Streptomyces loop and application thereof

Abstract

The invention discloses loop streptomyces and application thereof, and belongs to the technical field of microorganisms. The invention aims to provide an effective prevention and control method for root-knot nematodes. The invention provides Streptomyces anulatus, the Streptomyces anulatus is named as T.C.20, the preservation number of the Streptomyces anulatus is CGMCC (China General Microbiological Culture Collection Center) NO.35572, the preservation date of the Streptomyces anulatus is August 11, 2025, and the Streptomyces anulatus is preserved in China General Microbiological Culture Collection Center. The strain has huge application potential for solving the harm of meloidogyne incognita in cucumber production.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of microorganisms, and particularly relates to a Streptomyces annulus and application thereof. BACKGROUND

[0002] Vegetable root-knot nematode disease (commonly known as "tumor disease") caused by root-knot nematode is a common disease in vegetable planting. In recent years, with the continuous expansion of the area of greenhouse vegetable planting, a suitable environment has been created for the breeding and spread of the disease, leading to more and more serious damage, especially in the continuous cropping of greenhouse cucumbers, tomatoes, celery and other crops, with annual economic losses of tens of billions of yuan. At present, the prevention and control of the disease is still mainly based on chemical methods, and common agents include abamectin, dazomet and the like. Although such chemical agents can effectively kill root-knot nematodes, they have many drawbacks: they can affect the safety and food quality of vegetables, pollute soil and water resources, destroy the ecological balance, and restrict the continuous cropping of vegetables and lead to yield reduction. With the increasing demand for the development of green, safe and efficient agriculture, more and more chemical pesticides are prohibited for use in vegetable production, and safe and efficient biological control technology for vegetable root-knot nematodes has therefore attracted increasing attention.

[0003] Actinomycetes have been a research hotspot because they can produce a large number of secondary metabolites (such as enzymes, hormones, antibiotics, etc.) with commercial value. However, with the deepening of research on the extraction of natural products from common environmental microorganisms, the discovery of new species and new compounds has become increasingly difficult.

[0004] Due to the diversity of insect habitats and diets, insects carry a large number of related microorganisms; different insects and their symbiotic actinomycetes have formed diverse interaction relationships and unique systems through long-term evolution. Therefore, insect symbiotic actinomycetes are gradually becoming an important resource for exploring new strains of high-activity actinomycetes, and showing broad application prospects in the field of agricultural biological control. SUMMARY

[0005] The purpose of the present application is to provide an effective method for preventing and controlling root-knot nematodes.

[0006] The present application provides a Streptomyces annulus (T.C.20) for use in the prevention and control of root-knot nematodes. Streptomyces anulatus The Streptomyces annulus is named T.C.20, has a preservation number of CGMCC NO.35572, was preserved on August 11, 2025, and is preserved in the General Microbiological Center of the Chinese Microorganism Bacterium Preservation Management Committee, located at No.3, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, and is classified and named Streptomyces annulus. Streptomyces anulatus

[0007] The present application provides a microbial preparation containing the above-mentioned Streptomyces annulus.

[0008] ​The application provides application of the above-mentioned streptomyces annulatus or the above-mentioned microbial preparation in preparation of a pesticide for preventing cucumber root-knot nematode disease.

[0009] The application provides application of the above-mentioned streptomyces annulatus or the above-mentioned microbial preparation in preparation of a pesticide for treating cucumber root-knot nematode disease.

[0010] The application provides a cucumber pesticide, and an effective component of the cucumber pesticide is the above-mentioned streptomyces annulatus.

[0011] The application further limits application of the above-mentioned cucumber pesticide in resisting cucumber root-knot nematode disease.

[0012] The application provides application of the above-mentioned streptomyces annulatus or the above-mentioned microbial preparation in preparation of a pesticide for treating cucumber root-knot nematode disease.

[0013] Further limitation is that the fermentation liquor of the streptomyces annulatus is obtained by the following method: the seed liquid of the streptomyces annulatus T.C.20 strain is inoculated into the ISP3 liquid culture medium at 5%, and the fermentation liquor is obtained by sterile culture at 28 DEG C for 7 days.

[0014] Further limitation is that the metabolic crude extract of the streptomyces annulatus is obtained by the following method: S1: the seed liquid of the streptomyces annulatus T.C.20 strain is inoculated into the ISP3 liquid culture medium at 5%, and the fermentation culture is obtained by culture at 28 DEG C for 7 days; S2: the obtained fermentation culture is extracted by ethyl acetate, and after extraction, the upper organic phase is poured out to obtain the crude extract, and the ethyl acetate in the crude extract is separated by rotary evaporation to obtain the metabolic crude extract.

