symptoms, rapidly reduce the levels of sensitization-related antibodies and inflammatory factors, and improve the balance of the immune response, with remarkable effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120905090A_ABST
    Figure CN120905090A_ABST
Patent Text Reader

Abstract

The invention discloses a bacterial strain with an anti-allergic effect and application of the bacterial strain. The bacterial strain is lactobacillus plantarum Biohalo 12, is preserved in the China General Microbiological Culture Collection Center (CGMCC), and has the preservation number of CGMCC NO.34916; the preservation time is June 16, 2025; the strain with the anti-allergic effect is obtained through screening, the strain has the anti-allergic effect, the level of sensitization-related antibodies (IgE and IgG1) and IL-4 can be reduced, secretion of IFN-gamma and IgG2a is promoted, expression of an anti-inflammatory factor IL-10 is up-regulated, then allergy symptoms can be relieved, the effect is fast, and the effect is remarkable.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of microbial technology, in particular to a strain with anti-allergy effect and application thereof. BACKGROUND

[0002] Allergy, also known as allergic reaction, is an abnormal immune response mainly manifested as symptoms such as sneezing, skin redness, and difficulty breathing. Its causes are complex and can be caused by diseases, drugs, diet, environment, and other factors. Common types of allergy can be divided into respiratory allergy (such as allergic rhinitis and asthma), skin allergy (such as urticaria and eczema), and digestive allergy (such as food protein-induced enteropathy) according to the site of occurrence. Allergy can occur at any age, but certain groups such as people with allergic constitution and those with a family history of allergy are more likely to occur. Although the mortality rate of allergy is low, severe allergic reactions caused by certain conditions can be life-threatening.

[0003] The symptoms of allergy are diverse, ranging from mild skin itching and runny nose to life-threatening symptoms such as difficulty breathing and shock. Common complications include allergic purpura and bronchial asthma. Allergy is not a contagious disease and cannot be transmitted to others through contact or droplets.

[0004] The treatment of allergy is mainly drug therapy, which can be supplemented by surgery and desensitization therapy. Common drugs include antihistamines, glucocorticoids, and leukotriene modulators. For severe allergic reactions such as anaphylactic shock, immediate first aid is required, including the use of adrenaline and fluid resuscitation. After regular treatment, the prognosis of patients is generally good, but it is prone to recurrence. The key to preventing allergy is to avoid contact with allergens such as pollen, dust mites, and certain foods. At the same time, maintaining good living habits and dietary habits can also help reduce the occurrence of allergy.

[0005] Current research shows that probiotics can alleviate allergic reactions, but different probiotics have different anti-allergy properties. Therefore, it is particularly important to provide a new probiotic with excellent anti-allergy properties. SUMMARY

[0006] The present application relates to the field of microbial technology, in particular to a strain with anti-allergy effect and application thereof.

[0007] In order to achieve the above-mentioned purpose of the present application, the following technical solutions are adopted: The first aspect of the present application provides a strain with anti-allergy effect, the strain being Lactiplantibacillus plantarum Biohalo12, deposited in the China General Microbiological Culture Collection Center on June 16, 2025, and having a deposit number of CGMCC NO.34916.

[0008] The second aspect of the present application provides a microbial inoculant containing the strain with anti-allergy effect.

[0009] Preferably, the microbial inoculant is obtained by inoculating the strain with anti-allergy effect into a culture medium and culturing.

[0010] The third aspect of the present application provides use of the strain with anti-allergy effect or the microbial inoculant in preparation of an anti-allergy product.

[0011] Preferably, the product is a pharmaceutical product or a health-care product.

[0012] The fourth aspect of the present application provides an anti-allergy product, the product comprising the strain with anti-allergy effect or the microbial inoculant.

[0013] Preferably, the viable cell count of the strain with anti-allergy effect is not less than 1×10 7 cfu / g.

[0014] Preferably, the cell count of the microbial inoculant is not less than 1×10 7 cells / g.

[0015] Compared with the prior art, the present application has at least the following beneficial effects: The strain with anti-allergy effect screened by the present application has anti-allergy effect, and can reduce the levels of sensitization-related antibodies (IgE, IgG1) and IL-4, promote the secretion of IFN-γ and IgG2a, and up-regulate the expression of anti-inflammatory factor IL-10, thereby relieving allergic symptoms, with fast effect and remarkable effect. BRIEF DESCRIPTION OF DRAWINGS

[0016] In order to more clearly illustrate the specific embodiments of the present application or the technical solutions in the prior art, the drawings needed in the specific embodiments or prior art description will be briefly introduced below. In all the drawings, similar elements or parts are generally identified by similar reference numerals. In the drawings, each element or part is not necessarily drawn according to the actual scale.

