Application of the FAD2 gene in regulating the growth, pathogenicity, and stress resistance of Botrytis cinerea
By knocking out the FAD2 gene in B. cinerea and preparing the Δfad2 mutant, the problem of difficulty in controlling the pathogenicity and growth rate of Botrytis cinerea was solved, and its pathogenicity and resistance to adversity were significantly reduced, providing a new approach to disease control.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-04
- Publication Date
- 2026-04-07
AI Technical Summary
Current technologies have limited understanding of the pathogenic mechanism of Botrytis cinerea, and there is a lack of effective gene function studies, making it difficult to effectively control its pathogenicity, growth rate, and resistance to adversity.
By knocking out the FAD2 gene in B. cinerea, a Δfad2 knockout mutant was prepared using homologous recombination to reduce its pathogenicity, growth rate, and resistance to stress. Antifungal drugs were designed using the FAD2 gene as a target, and transgenic strains were cultivated.
It significantly reduced the pathogenicity, growth rate, and stress resistance of B. cinerea, and increased its sensitivity to osmotic pressure and oxidative stress, providing a new method for breeding disease-resistant varieties and controlling diseases.
Smart Images

Figure CN120905167B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to the application of the FAD2 gene in regulating the growth, pathogenicity, and stress resistance of B. cinerea. Background Technology
[0002] Botrytis cinerea belongs to the genus Botrytis of the family Moniliaceae, class Hyphomycetes, order Hyphomycetales, kingdom Eumycetes, phylum Eumycota, subphylum Deuteromycotina. Botrytis cinerea has a very wide host range, infecting economic crops such as tomatoes, cucumbers, eggplants, grapes, and tobacco (Chen T., Zhang ZQ, Chen Y., Li BQ, Tian SPBotrytis cinerea. Curr. Biol. 2023, 33(11): R460-R462; Dean R., Van-kan JA, Pretorius ZA, Hammond-kosack KE, Di pietro A., Spanu PD, Rudd JJ, Dickman M., Kahmann R., Ellis J., Foster GD The top 10 fungal pathogens inmolecular plant pathology. Mol. Plant Pathol. 2012, 13(4): 414-430; Bi K.,Liang Y., Mengiste T., Sharon A. Killing softly: A roadmap of Botrytiscinerea pathogenicity. Trends Plant Sci. 2023, 28(2): 211-222). The wild strain GZFQ-1 of B. cinerea (China General Microbiological Culture Collection Center, strain preservation number CGMCC3.20932, published) was isolated and identified by the research group of the inventors. This pathogen can infect tomato fruits and leaves, and has a serious impact on the quality and yield of tomatoes.
[0003] To date, molecular biological research on *B. cinerea* pathogen remains relatively weak both domestically and internationally, particularly lacking reports on the pathogenic mechanism. Studies have shown that successful infection of tomatoes by *B. cinerea* mainly depends on a series of pathogenic factors. Therefore, fully exploring the pathogenic genes related to *B. cinerea* and conducting gene function research will help to comprehensively understand the pathogenic mechanism of *B. cinerea*, provide important data for the control of diseases caused by *B. cinerea*, and also contribute to the breeding of disease-resistant varieties. Summary of the Invention
[0004] Therefore, one objective of this invention is to provide a novel use for the FAD2 gene derived from *B. cinerea*, specifically its application in regulating the pathogenicity and / or growth rate and / or stress resistance and / or cell wall integrity of *B. cinerea*, wherein the nucleotide sequence of the FAD2 gene is shown in SEQ ID NO. 1 or SEQ ID NO. 2, or the encoded amino acid sequence is shown in SEQ ID NO. 3. Of course, nucleic acid molecules containing the FAD2 gene, or expression cassettes, recombinant vectors, or recombinant microorganisms containing said nucleic acid molecules, are all within the scope of this invention. The nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA, or RNA, such as mRNA or hnRNA. The vector can be a plasmid, granulosome, bacteriophage, or viral vector. The microorganism can be yeast, bacteria, algae, or fungi, such as *Agrobacterium*. Fusion proteins obtained by attaching tags to the N-terminus and / or C-terminus of the protein shown in SEQ ID NO. 3 are also within the scope of this invention. This FAD2 gene may be an oleate delta-12 desaturase family gene.
