A rice OsRbohB protein, its encoding gene, and its applications.

By overexpressing the OsRbohB protein in rice, constructing an overexpression vector using the maize Ubi promoter, and transforming it, the shortcomings of existing technologies in regulating rice plant height, stem diameter, number of grains per panicle, and grain length by the OsRbohB gene were overcome, resulting in a significant increase in the height, diameter, and grain length of rice plants.

CN120905169BActive Publication Date: 2026-01-30AGRO BIOLOGICAL GENE RES CENT GUANGDONG ACADEMY OF AGRI SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511445481.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-10-11
Publication Date
2026-01-30
Estimated Expiration
2045-10-11

AI Technical Summary

Technical Problem

In existing technologies, overexpression or silencing of the OsRbohB gene can lead to changes in rice leaf color and reduced fertility. There is a lack of functional genes that can effectively regulate rice plant height, stem diameter, number of grains per panicle, and grain length.

Method used

By overexpressing the OsRbohB protein or its encoding gene in rice, and integrating it into the pCAMBIA1380 vector using the maize Ubi promoter and multiple cloning site sequence, the overexpression vector pCAMBIA1380-Pubi::OsRbohB-OE was constructed. OsRbohB was then overexpressed in rice using Agrobacterium-mediated transformation.

Benefits of technology

It significantly increased the expression level of OsRbohB, enhanced the plant height, stem thickness, number of grains per panicle and grain length of rice, and improved the agronomic traits of rice, especially increasing plant height by 22.2%~31.9%, number of grains per panicle by 36.7%~40.5%, grain length by 24%~25.1%, and grain length-to-width ratio by 51.1%~53.1%.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120905169B_ABST
    Figure CN120905169B_ABST
Patent Text Reader

Abstract

This invention discloses a rice OsRbohB protein, its encoding gene, and its applications. The amino acid sequence of the OsRbohB protein is shown in SEQ ID NO.2, and the nucleotide sequence of its encoding gene is shown in SEQ ID NO.1. This invention provides a rice transformation overexpression vector that overexpresses the OsRbohB gene using the ZmUbi promoter. The plant height, number of grains per panicle, and grain length of the overexpressed plants were significantly increased. This invention is the first to demonstrate that rice OsRbohB is a functional gene regulating rice plant height, number of grains per panicle, and grain length. The cloning and biological function verification of this gene have important reference value for the study of the molecular mechanisms regulating important agronomic traits in rice. Since the above traits are important traits related to rice plant type and yield, the functional analysis of OsRbohB in this invention provides a new candidate gene for rice design breeding and has great potential application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering and genetic improvement technology, specifically relating to a rice OsRbohB protein, its encoding gene, and its applications. Background Technology

[0002] NADPH oxidase / RBOH (Respiratory Burst Oxidase Homolog) is a key enzyme in the production and accumulation of ROS in cells. Its function is closely related to ROS and it is widely involved in a series of important physiological processes in plants, including responses to abiotic stresses such as pathogens, drought, salt, and heavy metals, as well as cell differentiation, root hair development, pollen tube elongation, seed after-ripening, and seed germination. In plant genomes, RBOH exists as a multi-gene family. For example, 10 and 9 RBOH homologs have been identified in Arabidopsis and rice, respectively. These genes encode 727–1033 amino acids, with predicted molecular weights ranging from 83.4 to 115.0 kDa. They all possess four conserved functional domains: NADPH_Ox, Ferric_reduct, FAD_binding_8, and NAD_binding_6, as well as a transmembrane domain and a Ca2+ domain. 2+ Combined with the EF-hand structure, their proteins have similar structures but diverse functions. Compared to the wild type, AtrbohC The mutant is root hair defective mutant 2. rhd2 The number of root hairs was significantly reduced and their length shortened by 20%; while AtrbohD / F Double mutants lead to O2 •- Accumulation occurs locally in the main root, promoting the formation of lateral roots and increasing their density. AtRbohE This gene regulates programmed cell death in the tapetum layer; mutations in this gene lead to pollen abortion and reduced fertility. AtRbohH / J It participates in regulating pollen tube growth and seed development; double mutations lead to reduced fertility and inhibited pollen tube growth. AtRbohB This gene is involved in regulating seed after-ripening; mutations in this gene lead to weakened endosperm and delayed seed germination. In rice, OsRbohA This gene is involved in the regulation of rice development, and mutations in this gene lead to a decrease in plant biomass, reduced fertility, and decreased seed germination rate. OsRbohB Mediated ROS generation plays a crucial role in drought resistance in rice; and OsRbohH It then participates in the formation of root aeration tissue induced by ethylene.