[0017] Figure 1The differences in the body weight, liver / body ratio and kidney / body ratio of the three groups of mice in the blank group, the control group and the experimental group in the embodiment of the present application are shown in the figure, (A) is the difference in the body weight of the three groups of mice in the blank group, the control group and the experimental group; (B) is the difference in the liver / body ratio of the three groups of mice in the blank group, the control group and the experimental group; (C) is the difference in the kidney / body ratio of the three groups of mice in the blank group, the control group and the experimental group; Figure 2 The relative levels of OVA-specific IgE, IgG1 and IgG2a of the three groups of mice in the blank group, the control group and the experimental group in the embodiment of the present application are shown in the figure, (A) is the relative level of OVA-specific IgE of the three groups of mice in the blank group, the control group and the experimental group; (B) is the relative level of OVA-specific IgG1 of the three groups of mice in the blank group, the control group and the experimental group; (C) is the relative level of OVA-specific IgG2a of the three groups of mice in the blank group, the control group and the experimental group; Figure 3 The IFN-γ content secreted by the spleen cells of the three groups of mice under different culture conditions in the embodiment of the present application is shown in the figure, (A) is the IFN-γ concentration secreted by the spleen cells under the culture condition of not adding OVA stimulant and using RPMI1640 culture medium; (B) is the IFN-γ concentration secreted by the spleen cells under the culture condition of adding OVA OVA stimulant and using RPMI1640 culture medium.

[0018] Figure 4 The IL-4 and IL-10 contents in the bronchoalveolar lavage fluid of the three groups of mice in the embodiment of the present application are shown in the figure, (A) is the IL-4 content in the bronchoalveolar lavage fluid of the three groups of mice, (B) is the IL-10 content in the bronchoalveolar lavage fluid of the three groups of mice. DETAILED DESCRIPTION

[0019] The technical solutions of the present application will be described in detail below with reference to the embodiments. The following embodiments are only used to more clearly illustrate the technical solutions of the present application, and therefore only serve as examples, but cannot limit the protection scope of the present application.

[0020] It should be noted that, unless otherwise specified, the technical terms or scientific terms used in the present application should be understood as the usual meanings understood by the skilled person in the field to which the present application belongs.

[0021] The embodiment of the present application provides a strain with anti-allergy effect, the strain is Lactiplantibacillus plantarum Biohalo12, which is preserved in the China General Microbiological Culture Collection Center, and the preservation number is CGMCC NO.34916; the preservation time is June 16, 2025.

[0022] The strain screened by the application has an anti-allergy effect, can reduce the levels of allergy-related antibodies (IgE, IgG1) and IL-4, promote the secretion of IFN-gamma and IgG2a, and up-regulate the expression of anti-inflammatory factor IL-10, thereby relieving allergic symptoms, and has a fast effect and a remarkable effect.

[0023] Another embodiment of the application provides a microbial inoculant containing the strain with the anti-allergy effect.

[0024] In an embodiment, the microbial inoculant is obtained by inoculating the strain with the anti-allergy effect in a culture medium and culturing.

[0025] Still another embodiment of the application provides application of the strain with the anti-allergy effect or the microbial inoculant in preparation of an anti-allergy product.

[0026] In an embodiment, the product is a drug or a health product.

[0027] Still another embodiment of the application provides an anti-allergy product, which comprises the strain with the anti-allergy effect or the microbial inoculant.

[0028] In an embodiment, the viable cell count of the strain with the anti-allergy effect is not less than 1×10 7 cfu / g.

[0029] In an embodiment, the cell count in the microbial inoculant is not less than 1×10 7 cells / g.

[0030] The technical solutions of the application are further described in detail through specific embodiments.