[0005] Preferably, the regulation involves reducing the expression of the FAD2 gene, thereby decreasing the pathogenicity of B. cinerea and / or reducing its growth rate and / or its resistance to adversity and / or its cell wall integrity.
[0006] Preferably, the adversity includes osmotic pressure stress and / or oxidative stress.
[0007] The second objective of this invention is to provide the application of the FAD2 gene as a target in the design and screening of antifungal drugs, wherein the nucleotide sequence of the FAD2 gene is shown in SEQ ID NO.1 or SEQ ID NO.2, or the encoded amino acid sequence is shown in SEQ ID NO.3.
[0008] A third objective of this invention is to provide the application of the FAD2 gene in the cultivation of transgenic B. cinerea with reduced pathogenicity and / or reduced growth rate and / or reduced stress resistance and / or reduced cell wall integrity, wherein the nucleotide sequence of the FAD2 gene is shown in SEQ ID NO.1 or SEQ ID NO.2, or the encoded amino acid sequence is shown in sequence SEQ ID NO.3.
[0009] A fourth objective of this invention is to provide a method for cultivating transgenic *B. cinerea* with reduced pathogenicity and / or reduced growth rate and / or reduced stress resistance and / or reduced cell wall integrity. This method includes the step of reducing the expression level and / or activity of the FAD2 gene in the recipient *B. cinerea* to obtain a transgenic *B. cinerea* (such as a Δfad2 knockout mutant). The nucleotide sequence of the FAD2 gene is shown in SEQ ID NO. 1 or SEQ ID NO. 2, or the encoded amino acid sequence is shown in SEQ ID NO. 3. The pathogenicity and / or growth rate and / or stress resistance and / or cell wall integrity of the transgenic *B. cinerea* are lower than those of the wild-type *B. cinerea*.
[0010] Preferably, the method for reducing the expression level and / or activity of the FAD2 gene in the receptor B. cinerea is achieved by knocking out, inhibiting, or silencing the expression of the FAD2 gene in the receptor B. cinerea.
[0011] Preferably, the knockout method is to use homologous recombination to knock out the FAD2 gene in the receptor B. cinerea.
[0012] Preferably, the method of homologous recombination involves introducing a homologous recombination fragment into the protoplast of the receptor B. cinerea.
[0013] The fifth objective of this invention is to provide the application of the above-mentioned method in the prevention and control of diseases caused by B. cinerea.
[0014] This invention provides the application of the FAD2 gene derived from *B. cinerea* in regulating the pathogenicity, growth rate, stress resistance, and cell wall integrity of the plant pathogenic fungus *B. cinerea*. Knockout of the FAD2 gene in wild-type *B. cinerea* significantly reduced pathogenicity, growth rate, stress resistance, and cell wall integrity. Therefore, the FAD2 gene can serve as a target for fungicides and a key protein in the pathogenic mechanism of diseases, enabling the development of agents for *B. cinerea*-infected diseases and the breeding of new resistant varieties, showing broad application prospects in the control of plant pathogenic fungal diseases. Attached Figure Description
[0015] Figure 1 This is a schematic diagram of the FAD2 gene knockout screening strategy for B. cinerea in this invention;
[0016] Figure 2 This is a spectrum of the plasmid pCT74 of this invention;
[0017] Figure 3 This is a schematic diagram of microscopic observation of the knocked-out protoplasts according to the present invention;
[0018] Figure 4 The image shows the PCR electrophoresis pattern used in the knockout detection of this invention (Note: M: marker; 1: 4F / HYG-1R (2594 bp); 2: HYG-1F / 4R (2248 bp); 3: HYG-F / HYG-R (1376 bp); 4: 2F / 2R (1446 bp)).
[0019] Figure 5 This is a diagram showing the growth of the hyphae of the wild-type and Δfad2 knockout mutant B. cinerea on a PDA.
[0020] Figure 6 This is a colony growth diagram of the hyphae of wild-type B. cinerea and Δfad2 knockout mutant under different stress conditions.
[0021] Figure 7 This is a graph showing the colony growth inhibition rate of wild-type B. cinerea and Δfad2 knockout mutant hyphae under different stress conditions.