[0003] CN105505984A discloses overexpression in rice OsRbohB The gene resulted in transgenic plants with yellowing leaves, increased hydrogen peroxide content, and reduced fertility. CN105462983A discloses the silencing of genes in rice. OsRbohBThe gene was used to create transgenic plants whose leaves turned white and whose fertility was reduced. This indicates that... OsRbohB Overexpression or silencing of genes in rice can cause changes in leaf color and reduced fertility. Summary of the Invention

[0004] Based on the above problems, this invention provides a rice OsRbohB protein, its encoding gene, and its applications. Specifically, it relates to the application of the OsRbohB protein or its encoding gene in regulating rice plant height, stem diameter, number of grains per panicle, and grain length, and is involved in rice seed and seedling cultivation in bio-agriculture.

[0005] The first objective of this invention is to provide a rice OsRbohB protein, the amino acid sequence of which is shown in SEQ ID NO.2.

[0006] A second objective of this invention is to provide the gene encoding the OsRbohB protein described above, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0007] A third objective of this invention is to provide the application of the aforementioned OsRbohB protein or the aforementioned encoding gene in regulating rice plant height, stem diameter, number of grains per panicle, and / or grain length.

[0008] Preferably, it involves the application of overexpression of the above-mentioned coding genes in rice to increase plant height, stem thickness, number of grains per panicle, and / or grain length.

[0009] Preferably, the rice plant is a mature rice plant.

[0010] The fourth objective of this invention is to provide a method for promoting increased plant height, thicker stems, increased number of grains per panicle, and / or longer grains in rice plants, comprising the following steps: overexpressing the above-mentioned coding gene in rice, thereby increasing the expression level of the coding gene for OsRbohB protein by 4 to 6 times.

[0011] Preferably, the above-mentioned coding gene, along with the maize Ubi gene promoter and multiple cloning site sequence, are integrated into the pCAMBIA1380 vector, and the above-mentioned coding gene is positioned at the 3' end of the Ubi promoter to obtain the overexpression vector pCAMBIA1380-Pubi::OsRbohB-OE. The overexpression vector pCAMBIA1380-Pubi::OsRbohB-OE is then transformed into rice to obtain OsRbohB overexpression transgenic lines.

[0012] Preferably, the overexpression vector pCAMBIA1380-Pubi::OsRbohB-OE is constructed as follows: using pCAMBIA1380 as the backbone vector, homologous recombination is performed... Eco RI and Pml The maize Ubi gene promoter and multiple cloning site sequence were integrated into the backbone vector pCAMBIA1380 after double digestion with enzyme I to obtain the pCAMBIA1380-Pubi-OE vector. Then, the aforementioned coding gene was integrated into the vector via homologous recombination. Kpn I and Bam The overexpression vector pCAMBIA1380-Pubi-OE was obtained by double digestion of the pCAMBIA1380-Pubi-OE vector with HⅠ.

[0013] Preferably, the sequence of the maize Ubi gene promoter and multiple cloning site is shown in SEQ ID NO.3.

[0014] Preferably, the rice is the japonica rice variety Nipponbare.

[0015] This invention clones rice using RT-PCR. OsRbohB The gene and its complete CDS coding sequence (SEQ ID No: 1) were integrated into a genetically modified organism via homologous recombination. Kpn I (NEB) and Bam H I. The pCAMBIA1380-Pubi-OE overexpression intermediate vector, double-digested with (NEB), was positioned at the 3' end of the Ubi promoter and driven by it. OsRbohB overexpression transgenic lines were obtained using Agrobacterium-mediated transformation based on the japonica rice variety Nipponbare.