[0031] Embodiment 1 This embodiment is screening of Lactiplantibacillus plantarum Biohalo12; The Lactiplantibacillus plantarum Biohalo12 of the application is one of probiotics isolated from breast milk, and is identified as Lactiplantibacillus plantarum through 16S rRNA gene sequencing and pheS gene sequencing; wherein the sequencing sequence of 16S rRNA is shown as SEQ ID NO: 1, and specifically is: The sequence of the pheS gene is shown as SEQ ID NO: 2, specifically: CCCAGTACTTCGATCCAACCCGTTTGCTTACAGATTGCACAGCCCTTGCCATTGCAATTAAAGCAAGTTACATCAGCTTCTACGGATGGTTCCGTGAATGGAAAGAAGCTTGGCCGTAGCCGAACATCGAATTGATCGCCAAACAAAGTCTTGGCAACCAGAATTAAGGTGCCCTTCAAATCAGCCATCGTAATATGCTTGTCCACGACTAACCCTTCAATTTGATGAAATTGATGGGAATGGGTTGCATCATCCGTATCACGCCGATAAACGCGGCCAGGTGACAAGACCTTCAGCGGTCCTTTAGAAAAATCGTGATTTTCAAGTGACCGCGGCTGATCAGCAGACGTCTGCGTGCGTAGTAGCACGTCTTTGGTAATATAGAACGTGTCTTGCATATC.

[0032] The morphological identification characteristics of Lactiplantibacillus plantarum Biohalo12 are as follows: the colony characteristics mainly show round, smooth, and cream-colored colonies. Under a microscope, the bacteria are rod-shaped and single.

[0033] Example 2 This example is a study on the functional effect of Lactiplantibacillus plantarum Biohalo12.

[0034] 1. Experimental animals and reagents: The experimental animals used in this experiment were 6-week-old female BALB / c mice purchased from Hubei Biotechnology Co., Ltd. Chicken ovalbumin (OVA) was purchased from Sigma (item number A5378) in the United States. OVA-specific IgE, IgG1, IgG2a, and IFN-γ, IL-4, IL-10 ELISA kits were purchased from BD biosicneces.

[0035] 2. Establishment of animal models: Twenty-four six-week-old mice were weighed and randomly divided into a blank control group, a control group, and an experimental group, with eight mice in each group. After one week of acclimatization, the experiment began using a 12-hour light / 12-hour dark cycle, during which the mice had free access to food. The control and experimental groups were sensitized by intraperitoneal injection of 2 μg OVA on day 1, and then again by intraperitoneal injection of 6 μg OVA on days 14 and 28 to enhance the sensitization effect; the blank control group received an equal volume of physiological saline intraperitoneally. In addition, the experimental group received 4 × 10⁴ OVA daily via gavage. 9 CFU / mouse of *Biohalo 12* bacterial suspension was administered. The control and blank groups were fed the same volume of sterile water daily. Tail vein blood was collected on days 1, 14, and 28 to assess allergic reactions by detecting OVA-specific antibody concentrations of IgE, IgG1, and IgG2a. The experiment ended on day 35. Mouse body weight, liver-to-body weight ratio, and kidney-to-body weight ratio were recorded. Blood was collected from the mice's eyeballs, and they were euthanized by CO2 asphyxiation. Serum concentrations of OVA-specific IgE, IgG1, and IgG2a were measured again.

[0036] 3. Preparation and culture of spleen cells: After euthanizing mice using CO2 asphyxiation, the spleens were aseptically placed in culture dishes, and 6 ml of PBS was added. The spleens were then crushed and ground into a suspension using a glass rod. The suspension was slowly added to centrifuge tubes pre-filled with 6 ml of density gradient medium (catalog number 17-1400-02, BD Pharmacia). Splenic cells were separated by gradient centrifugation (720 × g, 20 min), and erythrocytes were precipitated. Splenic cells were removed from the separation interface, washed twice with PBS, and then the cell concentration was adjusted to 4 × 10⁶ cells / mL using RPMI-1640 medium. 6 100 μL of spleen cells were injected into each well of a 96-well plate. Two groups of spleen cell culture conditions were set up: OVA group (OVA culture concentration 30 μg / ml, OVA dissolved in 1640 medium) and control group (same volume of 1640 medium as the OVA group). The supernatant was collected after 48 h of culture.

[0037] 4. Collection of bronchoalveolar lavage fluid: Mice in each group were euthanized by CO2 asphyxiation and then underwent bronchoalveolar lavage, with lung tissue collected. The specific steps were as follows: Mice were fixed to the operating table, the skin of the neck and chest was disinfected, the neck skin was cut open, and the muscles were bluntly dissected to expose the trachea. A surgical suture was passed through the lower part of the trachea, and an indwelling intravenous catheter was inserted at the thyroid cartilage. After removing the needle core, the catheter was secured with sutures. A 1 ml sterile syringe was connected, and the lungs were lavaged three times consecutively with PBS until the lung lobes turned white.