[0022] Figure 8 The results of the pathogenicity test of the mycelium of wild-type B. cinerea and Δfad2 knockout mutant on tomato fruit are presented in this invention.
[0023] Figure 9The results show the pathogenicity of the mycelium of the wild-type B. cinerea and Δfad2 knockout mutant to tomato leaves. Detailed Implementation
[0024] The present invention will be described in detail below with reference to embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of application of the present invention. The present invention is not limited to the following embodiments or examples. Any modifications and variations made without departing from the spirit of the present invention should be included within the scope of the present invention. Unless otherwise specified, the experimental materials used in the following embodiments are commercially available.
[0025] In the following examples, the wild-type B. cinerea strain GZFQ-1 was isolated and identified by the inventors' research group and deposited at the China General Microbiological Culture Collection Center (CGMCC3.20932). The genomic sequence of the FAD2 gene in this strain is shown in SEQ ID NO.1, the CDS sequence is shown in SEQ ID NO.2, and the encoded amino acid sequence is shown in SEQ ID NO.3.
[0026] Example 1 B. FAD2 gene knockout in cinerea
[0027] A schematic diagram illustrating the specific construction and screening strategy for FAD2 gene knockout mutants in B. cinerea is shown below. Figure 1 As shown, the specific steps include:
[0028] 1. Constructing the knockout gene fragment
[0029] 1) Amplification of upstream and downstream homologous sequences of the target gene: Using genomic DNA from the wild-type B. cinerea strain CGMCC3.20932 as a template, the upstream A fragment was amplified using primers 1F and 1R, and the downstream B fragment was amplified using primers 3F and 3R. A reverse complementary sequence of primer HYG-F was added to the 5' end of primer 1R, and a reverse complementary sequence of primer HYG-R was added to the 5' end of primer 3F. The sequences (5' to 3') of primers 1F, 1R, 3F, 3R, HYG-F, and HYG-R are as follows:
[0030] 1F: GGAGATGTATCAGGGTGGCA;
[0031] 1R:ACCTCCACTAGCTCCAGCCAAGTGTGTAGAGGGAGGAAGAGGG;
[0032] 3F: GAATAGAGTAGATGCCGACCGGGACACTCTTTGCATACTATCGCTT;
[0033] 3R: TCGTCTATTTTCCTCCTCGGC;
[0034] HYG-F: CTTGGCTGGAGCTAGTGGAGGT;
[0035] HYG-R:CCCGGTCGGCATCTACTCTATTC.
[0036] 2) Amplification of the hygromycin resistance gene hph: Using plasmid pCT74 as a template, the first half (H1, 1094 bp) of the hygromycin resistance gene was amplified using primers HYG-F and HYG-1R; the second half (H2, 748 bp) of the hygromycin resistance gene was amplified using primers HYG-1F and HYG-R. The sequences of primers HYG-1F and HYG-1R (5' to 3' ends) are as follows:
[0037] HYG-1F: CGTTGCAAGACCTGCCTGAA;
[0038] HYG-1R:GGATGCCTCCGCTCGAAGTA.
[0039] 3) Fusion of upstream and downstream fragments of the target gene with the hygromycin resistance gene: Overlapping PCR was used to overlap the recovered A and B fragments with the H1 and H2 fragments, respectively, to obtain the A-H1 and H2-B ligation fragments. The A-H1 and H2-B fragments were amplified using primers 1F / HYG-1R and HYG-1F / 4R, respectively, and the knockout fragments were purified to achieve a concentration of 500 ng / μL.
[0040] 2. Preparation of B. cinerea protoplasts
[0041] 1) Inoculate B. cinerea onto potato dextrose agar (PDA) medium and culture at 25°C for 3 days. Then, use an inoculation needle to cut three fresh mycelial discs at the edge of the colony and inoculate them into 100 mL of PDB medium. Culture at 25°C and 180 rpm for 2 days until fresh mycelia are generated.
[0042] 2) Grind the cultured fresh mycelium using a grinder, transfer it to YEPD medium, and incubate at 20°C and 160 rpm for 20 h with shaking until fresh mycelium is generated. Filter and collect the fresh mycelium of Botrytis cinerea, and wash with 0.6 M potassium chloride.