[0016] Agronomic traits such as plant height and number of grains per ear were measured between transgenic and non-transgenic wild-type plants, and T-TEST was used for statistical analysis to determine the significance of differences in plant height, stem diameter, number of grains per ear, and grain length between wild-type and transgenic plants. Figure 3 and 4 Meanwhile, using the plant height of non-transgenic wild-type plants as 100%, overexpression... OsRbohB Genetically modified plants exhibited larger flag leaves, thicker stems, and increased plant height by 22.2%–31.9%, with a 36.7%–40.5% increase in grain number per ear, but no significant change in seed setting rate; grain length increased by 24%–25.1%, and the grain length-to-width ratio improved by 51.1%–53.1%. These results indicate that… OsRbohB Gene overexpression can lead to larger leaves, thicker stems, increased plant height, increased number of grains per panicle, and longer grain length in mature rice plants.

[0017] Advantages of this invention:

[0018] 1. This invention is the first to demonstrate that rice... OsRbohB(Os01g0360200) is a functional gene that regulates rice plant height, stem diameter, number of grains per panicle, and grain length. The cloning and biological function verification of this gene are of great reference value for the study of the molecular mechanism of regulation of important agronomic traits in rice.

[0019] 2. This invention provides a rice transformation overexpression vector that utilizes the Ubi promoter to overexpress the OsRbohB gene. The overexpression-transformed plants exhibit significantly increased plant height, stem diameter, number of grains per panicle, and grain length. Since these traits are important characteristics related to rice plant architecture and yield, the functional analysis of OsRbohB in this invention provides a new candidate gene for rice design breeding, possessing significant potential application value. Attached Figure Description

[0020] Figure 1 The diagram shows the gene clone, gene structure, protein structure, and subcellular localization of OsRbohB in Example 1, where A is the OsRbohB gene clone; B is the gene Exon-Intron structure and protein domain; and C is the subcellular localization diagram.

[0021] Figure 2 In Example 2 OsRbohB Diagrams showing the construction of overexpression vectors and overexpression lines, where A is the map of the intermediate pCAMBIA1380-Pubi-OE overexpression vector; B is... OsRbohB Map of the overexpression vector pCAMBIA1380-Pubi::OsRbohB-OE; C is the PCR identification result of the T0 generation transgenic plants; D is the transcriptional level detection of the T3 generation homozygous overexpression lines OsRbohB-OE 11# and 16#.

[0022] Figure 3 The images show the phenotypic diagrams of plants, flag leaves, and stem nodes of the T3 generation homozygous overexpression OsRbohB-OE lines 11# and 16# in Example 2. A shows the phenotypic diagram of mature plants; B shows the statistical results of plant height at maturity; C shows the phenotypic diagram of the flag leaf of mature plants; D shows a paraffin section cross-section of the flag leaf of mature plants; E shows the phenotypic diagram of stem nodes 2-5 of mature plants; and F shows a paraffin section cross-section of the third internode.

[0023] Figure 4 The images show the ear and grain phenotypes of the T3 generation homozygous overexpression OsRbohB-OE lines 11# and 16# in Example 2. A represents the phenotype of the ear at maturity; B represents the statistical results of the total number of grains per ear and the number of grains per ear that are filling; C represents the statistical results of the seed setting rate; D represents the phenotype of grain shape and the length of unhulled and hulled grains; E represents the statistical results of grain length and grain width; and F represents the statistical results of the grain length-to-width ratio. Detailed Implementation

[0024] The following embodiments are further illustrations of the present invention, but not limitations thereof. Specific experimental conditions and methods are not specified in the following embodiments; the techniques used are generally conventional methods well known to those skilled in the art. Unless otherwise specified, the experimental materials used in the following embodiments can be purchased from conventional biochemical reagent companies.

[0025] Example 1: OsRbohB encodes a membrane-localized NADPH oxidase

[0026] (1) Take the leaf parts of rice Nipponbare seedlings, extract total RNA from the leaves using TriZol Reagent (Invitrogen), and detect the purity and amount of total RNA using formaldehyde denaturing gel electrophoresis and ultraviolet spectrophotometer.

