Application of FAD2 gene in regulation and control of growth, pathogenicity and stress resistance of Botryis cinerea

Abstract

The invention discloses an application of an FAD2 gene of Botrytis cinerea (Botrytis cinerea) in regulation and control of growth, pathogenicity and stress resistance of B. cinerea (Botrytis cinerea). The FAD2 gene is derived from B. cinerea, and a knockout mutant of the FAD2 gene is obtained by constructing a knockout gene segment of the FAD2 gene and introducing the knockout gene segment into a protoplast of B. cinerea. The research finds that the FAD2 gene plays an important role in regulating and controlling the growth of B. cinerea and influencing osmotic stress and oxygen stress capabilities such as high salinity, and obviously reduces the pathogenicity of B. cinerea hyphae to tomato fruits and leaves. Therefore, the FAD2 can be used as a key gene for researching a disease pathogenic mechanism and a target of a bactericide, so that the bactericide for preventing and treating B. cinerea is researched and developed, or the FAD2 is applied to gene function research of germs, a new variety for resisting plant diseases is favorably cultivated, and the FAD2 has a wide application prospect in plant fungal disease research.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and particularly relates to the application of FAD2 gene in regulating the growth, pathogenicity and stress resistance of B. cinerea. BACKGROUND

[0002] Botrytis cinerea belongs to Eumycetes, Eumycota, Deuteromycotina, Hyphomycetes, Hyphomycetales and Moniliaceae. The host range of B. cinerea is very wide, and it can infect economic crops such as tomato, cucumber, eggplant, grape and tobacco (Chen T., Zhang Z.Q., Chen Y., Li B.Q., Tian S.P. Botrytis cinerea. Curr. Biol. 2023, 33(11): R460-R462; Dean R., Van-kan J.A., Pretorius Z.A., Hammond-kosack K.E., Di pietro A., Spanu P.D., Rudd J.J., Dickman M., Kahmann R., Ellis J., Foster G.D. The top 10 fungal pathogens in molecular plant pathology. Mol. Plant Pathol. 2012, 13(4): 414-430; Bi K., Liang Y., Mengiste T., Sharon A. Killing softly: A roadmap of Botrytis cinerea pathogenicity. Trends Plant Sci. 2023, 28(2): 211-222). The wild strain GZFQ-1 (China General Microbiological Culture Collection Center, strain preservation number CGMCC 3.20932, published) of B. cinerea isolated and identified by the research group of the present inventors can infect tomato fruits and leaves, and has a serious impact on the quality and yield of tomato.

[0003] So far, the molecular biology research of B. cinerea is still weak, especially the lack of pathogenic mechanism reports. Studies have shown that the successful infection of B. cinerea to tomato mainly depends on a series of pathogenic factors. Therefore, fully excavating the pathogenic related genes of B. cinerea and carrying out the gene function research can help to fully understand the pathogenic mechanism of B. cinerea, provide important data for the prevention and control of B. cinerea disease, and also help to select disease-resistant varieties. SUMMARY

[0004] In view of this, one of the purposes of the present application is to provide a new use of FAD2 gene derived from B. cinerea, i.e. the application of FAD2 gene in regulating the pathogenicity and / or growth rate and / or stress resistance and / or cell wall integrity of B. cinerea, the nucleotide sequence of the FAD2 gene is shown as SEQ ID NO. 1 or SEQ ID NO. 2, or the encoded amino acid sequence is shown as sequence SEQ ID NO. 3. Of course, the nucleic acid molecule containing FAD2 gene or the expression cassette, recombinant vector or recombinant microorganism containing the nucleic acid molecule all belong to the protection scope of the present application, the nucleic acid molecule can be DNA, such as cDNA, genomic DNA or recombinant DNA, or RNA, such as mRNA or hnRNA, etc., the vector can be plasmid, cosmid, bacteriophage or virus vector; the microorganism can be yeast, bacteria, algae or fungi, such as Agrobacterium; the fusion protein obtained by connecting a tag to the N terminal and / or C terminal of the protein shown as sequence SEQ ID NO. 3 also belongs to the protection scope of the present application. The FAD2 gene can be an oleate delta-12 desaturase family gene.