[0038] 5. ELISA detection of OVA-specific IgE antibodies in serum: OVA was dissolved in pH 9.6 sodium bicarbonate buffer and prepared into 10 μg / ml OVA solution, which was added into 96-well plates (200 μl per well). Appropriate amount of purified IgGl and purified IG2a were dissolved in pH 9.0 sodium phosphate buffer and diluted 250 times, which were added into 96-well plates (100 μl per well). The plates were sealed with adhesive film and incubated at 4°C overnight. The next day, the plates were washed 3 times with ELISA wash buffer, and then 200 μl of blocking buffer was added to each well. After incubation at room temperature for 1 h, the plates were washed 5 times with ELISA wash buffer. Serum samples were diluted 30 times and added to the 96-well plates (100 μl per well), and incubated at room temperature for 2 h. The plates were washed 5 times with ELISA wash buffer. Biotin-anti-mouse IgE (No. 5126552E, BD PharMingen, diluted 500 times), Biotin-anti-mouse IgGl (No. 553441, BD PharMingen, diluted 500 times) and Biotin-anti-mouse IgG2a (No. 553388, BD PharMingen, diluted 500 times) were prepared and added to the 96-well plates (100 μl per well), and incubated at room temperature for 1 h. The plates were washed 5 times with ELISA wash buffer. Streptavidin-alkaline phosphatase (diluted 2 000 times, 100 μl per well) was added to the plates, and incubated at room temperature for 1 h. The plates were washed 5 times with ELISA wash buffer. Finally, pNPP substrate (100 μl per well) was added to develop color, and the results were expressed as OD405. The serum of the placebo group was used as positive control, and the results were expressed as OVA-specific IgE relative level in ELISA units (%).

[0039] 6. ELISA detection of IFN-γ in spleen cells and IL-10 and IL-4 in bronchoalveolar lavage fluid: Take appropriate amounts of purified IFN-γ, IL-10, and IL-4, dissolve them in pH 9.0 sodium hydrogen phosphate buffer (250-fold dilution), and add 100 μl to each well of a 96-well plate. Seal the plate with a gel film and incubate overnight at 4°C. The next day, wash three times with ELISA wash buffer, then add 200 μl of filling buffer to each well, incubate at room temperature for 1 h, and then wash five times with ELISA wash buffer. Take samples (spleen cell culture supernatant and bronchoalveolar lavage fluid) and add them to 96-well plates (100 μl per well). Incubate at room temperature for 2 h and wash 5 times with ELISA wash buffer. Take Biotin-anti-mouse INF-γ (catalog number 554410, BDPharmingen), Biotin-anti-mouse IL-10 (catalog number 554465, BD Pharmingen), and Biotin-anti-mouse IL-4 (catalog number 5126512E, BD Pharmingen) and dilute them with ELISA wash buffer (dilution factors of 1000, 500, and 500, respectively). Add them to 96-well plates (100 μl per well) and incubate at room temperature for 1 h. Wash 5 times with ELISA wash buffer. Add streptavidin-alkaline phosphatase (diluted 2000-fold, 100 μl per well), incubate at room temperature for 1 h, and then wash 5 times with ELISA wash buffer. Finally, add pNPP substrate (100 μl per well) for color development, and the colorimetric results are expressed as OD405 values. The results are expressed as ELISA units (%) representing the relative levels of OVA-specific IgG1 and IgG2a.

[0040] 7. Statistical Analysis: Each experiment was independently and randomly repeated three times. GraphPad Prism 10 software was used for statistical analysis and graphing of the experimental data. Quantitative data were expressed as mean ± standard deviation (x±s). Homogeneity of variance was tested for data analysis, and p < 0.05 was considered statistically significant.

[0041] 8. Experimental Results:

[0042] 1) Compare the changes in body weight, liver-to-body ratio, and kidney-to-body ratio among the three groups of mice as follows: Figure 1 As shown, Figure 1 In the mean squared error (ns), P>0.05, there was no statistically significant difference. Depend on Figure 1 It was found that there were no statistically significant differences in body weight, liver-to-body ratio, and kidney-to-body ratio among the three groups of mice: blank group, control group, and experimental group (all P>0.05).