[0027] (2) Take 1 μg of total RNA to initiate the reverse transcription reaction. The reverse transcriptase used is PrimeScript (TAKARA, catalog number RR047A). Refer to the instructions for use of this reverse transcriptase for the reverse transcription reaction steps. Using the reverse transcription product as a template, PCR amplification was performed using the OsRbohB-F / R primer pair (SEQ ID NO.4 and SEQ ID NO.5). The polymerase used for PCR was KOD FX (Toyobo, KFX-101). The reaction system was 50 μL, and the PCR reaction system was prepared according to the instructions for KOD FX. The reaction conditions were: 94℃ for 5 min; 94℃ for 30 sec, 56℃ for 30 sec, 68℃ for 2 min, 35 cycles; 68℃ for 10 min. PCR amplification yielded a fragment of approximately 2983 bp.

[0028] (3) After recovering the fragment using the direct purification method of PCR product, 40 μL of the recovered product, 2 μL of Ex Taq enzyme (TAKARA, RR001Q), 5 μL of Ex Taq Buffer, and 3 μL of dNTPs were added to a 50 μL reaction system and incubated at 72℃ for 20 min to add an A tail to the 3' end of the PCR fragment. After the reaction, the tailed fragment was recovered and ligated to the pMD18-T vector (which has a 3' T tail). All ligation products were taken and transformed into Escherichia coli DH5α by heat shock at 42℃. The transformation products were plated on LB solid medium containing 100 mg / L ampicillin resistance. After overnight incubation at 37℃, 10 positive white single clones were selected for plasmid extraction, enzyme digestion identification, and two positive clones were selected for sequencing to obtain Escherichia coli DH5α containing the pMD18T-OsRbohB plasmid. The sequencing results showed that the full-length sequence was 2983 bases and contained one open reading frame, i.e. OsRbohB A gene, which is 2718 base pairs in size ( Figure 1 A), whose nucleotide sequence is shown in SEQ ID NO.1, encodes a protein with 905 amino acid residues, whose amino acid sequence is shown in SEQ ID NO.2. OsRbohB The exon-intron structure and protein domain of genes, such as Figure 1 As shown in B in the diagram.

[0029] (4) Construct the pSAT6-2x35S::OsRbohB-GFP fusion vector. Using primer pair OsRbohB-sub_F / R (SEQ ID NO.6 and SEQ ID NO.7), and with pMD18T-OsRbohB plasmid as a template, amplify the full-length OsRbohB CDS sequence by PCR. Then, use the Seamless Cloning Kit (Beyotime, D7010S) for homologous recombination into the GFP fusion vector. Nco I and Bam pSAT6-2x35S::eYFP vector was double-digested with HⅠ to obtain pSAT6-2x35S::OsRbohB-eYFP. pSAT6-2x35S::OsRbohB-eYFP and pSAT6-2x35S::eYFP (control) were transiently transformed into rice protoplast cells (refer to Jiang et al., 2018; Bio-101 e1010125) with WI solution [0.6 mol L]. −1 mannitol, 4 mmol L −1 KCl, and 4 mmol L -1 MES (pH 5.7) was incubated in the dark at 28°C for 16-18 h. The yellow fluorescence signal of eYFP was observed and photographed using a Zeiss LSM 710 laser confocal scanning microscope. Figure 1 As shown in C, OsRbohB is located on the cell membrane.

[0030] Example 2: OsRbohB Construction of overexpression vectors and acquisition of overexpression rice lines

[0031] To construct the OsRbohB overexpression vector, the complete CDS coding sequence (SEQ ID NO.1) was amplified by PCR using primer pair OsRbohB-OE-F / R (SEQ ID NO.8 and SEQ ID NO.9) and pMD18T-OsRbohB plasmid as a template. The sequenced-verified amplified fragment was integrated into the pMD18T-OsRbohB plasmid using the Seamless Cloning Kit (Beyotime, D7010S). Kpn I (NEB) and Bam H I. (NEB) Double-digested pCAMBIA1380-Pubi-OE vector [This vector uses pCAMBIA1380 as a backbone and is digested using a homologous recombination kit...] Eco RI and Pml I double digestion was performed to integrate the maize Ubi gene promoter and multiple cloning site (MCS) sequence (SEQ ID NO.3) into the backbone vector to obtain the pCAMBIA1380-Pubi-OE vector. Figure 2 [A], placing it at the 3' end of the Pubi promoter and driving it, thereby obtaining the overexpression vector pCAMBIA1380-Pubi::OsRbohB-OE plasmid ( Figure 2 (B in the middle).