[0015] Beneficial effect: the application separates a strain of streptomyces, and the root knot index of the treatment group is 1.32, and the prevention and treatment effect is 67.6% in the greenhouse pot experiment of the strain in preventing and treating the southern root-knot nematode, and the root knot index of the negative control group is 5.13. The strain has great application potential in solving the harm of the southern root-knot nematode in cucumber production.

[0016]

Biological preservation information

[0017] Figure 1A colony morphology chart of Streptomyces anulatus T.C.20 strain of the application; Figure 2 An application effect comparison chart of fermentation liquor of Streptomyces anulatus T.C.20 strain of the application in preventing and treating root-knot nematode disease of potted cucumbers; A is abamectin; B is T.C.20 strain; C is sterile water. DETAILED DESCRIPTION

[0018] TWYE: Yest extract 0.25 g, K2HPO4 0.5 g, Agar 18.0 g, water to 1 L, adjust pH to 7.2; SM3: dextrose 10 g, peptone 5 g, tryptone 3 g, sodium chloride 5 g, Agar 18 g, water to 1 L, adjust pH to 7.2; GS: Soluble starch 20.0 g, KNO3 1.0 g, NaCl 0.5 g, MgSO4·7 H2O 0.5 g, K2HPO4 0.5 g, FeSO4·7 H2O 10.0 mg, Agar 18.0 g, water to 1 L, adjust pH to 7.4.

[0019] Example 1. Strain screening and identification (1) Strain isolation and purification In this example, the beet armyworm larvae were collected from the cowpea planting site of the Institute of Hot Regions in Sanya, Hainan Province, and the microorganisms in the intestines of the beet armyworm larvae were isolated and identified by dilution coating method, as follows: The collected beet armyworm larvae were placed in sterile water, sterile water, 75% alcohol, 75% alcohol, and sterile water for 30 s, respectively, for in vitro disinfection; the head of the disinfected larvae was clamped with a forceps, and the intestine was clamped out with a sharp forceps, and the intestine was collected into a mortar and ground into a suspension with 5 mL of sterile water. The suspension was diluted into 10 -4 , 10 -5 , 10 -6 , 10 -7 four concentration gradients, and 100 μL of each concentration was taken and coated on TWYE, SM3, and GS 3 kinds of culture media containing 50 μg / mL cycloheximide and 50 μg / mL nalydine acid (pH of the culture medium was adjusted to 8.0), 3 plates for each concentration, a total of 36 plates; the plates were inverted in a 28℃ constant temperature incubator for culture, and the colony size was checked every day, and the newly grown colonies were isolated and purified until no new colonies grew.

[0020] (2) Strain identification The sequence of the T.C.20 strain was subjected to trpB Sequence fragment amplification, the amplified sequence trpB Sequence homology analysis, phylogenetic analysis, through BLAST homologous alignment, we determined that the closest species of the strain is Streptomyces cyclocolouratus Streptomyces anulatus ).

[0021] The primer sequence is: trpBF: 5'- GCGCGAGGACCTGAACCACACCGGCTCACACAAGATCAACA-3' (SEQ ID NO. 1); trpBR: 5'-TCGATGGCCGGGATGATGCCCTCGGTGCGCGACAGCAGGC-3' (SEQ ID NO. 2); The gene sequence of the strain T.C.20 is as follows: (SEQ ID NO. 3) trpB ​TCGTTTTCCGCTTAACAAGTCGTGAAGCTCCAGCGCTCCTCATCGGTGACCGCGCGGTACTCGCCGCGCCCGACGTCCTTGAGGTACGCGTGCTCCGGGCCGATGCCGGGGTAGTCCAGTCCCGCCGAGATGGAGTACGGCTCGGTGATCTGGCCCTCGTCGTCCTGGAGGACGTAGGAGCGCGAGCCGTGCAGGATGCCGGGCTCCCCCGCGGTGAGGGTCGCCGCGTGCTCACCGGTCTCCACCCCGTGCCCGGCGGGCTCGCAGCCCACCAGGCGGACGTCGGCGTCGGGGATGAAGGCGTGGAAGAGGCCGATGGCGTTGGAGCCGCCTCCGAGCGCGGCGACCGCCGCGTCCGGGAGGCGTCCCGCGCGCTCCAGGATCTGGCGGCGGGCCTCGACGCCGATGACCCGGTGGAAGTCGCGGACCATCGCCGGGAAGGGGTGCGGGCCCGCGACCGTGCCGAAGAGGTAGTGCGTGCGGTCCACGTTGGCGACCCAGTCGCGGAACGCCTCGTTGATGGCGTCCTTCAGCGTCCGCGAGCCGGACTTCACGGCGACGACCTCGGCGCCGAGCATCCGCATCCGGGCCACGTTCAGCGCCTGGCGCTCGGTGTCGATCTCGCCCATGTAGATGGTGCATTCGAGGCCGAAGAGGGCGCAGGCGGTCGCGGTGGCGACGCCGTGCTGGCCGGCTCCGGTCTCGGCGATGACACGGGTCTTGCCCATGCGCTTGGTGAGGAGGGCCTGACCCAGCACGTAAAAG.