[0043] 3) Using 30 mL of 0.6 M potassium chloride solution as an osmotic stabilizer, prepare a mixed enzymatic hydrolysate of lysing enzyme and snailase, and filter the enzyme solution using a bacterial filter with a pore size of 0.22 μm.
[0044] 4) Transfer the enzyme solution to a 50 mL centrifuge tube, add mycelium at a ratio of enzyme solution to mycelium of 3:1, suspend the mycelium, and culture at 25°C and 100 rpm for 3 h to lyse the mycelium.
[0045] 5) After lysis, filter through 2-3 layers of sterile lens paper (fiber mesh size 45 ± 12 μm), wash with 0.6 mol / L potassium chloride, collect the filtrate, and centrifuge at 4000 rpm for 6 min at 4℃. Resuspend in 15 mL of 1.2 mol / L sorbitol buffer (STC) solution;
[0046] 4) Discard the supernatant, resuspend the protoplast pellet in 1 mL of STC buffer to prepare a solution with a concentration of 1×10⁻⁶. 7 Prepare a protoplast suspension of 1 protoplast per mL and place it on ice until needed.
[0047] 3. B. cinerea protoplast transformation
[0048] 1) Take 200 μL of protoplast suspension and add it to a 50 mL centrifuge tube. Add 10~20 μg of A-H1 and H2-B knockout transformation fragments, mix gently, and let stand on ice in the dark for 20 min.
[0049] 2) Add 150 μL of SPTC solution, mix gently, and let stand on ice for 10 min; add 200~600 μL of LSPTC sequentially, mix gently by turning, and let stand at room temperature in the dark for 20 min.
[0050] 3) Add the mixture evenly to 100 mL of TB3 medium that has been heated and then cooled to room temperature, and incubate at 20°C in the dark for 24 h.
[0051] 4) Cover the original TB3 medium with a layer of TB3 medium containing 50 μg / mL Hygromycin B, and incubate at 25℃ for about 3-4 days until transformants grow.
[0052] 4. PCR verification of transformants
[0053] After three generations of subculturing on PDA medium containing hygromycin, transformants of fad2 were obtained. DNA was extracted from the transformant colonies using the CTAB method, and PCR amplification was performed using four pairs of primers: primers HYG-F / HYG-R were used to detect homologous recombination between marker fragments and the presence of the hph gene; primers 2F / 2R were used to detect whether the target gene was knocked out; primer 4F / HYG-1R was used to detect upstream homologous recombination; and primers HYG-1F / 4R were used to detect downstream homologous recombination. The sequences (5' to 3' ends) of primers 2F, 2R, 4F, and 4R are as follows:
[0054] 2F: CCTTCAACTCGCTCTTCAA;
[0055] 2R: GACTTCAGCCAAAAGAGGTA;
[0056] 4F:CAGAGGAAGTTTTTGATAGAAAGCA;
[0057] 4R: TATTGGACTGCACGCACGAT.
[0058] Homologous recombination was used to transform the gene knockout fragment into *B. cinerea* protoplasts, yielding hygromycin-positive transformants. PCR validation analysis of these positive transformants was performed using hph gene-specific primers, and the results are as follows: Figure 3 As shown, the hph gene, upstream homologous recombination, and downstream homologous recombination were detected in the transformants, and the FAD2 gene was not amplified in the electrophoresis diagram. Therefore, the corresponding positive transformants were obtained, i.e., the Δfad2 knockout mutants were obtained.
[0059] Example 2 B. Phenotypic observation and stress resistance analysis of wild-type cinerea and Δfad2 knockout mutants
[0060] 1. Colony morphology observation and growth rate determination
[0061] Wild-type B. cinerea and the knockout mutant fad2 were inoculated onto PDA medium and cultured in the dark at 25°C. The colony diameter was measured using the cross-hatching method after 4 days, and the colony morphology was observed. Each treatment was replicated in triplicate.