[0032] The constructed overexpression vector was transformed into the normal japonica rice variety Nipponbare using Agrobacterium EHA105-mediated genetic transformation. The rice transformation work was entrusted to Wuhan Boyuan Biotechnology Co., Ltd., and the general process was as follows: Agrobacterium EHA105 containing the pCAMBIA1380-Pubi::OsRbohB-OE plasmid was used to infect callus tissue of the japonica rice variety Nipponbare. The callus tissue was then transferred to a co-medium (N6 medium as the basal medium, supplemented with 0.6 g / L proline, 0.6 g / L hydrolyzed casein, 2.0 g / L 2,4-D, 30 g / L sucrose, 3.0 g / L plant gel, 100 μM acetylsylcholine, pH 5.7) and incubated in the dark at 26°C for 2-4 days. After washing, the callus tissue was transferred to a selective medium containing hygromycin (N6 medium as the basal medium, supplemented with 1.4 g / L proline, 0.6 g / L hydrolyzed casein, 2.0 g / L 2,4-D, 30 g / L sucrose, 3.0 g / L plant gel, 300 mg / L thiazolyl acetylsylcholine, 60... Resistance selection was performed on hygromycin (MS medium, pH 5.8) at 28℃, 14 h light / 10 h dark. The selected resistant calluses were transferred to pre-differentiation medium (MS medium supplemented with hydrolyzed casein 2.0 g / L, KT 2.0 mg / L, NAA 0.3 mg / L, sucrose 30 g / L, plant gel 3.0 g / L, 60 mg / L hygromycin, pH 5.8) and cultured under light (28℃, 14 h light / 10 h dark) for 10-14 days. Then, they were transferred to differentiation medium (MS medium supplemented with KT 3.0 mg / L, NAA 0.5 mg / L, sucrose 30 g / L, plant gel 3.0 g / L, 60 mg / L hygromycin, pH 5.8) and cultured under light (28℃, 14 h light / 10 h dark). Once the seedlings reached 2-4 cm in size... At cm, the plants were transferred to rooting medium (basal medium was 1 / 2 MS medium, supplemented with NAA 0.5 mg / L, sucrose 15 g / L, plant gel 2.5 g / L, 60 mg / L hygromycin, pH 5.8; 1 / 2 MS medium was MS medium with macro-element concentrations halved, other component concentrations unchanged) for 3 weeks of growth (28℃, 14 h light / 10 h dark). After hardening off the T0 generation seedlings (adding water to cover the medium for 3 days), they were transplanted into soil. The transformed primary (T0 generation) plants were then tested using PCR (SEQ ID NO. 10 and SEQ ID NO. 11) of the marker gene Hyg and quantitative PCR of the target gene OsRbohB (fluorescent quantitative PCR detection steps are described below). Positive transformed plants were identified at both DNA and RNA levels, proving that the target gene OsRbohB had been transformed into rice and that the expression level of the target gene had been increased. The PCR identification results of the marker gene Hyg in the T0 generation transgenic plants are shown below. Figure 2 C in the middle.

[0033] PCR amplification of the marker gene Hyg was performed using the EX Taq DNA Polymerase kit (TAKARA, catalog number RR001A). The reaction mixture consisted of: 2.5 μL 10×Ex Taq buffer, 1.0 μL dNTPs (10 μM), 1.0 μL Template DNA (approximately 50 ng), 1.0 μL Hyg-F primer (10 μM), 1.0 μL Hyg-R primer (10 μM), 0.5 μL Ex Taq DNA Polymerase (2.5 U), and 18 μL ddH2O. The reaction program was: 95℃ for 3 min; 95℃ for 15 sec, 60℃ for 15 sec, 72℃ for 30 sec, 35 cycles; 72℃ for 5 min; and stored at 4℃.