[0022] Example 2. Effect of crude extract of Streptomyces sp. T.C. 20 strain metabolism on killing of southern root-knot nematodes 1. Preparation of nematodes for testing The southern root-knot nematodes used in the experiment were collected from the greenhouse of the Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences. The southern root-knot nematodes were taken out from the roots of naturally infected pepper plants, washed gently with water, and the egg masses were removed from the surface of the roots, disinfected in 0.5% sodium hypochlorite for 3 min, then washed with sterile water for 3 times, placed in a culture dish containing a small amount of sterile water, and incubated in a 28°C incubator. The hatched second instar larvae of the root-knot nematodes were collected and suspended in sterile water for experimental study.

[0023] 2. Preparation of the crude extract of Streptomyces anulatus T.C.20 strain metabolites The method for preparing the crude extract of Streptomyces anulatus T.C.20 strain metabolites is as follows: S1: The seed liquid of Streptomyces anulatus T.C.20 strain was inoculated into ISP3 liquid medium at 5%, and cultured in a sterile incubator at 28°C for 7 days to obtain the fermentation culture; S2: The obtained fermentation culture was extracted with ethyl acetate. After extraction, the layers were separated, and the upper organic phase was poured out to obtain the crude extract. The ethyl acetate in the crude extract was separated by rotary evaporation to obtain the crude extract of metabolites.

[0024] 3. Determination of the effect of the crude extract of Streptomyces anulatus T.C.20 strain metabolites on killing southern root-knot nematodes The crude extract obtained by fermentation of T.C.20 strain was dissolved in methanol to form a mother liquor at 20 mg / mL. In a 96-well sterile cell culture plate, 5 μL of the crude extract mother liquor was added to each well, and 5 μL of methanol was used as a control. Then, 95 μL of nematode suspension (about 100 nematodes) was added to the treatment and control, respectively, to make the final concentration 1 mg / mL and the total volume 100 μL. The plate was incubated in a 28°C incubator for 24 h. The death of root-knot nematodes was observed, and the corrected mortality was calculated, which was the nematocidal effect. Each test was repeated three times, and the nematocidal effect is shown in Table 1.

[0025] Corrected mortality calculation formula: ; Table 1 Nematocidal effect of the crude extract of T.C.20 strain metabolites

[0026] Example 3. Pot experiment for preventing and treating cucumber root-knot nematode disease by Streptomyces anulatus T.C.20 1. Preparation of nematodes and fermentation broth of Streptomyces anulatus T.C.20 for the experiment Preparation of root-knot nematode: Southern root-knot nematodes used in the test were collected from the greenhouse of the Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences. The southern root-knot nematodes were taken from the roots of naturally infected pepper plants, washed gently with water, and the egg masses were removed from the surface of the roots. The egg masses were then disinfected in 0.5% sodium hypochlorite for 3 minutes, washed with sterile water for 3 times, and placed in a culture dish containing a small amount of sterile water. The culture dish was incubated in a 28°C incubator, and the hatched second instar juveniles were collected after 24-48 hours and suspended in sterile water for use in the test.

[0027] Preparation of fermentation broth: The T.C.20 strain of Streptomyces anulatus was inoculated into ISP3 liquid medium at 5%, and the seed liquid was cultured aseptically at 28°C for 7 days on a shaker to obtain the fermentation broth.

[0028] ISP3 liquid medium: oat meal 20.0 g, NaCl 1.0 g, FeSO4·7H2O 0.001 g, MnCl2·4H2O 0.001 g, ZnSO4·7H2O 0.001 g, and water to 1 L.