[0005] Preferably, the regulation is to reduce the pathogenicity and / or growth rate and / or stress resistance and / or cell wall integrity of B. cinerea after reducing the expression of FAD2 gene.

[0006] Preferably, the stress includes osmotic stress and / or oxidative stress.

[0007] The second purpose of the present application is to provide the application of FAD2 gene as a target in the design and screening of antifungal drugs, the nucleotide sequence of the FAD2 gene is shown as SEQ ID NO. 1 or SEQ ID NO. 2, or the encoded amino acid sequence is shown as sequence SEQ ID NO. 3.

[0008] The third object of the present application is to provide an application of FAD2 gene in cultivating transgenic B. cinerea with reduced pathogenicity and / or reduced growth rate and / or reduced stress tolerance and / or reduced cell wall integrity, wherein the nucleotide sequence of the FAD2 gene is shown as SEQ ID NO. 1 or SEQ ID NO. 2, or the encoded amino acid sequence is shown as SEQ ID NO. 3.

[0009] The fourth object of the present application is to provide a method for cultivating transgenic B. cinerea with reduced pathogenicity and / or reduced growth rate and / or reduced stress tolerance and / or reduced cell wall integrity, comprising the step of reducing the expression amount and / or activity of FAD2 gene in the recipient B. cinerea, to obtain the transgenic B. cinerea (such as Δfad2 knockout mutant), wherein the nucleotide sequence of the FAD2 gene is shown as SEQ ID NO. 1 or SEQ ID NO. 2, or the encoded amino acid sequence is shown as SEQ ID NO. 3. The pathogenicity and / or growth rate and / or stress tolerance and / or cell wall integrity of the transgenic B. cinerea is lower than that of wild type B. cinerea.

[0010] Preferably, the method for reducing the expression amount and / or activity of FAD2 gene in the recipient B. cinerea is achieved by knocking out or inhibiting or silencing the expression of FAD2 gene in the recipient B. cinerea.

[0011] Preferably, the method for knocking out is a method for knocking out FAD2 gene in the recipient B. cinerea by homologous recombination.

[0012] Preferably, the method for knocking out by homologous recombination is a method for introducing a homologous recombination fragment for homologous recombination into the protoplast of the recipient B. cinerea.

[0013] The fifth object of the present application is to provide an application of the above method in preventing and treating diseases caused by B. cinerea.

[0014] The application provides application of FAD2 gene from B. cinerea in regulating pathogenicity, growth rate, stress resistance and cell wall integrity of plant pathogenic fungi B. cinerea. It is found that the pathogenicity, growth rate, stress resistance and cell wall integrity of B. cinerea after knockout of FAD2 gene in wild type B. cinerea are significantly reduced. Therefore, the FAD2 gene can be used as a fungicide target and a key protein of disease pathogenic mechanism to develop a medicament for diseases caused by B. cinerea infection and cultivate new disease-resistant varieties, and has a broad application prospect in the prevention and control of plant pathogenic fungi diseases. BRIEF DESCRIPTION OF DRAWINGS

[0015] Figure 1 A schematic diagram of the knockout screening strategy of the FAD2 gene of B. cinerea in the application;

[0016] Figure 2 A map of the plasmid pCT74 in the application;

[0017] Figure 3 A schematic diagram of the protoplast knockout observed by a microscope in the application;

[0018] Figure 4 A PCR electropherogram for knockout detection in the application (Note: M: marker; 1: 4F / HYG-1R (2594 bp); 2: HYG-1F / 4R (2248 bp); 3: HYG-F / HYG-R (1376 bp); 4: 2F / 2R (1446 bp));

[0019] Figure 5 A growth situation diagram of mycelium of B. cinerea wild type and Δfad2 knockout mutant on PDA in the application;

[0020] Figure 6 A colony growth diagram of mycelium of B. cinerea wild type and Δfad2 knockout mutant under different stress conditions in the application;

[0021] Figure 7 A colony growth inhibition rate diagram of mycelium of B. cinerea wild type and Δfad2 knockout mutant under different stress conditions in the application;

[0022] Figure 8 A pathogenicity determination result of mycelium of B. cinerea wild type and Δfad2 knockout mutant on tomato fruits in the application;

[0023] Figure 9The pathogenicity of the wild type and the Δfad2 knockout mutant of B. cinerea to tomato leaves was determined. DETAILED DESCRIPTION

[0024] The application will be described in detail below with reference to the examples, which are merely illustrative and not restrictive of the application. The application is not limited to the following embodiments or examples, and any modifications and variations made without departing from the spirit of the application shall be included within the scope of the application. The experimental materials used in the following examples are commercially available unless otherwise specified.