[0062] The colony morphology and growth rate of B. cinerea wild-type and knockout mutant Δfad2 on PDA medium are as follows: Figure 5 As shown (where, Figure 5 A shows the growth of B. cinerea wild-type strain and knockout mutant strain Δfad2 on PDA medium 4 days after inoculation; Figure 5 B represents the colony growth rate of wild-type B. cinerea and the gene knockout strain fad2 on PDA medium 4 days after inoculation. The ordinate represents the measured diameter of the lesion. The values are based on the mean of three independent experiments and were analyzed using Duncan's new multiple range method (p < 0.05). The colony morphology and growth rate of the B. cinerea knockout mutant Δfad2 on PDA medium were lower than those of the wild-type B. cinerea, and there were fewer aerial hyphae, indicating that the FAD2 gene affects the vegetative growth of B. cinerea.
[0063] 2. Analysis of stress resistance
[0064] 1) Analysis of high osmotic pressure stress
[0065] Wild-type B. cinerea and knockout mutant Δfad2 were inoculated onto PDA medium containing 1.0 mol / L NaCl and 1 mol / L sorbitol, respectively. After incubation at 25°C inverted for 4 days, the colony growth of knockout mutant Δfad2 and wild-type strains was observed.
[0066] 2) Oxidative stress analysis: Wild-type B. cinerea and knockout mutant Δfad2 were inoculated on PDA medium containing 20 mmol / L H2O2 and incubated upside down in an incubator at 25 ℃ for 4 days. The colony growth of knockout mutant Δfad2 and wild-type was then observed.
[0067] 3) Cell membrane integrity analysis
[0068] Wild-type B. cinerea and knockout mutant Δfad2 were inoculated onto PDA medium containing 100 μg / mL sodium dodecyl sulfate (SDS) and incubated upside down in an incubator at 25°C for 4 days. The colony growth of knockout mutant Δfad2 and wild-type strains was then observed.
[0069] 4) Cell wall integrity analysis
[0070] Wild-type B. cinerea and knockout mutant Δfad 2 were inoculated onto PDA medium containing 300 μg / mL Congo red and incubated upside down in an incubator at 25 ℃ for 4 days. The colony growth of knockout mutant Δfad 2 and wild-type strains was then observed.
[0071] Measure the colony diameter of all strains (using the cross-hatching method) and record the data by photograph. Calculate the growth inhibition rate of the strains = (colon diameter of control strain - colony diameter of treated strain) / colony diameter of control strain * 100%.
[0072] The growth of B. cinerea's Δfad2 knockout mutant and wild type under different stress conditions is as follows: Figure 6 As shown (where A~E represent the growth of B. cinerea knockout mutant strains on culture media under different stress conditions; F~J represent the growth of B. cinerea wild-type strains on culture media under different stress conditions; 1 mol / L sorbitol: containing a final concentration of 1 mol / L sorbitol; 20 mmol / L H2O2: containing a final concentration of 20 mmol / L H2O2; 300 μg / mL Congo red: containing a final concentration of 300 μg / mL Congo red; 1 mol / L NaCl: containing a final concentration of 1 mol / L NaCl; 100 μg / mL SDS: containing a final concentration of 100 μg / mL SDS; scale bar is 1 cm), the relative growth inhibition rate of colonies under different stress conditions is as follows: Figure 7 As shown (the vertical axis represents the relative growth inhibition rate, and the values are the mean of three independent experiments, and the data were analyzed using Duncan's new multiple range method (p < 0.05)). Figure 7 From left to right, the figures show the relative growth inhibition rates of the wild-type and Δfad 2 knockout mutant colonies under Sorbitol, H2O2, Congo red, NaCl, and SDS stresses, analyzed using Duncan's new multiple range method (p < 0.05). Figure 6 and Figure 7 It was found that in PDA medium containing 1 mol / L sorbitol, 20 mmol / L H2O2, and 200 μg / mL Congo red, the relative growth inhibition rate of the Δfad2 knockout mutant colonies was significantly higher than that of the wild type, indicating that knockout of the FAD2 gene increases the sensitivity of mycelia to sorbitol, H2O2, and Congo red. In conclusion, knockout of the FAD2 gene inhibited the growth rate of *B. cinerea* and significantly increased its sensitivity to sorbitol, oxidative stress, and Congo red, suggesting that knockout of the FAD2 gene reduces the tolerance of *B. cinerea* to osmotic stress and oxidative stress, and decreases the cell wall integrity of *B. cinerea*.