[0034] In a controlled greenhouse, transgenic positive plants were self-pollinated to obtain homozygous positive F1 (T1) lines. Ten plants from each line, testing positive by PCR, were selected for propagation to obtain T2 lines. The T2 lines were then subjected to further PCR testing to identify two homozygous T3 lines (OE-11 and OE-16) derived from different T0 lines. Quantitative real-time PCR was performed on the leaves of seedlings from both lines to detect the expression levels of the target gene, using the results from the wild-type (japonica rice variety Nipponbare) as a control. Figure 2 (D in the middle).

[0035] The procedure for identifying the overexpression effect of the OsRbohB gene in transgenic plants by quantitative real-time PCR is as follows:

[0036] (1) Total RNA was extracted from spikelets at the initial heading stage of transgenic plants that tested positive by PCR. The reagent used was TriZol Reagent (Invitrogen, catalog number: 15596026). The procedure was performed according to the instructions of the reagent. The purity and amount of total RNA were detected by formaldehyde denaturing gel electrophoresis and ultraviolet spectrophotometer.

[0037] (2) Take 1 μg of total RNA to initiate the reverse transcription reaction. The reverse transcriptase used is PrimeScript (Takara, catalog number RR047A). Refer to the instructions for use of this reverse transcriptase for the reverse transcription reaction steps. Using the reverse transcription product as a template, the expression of the target gene was detected using primer pair OsRbohB-qF / qR (SEQ ID NO.12 and SEQ ID NO.13).

[0038] (3) The expression of the rice GADPH gene was detected using the primer pair OsGAPDH-F / R (SEQ ID NO.14 and SEQ ID NO.15) as an internal control, and the quantitative PCR reagent was SYBR. ® Premix Ex Taq™ (TAKARA, catalog number DRR420A), quantitative PCR instrument was CFX 96 (BIO-RAD).

[0039] The relative mRNA expression levels of OsRbohB in the two transgenic homozygous lines (OE-11# and OE-16#) and the wild-type plant (WT) are as follows: Figure 2 As shown in D, the results indicate that the two lines, compared to the wild type, OsRbohB The expression levels of these substances were significantly increased by 4 to 6 times.

[0040] Example 3: OsRbohB Significant differences were observed in plant height, stem diameter, number of grains per panicle, and grain length among overexpressed rice lines.

[0041] In Example 2, two homozygous overexpressing transgenic homozygous T3 generation lines (OsRbohB-OE-11# and OsRbohB-OE-16#) and wild-type (WT, japonica rice variety Nipponbare) rice seeds were surface-sterilized with 70% ethanol for 1 minute; then with 2.5% (active chlorine content) NaClO solution for 20 minutes; rinsed 4-5 times with sterile water, and germinated at 30℃ in the dark for 3 days. The seedlings were then transferred to soil and grown to the three-leaf stage, then transplanted to plastic trays and cultured until maturity (fully mature). Agronomic traits such as plant height, flag leaf, stem diameter, number of grains per panicle, and grain length of transgenic and non-transgenic wild-type plants were measured and photographed. T-TEST was used for statistical analysis to determine the significance of differences in plant height, stem diameter, number of grains per panicle, and grain length between wild-type and transgenic plants. Figure 3 and Figure 4 Meanwhile, using the plant height of non-transgenic wild-type plants as 100%, overexpression... OsRbohB The OsRbohB gene resulted in larger flag leaves, thicker stems, and increased plant height (22.2%–31.9%) and number of grains per panicle (36.7%–40.5%) in the genetically modified rice plants, but without a significant change in seed setting rate. Grain length increased by 24%–25.1%, and the grain length-to-width ratio improved by 51.1%–53.1%. These results indicate that overexpression of the OsRbohB gene leads to larger leaves, thicker stems, increased plant height, increased number of grains per panicle, and longer grain length in mature rice plants.

[0042] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention. Therefore, the scope of protection of this patent should be determined by the appended claims.