[0025] The wild strain GZFQ-1 of B. cinerea in the following examples was isolated and identified by the research group of the inventors and was deposited with the China General Microbiological Culture Collection Center with the strain preservation number CGMCC 3.20932. The genomic sequence of the FAD2 gene in the strain is shown in SEQ ID NO. 1, the CDS sequence is shown in SEQ ID NO. 2, and the encoded amino acid sequence is shown in SEQ ID NO. 3.

[0026] Example 1 Knockout of the FAD2 gene of B. cinerea

[0027] The specific construction and screening strategy of the knockout mutant of the FAD2 gene of B. cinerea are shown in Figure 1 The specific steps include:

[0028] 1. Construction of the knockout gene fragment

[0029] 1) Amplification of the upstream and downstream homologous sequences of the target gene: the genomic DNA of the wild strain CGMCC 3.20932 of B. cinerea was used as the template, and the upstream A fragment was amplified using primers 1F and 1R, and the downstream B fragment was amplified using primers 3F and 3R. A reverse complementary sequence of primer HYG-F was added to the 5' end of primer 1R, and a reverse complementary sequence of primer HYG-R was added to the 5' end of primer 3F. The sequences (from 5' end to 3' end) of primers 1F, 1R, 3F, 3R, HYG-F and HYG-R are as follows:

[0030] 1F: GGAGATGTATCAGGGTGGCA;

[0031] 1R: ACCTCCACTAGCTCCAGCCAAGTGTGTAGAGGGAGGAAGAGGG;

[0032] 3F: GAATAGAGTAGATGCCGACCGGGACACTCTTTGCATACTATCGCTT;

[0033] 3R: TCGTCTATTTTCCTCCTCGGC;

[0034] HYG-F: CTTGGCTGGAGCTAGTGGAGGT;

[0035] HYG-R: CCCGGTCGGCATCTACTCTATTC.

[0036] 2) Amplification of the hph gene: The first half of the hph gene (H1, 1094 bp) was amplified using primers HYG-F and HYG-1R, and the second half of the hph gene (H2, 748 bp) was amplified using primers HYG-1F and HYG-R. The sequences of primers HYG-1F and HYG-1R (from 5' to 3') are as follows:

[0037] HYG-1F: CGTTGCAAGACCTGCCTGAA;

[0038] HYG-1R: GGATGCCTCCGCTCGAAGTA.

[0039] 3) Fusion of the upstream and downstream fragments of the target gene with the hph gene: Overlapping PCR was used to overlap the recovered A fragment and B fragment with the H1 fragment and the H2 fragment, respectively, to obtain A-H1 and H2-B ligation fragments. Primers 1F / HYG-1R and HYG-1F / 4R were used to amplify the A-H1 and H2-B fragments, respectively, and the knockout fragment was purified to a concentration of 500 ng / μL.

[0040] 2, Preparation of B. cinerea protoplasts

[0041] 1) B. cinerea was inoculated on potato dextrose agar medium (PDA) and incubated at 25°C for 3 days, then fresh mycelial discs were cut from the edge of the colony using an inoculation needle and inoculated into 100 mL of PDB medium, which was incubated at 25°C with shaking at 180 rpm for 2 days to generate fresh mycelium.

[0042] 2) The fresh mycelium was ground using a grinder and transferred to YEPD medium, which was incubated at 20°C with shaking at 160 rpm for 20 h to generate fresh mycelium. The fresh mycelium of B. cinerea was collected by filtration and washed with 0.6 M potassium chloride.