[0073] Example 3 Pathogenicity analysis of Δfad2 knockout mutant
[0074] Wild-type B. cinerea and Δfad2 knockout mutant were inoculated onto PDA medium and incubated upside down in a 25°C incubator for 4 days. Using a sterile punch with a diameter of 4 mm, bacterial discs were collected from the edge of the colony and inoculated onto the surface of tomato fruits and leaves. Disease incidence was investigated 2 days later.
[0075] The pathogenicity test results of B. cinerea's Δfad2 knockout mutant in tomato are as follows: Figure 8 and Figure 9 As shown, where, Figure 8 A shows the lesions on tomato fruits 2 days after inoculation with wild-type B. cinerea and knockout mutant strain Δfad2; Figure 8 Figure B shows the results of lesion area measurement on tomato fruits 2 days after inoculation with wild-type B. cinerea strain and knockout mutant Δfad2 mycelium. Figure 9 A shows the lesions on tomato leaves 2 days after inoculation with wild-type B. cinerea and knockout mutant strain Δfad2. Figure 9 Figure B shows the lesion area measurements of tomato leaves 2 days after inoculation with wild-type B. cinerea strain and knockout mutant Δfad2 mycelium. The vertical axis represents the measured lesion area, and the values are the mean of 20 independent experiments. Data analysis was performed using Duncan's new multiple range method (p < 0.05). Figure 8 and Figure 9 It can be seen that, compared with the wild type, the lesion area of the Δfad2 knockout mutant in tomatoes is significantly reduced, indicating that the pathogenicity of B. cinerea is significantly reduced after knocking out the FAD2 gene.
[0076] The conventional techniques and solutions not described in detail in the above embodiments are all well known in the art, and therefore will not be elaborated upon here. The above embodiments and / or experimental examples describe the preferred embodiments of the present invention in detail. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solutions of the present invention, and these simple modifications all fall within the protection scope of the present invention.
Claims
1. FAD2 Genes regulate botrytis cinerea ( Botrytis cinerea Its application in pathogenicity and / or growth rate and / or resistance to adversity and / or cell wall integrity, characterized in that, The FAD2 The nucleotide sequence of the gene is shown in SEQ ID NO. 1 or SEQ ID NO. 2; the regulation is to reduce FAD2 Gene expression reduces the pathogenicity and / or growth rate of Botrytis cinerea and / or the resistance to adverse conditions and / or the cell wall integrity; the adverse conditions are osmotic stress and / or oxidative stress; the osmotic stress is caused by sorbitol.
2. FAD2 The application of genes as targets in the design and screening of antifungal drugs is characterized by, The FAD2 The nucleotide sequence of the gene is shown in SEQ ID NO.1 or SEQ ID NO.2; the fungus is Botrytis cinerea.
3. FAD2 The application of the gene in the cultivation of transgenic Botrytis cinerea with reduced pathogenicity and / or reduced growth rate and / or reduced stress resistance and / or reduced cell wall integrity is characterized by, The FAD2 The nucleotide sequence of the gene is shown in SEQ ID NO. 1 or SEQ ID NO. 2; the application is to reduce... FAD2 This is achieved through gene expression.
4. A method for cultivating transgenic Botrytis cinerea with reduced pathogenicity and / or reduced growth rate and / or reduced stress resistance and / or reduced cell wall integrity, characterized in that, Including reducing receptors in Botrytis cinerea FAD2 The steps of obtaining transgenic botrytis cinerea by measuring gene expression levels and / or activity, as described above. FAD2 The nucleotide sequence of the gene is shown in SEQ ID NO.1 or SEQ ID NO.2; the stress is osmotic stress and / or oxidative stress; the osmotic stress is caused by sorbitol.
5. The method as described in claim 4, characterized in that, The reduced receptor Botrytis cinerea FAD2 The method for determining gene expression levels and / or activity is by analyzing the expression levels and / or activity of the receptor Botrytis cinerea. FAD2 This is achieved by knocking out, suppressing, or silencing gene expression.
6. The method as described in claim 5, characterized in that, The knockout method is homologous recombination.
7. The method as described in claim 6, characterized in that, The method of homologous recombination involves introducing a homologous recombination fragment into the protoplast of the recipient Botrytis cinerea.