[0043] 2) Compare the changes in OVA-specific antibody concentrations in the serum of the three groups of mice as follows: Figure 2 As shown, Figure 2**P < 0.05, ****P < 0.0001; As shown in Fig. 2A, the OVA-specific IgE in the serum of the experimental group was significantly lower than that of the control group (P < 0.0001), but higher than that of the blank group (P < 0.05). Figure 2 As shown in Fig. 2B, the IgG1 in the serum of the experimental group was significantly lower than that of the control group (P < 0.0001), but higher than that of the blank group (P < 0.05). Figure 2 As shown in Fig. 2C, the IgG2a in the serum of the experimental group was significantly higher than that of the blank group and the control group (P < 0.0001), but there was no significant difference between the blank group and the control group. Figure 2 Figure 2

[0044] 3) Comparison of IFN-γ concentrations secreted by spleen cells of the three groups under different culture conditions, as shown in Fig. 3. Figure 3 As shown in Fig. 3A, the IFN-γ concentration secreted by the spleen cells of the experimental group was significantly higher than that of the blank group and the control group (P < 0.0001), but there was no significant difference between the blank group and the control group. Figure 3 As shown in Fig. 3B, the IFN-γ concentration secreted by the spleen cells of the experimental group was significantly higher than that of the control group (P < 0.0001), but higher than that of the blank group (P < 0.05). As shown in Fig. 3C, the IFN-γ concentration secreted by the spleen cells of the experimental group was significantly higher than that of the blank group and the control group (P < 0.0001), but there was no significant difference between the blank group and the control group. Figure 3 As shown in Fig. 3A, the IFN-γ concentration secreted by the spleen cells of the experimental group was significantly higher than that of the blank group and the control group (P < 0.0001), but there was no significant difference between the blank group and the control group. As shown in Fig. 3B, the IFN-γ concentration secreted by the spleen cells of the experimental group was significantly higher than that of the control group (P < 0.0001), but higher than that of the blank group (P < 0.05). Figure 3 As shown in Fig. 3C, the IFN-γ concentration secreted by the spleen cells of the experimental group was significantly higher than that of the blank group and the control group (P < 0.0001), but there was no significant difference between the blank group and the control group. Figure 3 4) Comparison of IL-4 and IL-10 cytokine concentrations in the three groups of bronchoalveolar lavage fluid, as shown in Fig. 4.

[0045] As shown in Fig. 4A, the IL-4 content of the control group was significantly higher than that of the other two groups (P < 0.0001). Figure 4 As shown in Fig. 4B, the IL-10 content of the control group was significantly higher than that of the other two groups (P < 0.0001). Figure 4 As shown in Fig. 4C, the IL-10 content of the experimental group was significantly higher than that of the blank group and the control group (P < 0.0001), but there was no significant difference between the blank group and the control group. As shown in Fig. 4A, the IL-4 content of the control group was significantly higher than that of the other two groups (P < 0.0001). Figure 4 As shown in Fig. 4B, the IL-10 content of the control group was significantly higher than that of the other two groups (P < 0.0001). As shown in Fig. 4C, the IL-10 content of the experimental group was significantly higher than that of the blank group and the control group (P < 0.0001), but there was no significant difference between the blank group and the control group. Figure 4 ​​The IL-10 content in the experimental group was significantly higher than that in the blank group (P<0.000 1) Figure 4 Medium B).

[0046] Finally, it should be noted that: the above examples are used to illustrate the technical solutions of the present application, but not limited to; although the present application is described in detail with reference to the foregoing examples, those skilled in the art should understand that: it can still modify the technical solutions recorded in the foregoing examples, or make equivalent replacement for part or all of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present application, and they should be covered in the scope of the claims and description of the present application.

Claims

1. A strain having an anti-allergic effect, characterized by, The strain is Lactobacillus plantarum (Lactobacillus plantarum) Lactiplantibacillus plantarum ) Biohalo 12, deposited with the China General Microbiological Culture Collection Center on June 16, 2025, and assigned accession number CGMCC NO. 34916.

2. A microbial agent containing the strain having an anti-allergic effect according to claim 1.

3. The microbial inoculant of claim 2, wherein, The microbial agent is obtained by inoculating the strain having an anti-allergic effect into a culture medium and culturing the same.

4. Use of the strain having an anti-allergic effect according to claim 1 or the microbial agent according to any one of claims 2 to 3 in the manufacture of an anti-allergic product.

5. Use according to claim 4, characterized in that, The product is a pharmaceutical product or a health food product.

6. A product having an anti-allergic effect, characterized by comprising: A composition comprising the strain having an anti-allergic effect according to claim 1 or the microbial agent according to any one of claims 2 to 3.

7. The product of claim 6, wherein, The viable cell number of the strain having an anti-allergic effect is not less than 1 x 10 7 cfu / g.

8. The product of claim 6, wherein, The cell number in the microbial inoculant is not less than 1 x 10 7 cells / g.