[0043] 3) A mixture of lysing enzyme and snailase was prepared using 30 mL of 0.6 M potassium chloride solution as an osmotic stabilizer, and the enzyme solution was filtered through a 0.22 μm bacterial filter.

[0044] 4) Transfer the enzyme solution to a 50 mL centrifuge tube, add mycelium at a ratio of enzyme solution: mycelium = 3:1, suspend the mycelium, and shake at 25°C and 100 rpm for 3 h to lyse the mycelium.

[0045] 5) After lysis, filter through 2-3 layers of sterilized lens cleaning paper (fiber mesh aperture 45 ± 12 μm), rinse with 0.6 mol / L potassium chloride, collect the filtrate, and centrifuge the obtained filtrate at 4°C and 4000 rpm for 6 min. Resuspend with 15 mL of 1.2 mol / L sorbitol buffer (STC) solution;

[0046] 4) Discard the supernatant, resuspend the protoplasts with 1 mL of STC buffer, and prepare a protoplast suspension with a concentration of 1 × 10 7 protoplasts / mL, and store on ice.

[0047] 3. Protoplast transformation of B. cinerea

[0048] 1) Take 200 μL of the protoplast suspension and add it to a 50 mL centrifuge tube, add 10-20 μg of A-H1 and H2-B knock-out transformation fragments, mix gently, and place on ice in the dark for 20 min.

[0049] 2) Add 150 μL of SPTC solution, mix gently, and place on ice for 10 min; add 200-600 μL of SPTC in sequence, mix well, and place in the dark at room temperature for 20 min.

[0050] 3) Add the mixture evenly to 100 mL of TB3 medium that has been heated and then cooled to room temperature, and cultivate in the dark at 20°C for 24 h.

[0051] 4) Cover the original TB3 medium with a layer of TB3 medium containing 50 μg / mL of hygromycin B, and cultivate at 25°C for 3-4 days until the transformants grow.

[0052] 4. PCR verification of transformants

[0053] After subculturing for 3 generations on PDA medium containing hygromycin, the transformants of fad2 were obtained, and DNA was extracted from the transformant colonies by CTAB method, and PCR amplification was performed with four pairs of primers: primers HYG-F / HYG-R were used to amplify and detect the occurrence of homologous recombination between marker fragments and the presence of hph gene; primers 2F / 2R were used to detect whether the target gene was knocked out; primers 4F / HYG-1R were used to detect the occurrence of homologous recombination upstream; and primers HYG-1F / 4R were used to detect the occurrence of homologous recombination downstream. The sequences (from 5' end to 3' end) of primers 2F, 2R, 4F and 4R are as follows:

[0054] 2F: CCTTCAACTCGCTCTTCAA;

[0055] 2R: GACTTCAGCCAAAAGAGGTA;

[0056] 4F: CAGAGGAAGTTTTTGATAGAAAGCA;

[0057] 4R: TATTGGACTGCACGCACGAT.

[0058] The gene knockout fragment was introduced into B. cinerea protoplast by homologous recombination method, and hygromycin positive transformants were obtained. The positive transformants were analyzed by PCR verification using hph gene specific primers, and the results are shown in Figure 3 The hph gene, the occurrence of homologous recombination upstream and the occurrence of homologous recombination downstream were detected in the transformants, and the FAD2 gene was not amplified in the electrophoretogram, so the corresponding positive transformants were screened, i.e. the Δfad2 knockout mutant was obtained.

[0059] Example 2 Phenotype observation and stress resistance analysis of B. cinerea wild type and Δfad2 knockout mutant

[0060] 1. Colony morphology observation and growth rate determination

[0061] B. cinerea wild type and knockout mutant fad2 were inoculated on PDA medium, and cultured at 25°C in the dark. The colony diameter was measured by cross method at 4 d, and the colony morphology was observed. Three replicates were set for each treatment.