[0043] SEQ ID NO.1 ( OsRbohB (nucleotide sequence)

[0044] ATGGCTGACCTGGAAGCA GACCCATTTCGCACGACCTA ATTGGCGAAGCGTCTTCAAGAAGGTTGCGGTCAGCCATGAGAACCAGCGCGTCGGTGTGTTCTACTGTGGTGAGCCTG TGCTGGTTCCCCAACTAAGG CAGTTGTCAGCAGATTTCACCCACAAGACAAACACAAG ATTTGATTTCCACAAGGAGAACTTC TAA

[0045] SEQ ID NO.2 (Amino acid sequence of OsRbohB)

[0046] MADLEAGMVAAATDQGNSTRSQDDAATLIPNSGNLGSSNRSTKTARFKDDDELVEITLDVQRDSVAIQEVRGVDEGGSGHGTGFDGLPLVSPSSKSGKLTSKLRQVTNGLKMKSSSRKAPSPQAQQSAKRVRKRLDRTKSSAAVALKGLQFVTAKVGNDGWAAVEKRFNQLQVDGVLLRSRFGKCIGMDGSDEFAVQMFDSLARKRGIVKQVLTKDELKDFYEQLTDQGFDNRLRTFFDMVDKNADGRLTAEEVKEIIALSASANKLSKIKERADEYTALIMEELDPTNLGYIEMEDLEALLLQSPSEAAARSTTTHSSKLSKALSMKLASNKEMSPVRHYWQQFMYFLEENWKRSWVMTLWISICIALFIWKFIQYRNRAVFGIMGYCVTTAKGAAETLKFNMALVLLPVCRNTITWIRSKTQVGAVVPFNDNINFHKVIAAGVAVGVALHAGAHLTCDFPRLLHASDAQYELMKPFFGEKRPPNYWWFVKGTEGWTGVVMVVLMAIAFTLAQPWFRRNKLKDSNPLKKMTGFNAFWFTHHLFVIVYTLLFVHGTCLYLSRKWYKKTTWMYLAVPVVLYVSERILRLFRSHDAVGIQKVAVYPGNVLALYMSKPPGFRYRSGQYIFIKCTAVSPYEWHPFSITSAPGDDYLSVHIRTRGDWTSRLRTVFSEACRPPTEGESGLLRADLSKGITDEKARFPKLLVDGPYGAPAQDYREYDVLLLIGLGIGATPLISIVKDVLNHIQGEGSVGTTEPESSSKAKKKPFMTKRAYFYWVTREEGSFEWFRGVMNEVSEKDKDGVIELHNHCSSVYQEGDARSALIVMLQELQHAKKGVDILSGTSVKTHFARPNWRSVFKKVAVSHENQRVGVFYCGEPVLVPQLRQLSADFTHKTNTRFDFHKENF

[0047] SEQ ID NO.3 (ZmUbi promoter and multiple cloning site sequence, 2039 bp in total)

[0048]

[0049] SEQ ID NO.4 (OsRbohB-F, forward primer for gene cloning)

[0050] ACATGGCTGACCTGGAAGCA

[0051] SEQ ID NO.5 (OsRbohB-R, reverse primer for gene cloning)

[0052] AGGCATCCTTTGGTCACAACA

[0053] SEQ ID NO.6 (OsRbohB-sub_F, forward primer for subcellular localization vector construction)

[0054] atttacgaacgatagccatggATGGCTGACCTGGAAGCAGG

[0055] SEQ ID NO.7 (OsRbohB-sub_R, reverse primer for subcellular localization vector construction)

[0056] ccttgctcaccatcaggatccGAAGTTCTCCTTGTGGAAATCAAAT

[0057] SEQ ID NO.8 (OsRbohB-OE_F, forward primer for overexpression vector construction)

[0058] gtgttatacttctgcagggtaccATGGCTGACCTGGAAGCAGG

[0059] SEQ ID NO.9 (OsRbohB-OE_R, reverse primer for overexpression vector construction)

[0060] taattcacacttgtaggatccTTAGAAGTTCTCCTTGTGGAAATCAA

[0061] SEQ ID NO.10 (Hyg-F, forward primer for identifying overexpressing transgenic plants)

[0062] ACGGTGTCGTCCATCACAGTTTGCC

[0063] SEQ ID NO.11 (Hyg-R, reverse primer for identifying overexpressing transgenic plants)