[0029] 2. Effect test of T.C.20 strain of Streptomyces anulatus fermentation broth on the control of potted cucumber root-knot nematode disease The seeds of Zhongnong No. 6 cucumber were disinfected with 1% sodium hypochlorite, and after germination, they were sown in sterilized soil (vermiculite: substrate soil = 1:2). When the first true leaf emerged, the seedlings were transplanted into 7 cm*7 cm*10 cm plastic pots with sterilized soil (vermiculite: substrate soil = 1:2). When the Zhongnong No. 6 cucumber seedlings grew to two true leaves, three 1000 μL blue gun heads were inserted evenly into the pots. The experimental group was irrigated with 10 mL of T.C.20 strain of Streptomyces anulatus fermentation broth; the positive control group was irrigated with 10 mL of abamectin solution (0.18 mg / mL); and the negative control group was irrigated with 10 mL of sterile water. After 48 hours of irrigation, the blue gun heads in the pots were removed, and 150 μl of nematode suspension containing 100 southern root-knot nematodes was injected into each hole, with a total of 300 nematodes per pot, and the gun hole was then covered with substrate soil. After 30 days, the investigation was conducted, with 10 repetitions per group, and three independent repeated tests were conducted. The control effect is shown in Tables 2, 3, 4 and Figure 2 .

[0030] Control effect calculation formula: ; Root-knot index calculation formula: root-knot index = number of root knots / fresh weight of roots; Table 2 Effect of the first potted test

[0031] Note: Different lowercase letters in the same column indicate significant differences between treatments (Tukey's test, P<0.05).

[0032] Table 3 Effect of the second pot experiment

[0033] Note: Different lower case letters after the same column data indicate significant differences between treatments (Tukey's test, P < 0.05).

[0034] Table 4 Effect of the third pot experiment

[0035] Note: Different lower case letters after the same column data indicate significant differences between treatments (Tukey's test, P < 0.05).

[0036] From the experiment, it can be seen that the pot experiment clearly shows the biocontrol effect of T.C.20 strain on cucumber root-knot nematode disease. The results show that the average number of root-knots on cucumber seedlings in the sterile water control group is 83.3 per plant, and the average root-knot index is 5.13 (the average value of root-knot index in Tables 2-4). The average number of root-knots on pot-grown cucumber seedlings treated with Streptomyces lydicus T.C.20 fermentation broth is 27.7 per plant, and the average root-knot index is 1.32, with an average control effect on root-knot nematodes of 67.6%. This shows that Streptomyces lydicus T.C.20 can significantly reduce the number of root-knots on cucumber seedlings and effectively control cucumber root-knot nematode disease. In addition, the average number of root-knots on cucumber seedlings treated with the pesticide avermectin is as low as 13.73 per plant, with the best control effect on root-knot nematodes. However, according to the Chinese pesticide toxicity classification standard, avermectin is a high-toxicity insecticide with high toxicity to fish and other species, and improper use will directly endanger human health. In comparison, Streptomyces lydicus T.C.20 is derived from natural habitats and has the characteristics of high efficiency and safety, and has important value in the prevention and control of root-knot nematode disease in agricultural production.

Claims

1. A Streptomyces circovallatus (ATCC 31243) which is characterized by, Streptomyces anulatus The ring circle Streptomyces is named T.C. 20, the preservation number is CGMCC NO. 35572, and the preservation date is August 11, 2025, and is preserved in the China General Microbiological Culture Collection Center. ​ 2. A microbial preparation containing the ring circle Streptomyces of claim 1.

3. Use of the ring circle Streptomyces of claim 1 or the microbial preparation of claim 2 in the preparation of a pesticide for preventing cucumber root-knot nematode disease.

4. Use of the ring circle Streptomyces of claim 1 or the microbial preparation of claim 2 in the preparation of a pesticide for treating cucumber root-knot nematode disease.

5. A cucumber pesticide, characterized by comprising: The effective component of the cucumber pesticide is the ring circle Streptomyces of claim 1.

6. Use of the cucumber pesticide of claim 5 in resisting cucumber root-knot nematode disease.

7. Use of the metabolic crude extract of the ring circle Streptomyces of claim 1 or the fermentation broth of the ring circle Streptomyces of claim 1 in resisting cucumber root-knot nematode disease.

8. Use according to claim 7, characterized in that, The method for obtaining the fermentation broth of the ring circle Streptomyces is as follows: the seed liquid of the ring circle Streptomyces T.C. 20 strain is inoculated into ISP3 liquid medium at 5%, and sterile culture is carried out at 28℃ for 7 days on a shaking table to obtain the fermentation broth.

9. Use according to claim 7, characterized in that, The method for obtaining the metabolic crude extract of the ring circle Streptomyces is as follows: S1: the seed liquid of the ring circle Streptomyces T.C. 20 strain is inoculated into ISP3 liquid medium at 5%, and culture is carried out at 28℃ for 7 days to obtain the fermentation culture; S2: the obtained fermentation culture is extracted with ethyl acetate, after extraction, it is layered by standing, the upper organic phase is poured out to obtain the crude extract, and the ethyl acetate in the crude extract is separated by rotary evaporation to obtain the metabolic crude extract.

Images