[0062] The results of colony morphology observation and growth rate determination of B. cinerea wild type and knockout mutant Δfad2 on PDA medium are shown in Figure 5 , wherein Figure 5 A is the growth of B. cinerea wild type strain and knockout mutant strain Δfad2 after inoculation on PDA medium for 4 d.Figure 5 B. cinerea wild type and gene knockout strain fad2 were inoculated on PDA medium for 4 d, and the colony growth rate was measured. The vertical coordinate was the diameter of the lesion measurement, and the values were the mean values based on three independent experiments. Data analysis was performed by Duncan's new multiple range method (p < 0.05). The colony morphology and growth rate of the B. cinerea knockout mutant Δfad2 on PDA medium were lower than those of the wild type, and the aerial mycelium was less, indicating that the FAD2 gene had an impact on the vegetative growth of B. cinerea.

[0063] 2. Analysis of stress resistance

[0064] 1) High osmotic stress analysis

[0065] B. cinerea wild type and knockout mutant Δfad2 were inoculated on PDA medium containing 1.0 mol / L NaCl and 1 mol / L sorbitol, respectively, and incubated in an inverted culture at 25°C for 4 d. The colony growth of the knockout mutant Δfad2 and the wild type strain was observed.

[0066] 2) Oxidative stress analysis: B. cinerea wild type and knockout mutant Δfad2 were inoculated on PDA medium containing 20 mmol / L H2O2, respectively, and incubated in an inverted culture at 25°C for 4 d. The colony growth of the knockout mutant Δfad2 and the wild type was observed.

[0067] 3) Cell membrane integrity analysis

[0068] B. cinerea wild type and knockout mutant Δfad2 were inoculated on PDA medium containing 100 μg / mL sodium dodecyl sulfate (SDS), respectively, and incubated in an inverted culture at 25°C for 4 d. The colony growth of the knockout mutant Δfad2 and the wild type strain was observed.

[0069] 4) Cell wall integrity analysis

[0070] B. cinerea wild type and knockout mutant Δfad2 were inoculated on PDA medium containing 300 μg / mL Congo red, respectively, and incubated in an inverted culture at 25°C for 4 d. The colony growth of the knockout mutant Δfad2 and the wild type strain was observed.

[0071] The colony diameters of all strains were measured (cross method) and photographed. The growth inhibition rate of the strain was calculated = (colony diameter of the control strain - colony diameter of the treated strain) / colony diameter of the control strain * 100%.

[0072] The growth of B. cinerea's Δfad2 knockout mutant and wild type under different stress conditions is as follows: Figure 6 As shown (where A~E represent the growth of B. cinerea knockout mutant strains on culture media under different stress conditions; F~J represent the growth of B. cinerea wild-type strains on culture media under different stress conditions; 1 mol / L sorbitol: containing a final concentration of 1 mol / L sorbitol; 20 mmol / L H2O2: containing a final concentration of 20 mmol / L H2O2; 300 μg / mL Congo red: containing a final concentration of 300 μg / mL Congo red; 1 mol / L NaCl: containing a final concentration of 1 mol / L NaCl; 100 μg / mL SDS: containing a final concentration of 100 μg / mL SDS; scale bar is 1 cm), the relative growth inhibition rate of colonies under different stress conditions is as follows: Figure 7 As shown (the vertical axis represents the relative growth inhibition rate, and the values ​​are the mean of three independent experiments, and the data were analyzed using Duncan's new multiple range method (p < 0.05)). Figure 7 From left to right, the figures show the relative growth inhibition rates of the wild-type and Δfad 2 knockout mutant colonies under Sorbitol, H2O2, Congo red, NaCl, and SDS stresses, analyzed using Duncan's new multiple range method (p < 0.05). Figure 6 and Figure 7 It was found that in PDA medium containing 1 mol / L sorbitol, 20 mmol / L H2O2, and 200 μg / mL Congo red, the relative growth inhibition rate of the Δfad2 knockout mutant colonies was significantly higher than that of the wild type, indicating that knockout of the FAD2 gene increases the sensitivity of mycelia to sorbitol, H2O2, and Congo red. In conclusion, knockout of the FAD2 gene inhibited the growth rate of *B. cinerea* and significantly increased its sensitivity to sorbitol, oxidative stress, and Congo red, suggesting that knockout of the FAD2 gene reduces the tolerance of *B. cinerea* to osmotic stress and oxidative stress, and decreases the cell wall integrity of *B. cinerea*.