[0064] TTCCGGAAGTGCTTGACATTGGGGA

[0065] SEQ ID NO.12 (OsRbohB-qF, forward primer for quantitative PCR, across exons)

[0066] GACCCATTTCGCACGACCTA

[0067] SEQ ID NO.13 (OsRbohB-qR, reverse primer for quantitative PCR, across exons)

[0068] CCTTAGTTGGGGAACCAGCA

[0069] SEQ ID NO.14 (OsGAPDH-qF, forward primer for quantitative PCR of internal reference gene, across exons)

[0070] GCAATCAAGGAGGAGGCTGA

[0071] SEQ ID NO.15 (OsGAPDH-qR, reverse primer for quantitative PCR of internal reference gene, across exons)

[0072] ACGTGTCGCTCAAAGCAATG .

Claims

1. Application of overexpressing rice OsRbohB protein or its encoding gene in promoting rice grain length, wherein the amino acid sequence of the rice OsRbohB protein is shown as SEQ ID NO. 2, and the nucleotide sequence of the encoding gene is shown as SEQ ID NO.

1.

2. Use according to claim 1, characterized in that, The rice plant is a mature rice plant.

3. A method for promoting grain length in rice, the method comprising, The method comprises the following step: overexpressing the encoding gene of the OsRbohB protein in rice, so that the expression amount of the encoding gene of the OsRbohB protein is increased by 4-6 times, and the nucleotide sequence of the encoding gene is shown as SEQ ID NO.

1.

4. The method of claim 3, wherein, The encoding gene of the OsRbohB protein and the corn Ubi gene promoter and the multiple cloning site sequence are integrated into the pCAMBIA1380 vector, and the encoding gene of the OsRbohB protein is located at the 3' end of the Ubi promoter, to obtain the overexpression vector pCAMBIA1380-Pubi::OsRbohB-OE, and the overexpression vector pCAMBIA1380-Pubi::OsRbohB-OE is transformed into rice to obtain the OsRbohB overexpression transgenic line.

5. The method of claim 4, wherein, The overexpression vector pCAMBIA1380-Pubi::OsRbohB-OE is constructed as follows: using pCAMBIA1380 as a backbone vector, a corn Ubi gene promoter and a polylinker sequence are integrated into the backbone vector pCAMBIA1380 by homologous recombination to obtain a pCAMBIA1380-Pubi-OE vector, and then a coding gene of an OsRbohB protein is integrated into the pCAMBIA1380-Pubi-OE vector by homologous recombination to obtain the overexpression vector pCAMBIA1380-Pubi::OsRbohB-OE. Eco RI and Pml I double digestion, a corn Ubi gene promoter and a polylinker sequence are integrated into the backbone vector pCAMBIA1380 to obtain a pCAMBIA1380-Pubi-OE vector, and then a coding gene of an OsRbohB protein is integrated into the pCAMBIA1380-Pubi-OE vector by homologous recombination to obtain the overexpression vector pCAMBIA1380-Pubi::OsRbohB-OE. Kpn I and Bam The overexpression vector pCAMBIA1380-Pubi::OsRbohB-OE is constructed as follows: using pCAMBIA1380 as a backbone vector, a corn Ubi gene promoter and a polylinker sequence are integrated into the backbone vector pCAMBIA1380 by homologous recombination to obtain a pCAMBIA1380-Pubi-OE vector, and then a coding gene of an OsRbohB protein is integrated into the pCAMBIA1380-Pubi-OE vector by homologous recombination to obtain the overexpression vector pCAMBIA1380-Pubi::OsRbohB-OE.

6. The method of claim 5, wherein, The corn Ubi gene promoter and the multiple cloning site sequence are shown as SEQ ID NO.

3.

7. The method of claim 6, wherein, The rice is japonica variety Nipponbare.

Citation Information

Patent Citations

  • amiRNA for inhibiting rice gene OsRboh(LOC_Os01g25820)

    CN105462983A

  • Vector of rice respiratory burst oxidase gene OsRboh(LOC_Os01g25820) and application thereof

    CN105505984A