[0073] Example 3 Pathogenicity analysis of Δfad2 knockout mutant

[0074] Wild-type B. cinerea and Δfad2 knockout mutant were inoculated onto PDA medium and incubated upside down in a 25°C incubator for 4 days. Using a sterile punch with a diameter of 4 mm, bacterial discs were collected from the edge of the colony and inoculated onto the surface of tomato fruits and leaves. Disease incidence was investigated 2 days later.

[0075] The results of the pathogenicity determination of the Δfad2 knockout mutant of B. cinerea on tomato are shown in Figure 8 and Figure 9 wherein, Figure 8 A is the lesion map after 2 d of inoculation of B. cinerea wild type strain and knockout mutant strain Δfad2 on tomato fruits; Figure 8 B is the graph of lesion area measurement after 2 d of inoculation of B. cinerea wild type strain and knockout mutant Δfad2 mycelium on tomato fruits, Figure 9 A is the lesion map after 2 d of inoculation of B. cinerea wild type strain and knockout mutant strain Δfad2 on tomato leaves; Figure 9 B is the graph of lesion area measurement after 2 d of inoculation of B. cinerea wild type strain and knockout mutant Δfad2 mycelium on tomato leaves, the vertical coordinate is the measured lesion area, the numerical value is the mean value based on 20 independent experiments, and the data was analyzed by Duncan's new multiple range method (p < 0.05). It can be seen from Figure 8 and Figure 9 that the lesion area of the Δfad2 knockout mutant is significantly reduced compared with the wild type on tomato, indicating that the pathogenicity of B. cinerea is significantly reduced after knocking out the FAD2 gene.

[0076] The conventional techniques and schemes not described in detail in the above examples are well known in the art, and therefore will not be described in detail here. The above examples and / or experimental examples describe the preferred embodiments of the present application in detail, however, the present application is not limited to the specific details in the above embodiments, and within the technical concept of the present application, various simple modifications can be made to the technical scheme of the present application, and these simple modifications all belong to the protection scope of the present application.

Claims

1. Use of a FAD2 gene in modulating the pathogenicity and / or growth rate and / or stress tolerance and / or cell wall integrity of B. cinerea, characterized in that, The nucleotide sequence of the FAD2 gene is shown in SEQ ID NO. 1 or SEQ ID NO. 2, or the encoded amino acid sequence is shown in SEQ ID NO.

3.

2. Use according to claim 1, wherein The regulation is to reduce the pathogenicity and / or growth rate and / or stress resistance and / or cell wall integrity of B. cinerea after reducing the expression of the FAD2 gene.

3. The use according to claim 1, wherein The stress includes osmotic stress and / or oxidative stress.

4. Application of FAD2 gene as a target in designing and screening antifungal drugs, characterized in that, The nucleotide sequence of the FAD2 gene is shown in SEQ ID NO. 1 or SEQ ID NO. 2, or the encoded amino acid sequence is shown in SEQ ID NO.

3.

5. Use of a FAD2 gene for breeding transgenic B. cinerea with reduced pathogenicity and / or reduced growth rate and / or reduced stress tolerance and / or reduced cell wall integrity, characterized in that, The nucleotide sequence of the FAD2 gene is shown in SEQ ID NO. 1 or SEQ ID NO. 2, or the encoded amino acid sequence is shown in SEQ ID NO.

3.

6. A method for breeding transgenic B. cinerea with reduced pathogenicity and / or reduced growth rate and / or reduced ability to withstand stress and / or reduced cell wall integrity, characterized in that, The method for reducing the expression amount and / or activity of the FAD2 gene in the recipient B. cinerea is achieved by knocking out or inhibiting or silencing the expression of the FAD2 gene in the recipient B. cinerea.

7. The method of claim 6, wherein, The method for knocking out is by using the method of homologous recombination.

8. The method of claim 7, wherein, The method of using homologous recombination is to introduce a homologous recombination fragment for homologous recombination into the protoplast of the recipient B. cinerea.

9. The method of claim 8, wherein, 10. Use of the method of any one of claims 6-9 in the prevention and treatment of diseases caused by B. cinerea. ​

Images