Chitinase mutant and application thereof in promoting plant growth

Abstract

The invention belongs to the technical field of microorganisms and genetic engineering, and particularly relates to a chitinase mutant and application thereof in promoting plant growth. According to the present invention, by using the error-prone PCR technology, the direct evolution is performed on the wild type chitinase in vitro so as to obtain the chitinase mutant with significantly improved enzyme activity and significantly improved environmental stability; the enzyme activity of the mutant is 1051.36 U / mL under the conditions that the temperature is 50 DEG C and the pH value is 7 and is about 2.7 times that of wild chitinase (385.45 U / mL), and the mutant not only has a good killing effect on pests such as lepidoptera pests, thysanoptera pests and coleoptera pests, but also has good bacteriostatic activity on pathogenic bacteria such as phytophthora capsici, pythium aphanidermatum, botrytis cinerea, potato early blight and corn curvularia, and has good application prospects. The fertilizer is used for growth and development of vegetable plants or grain plants, and can promote plant growth and significantly improve the yield and quality of plants.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of microorganisms and genetic engineering, and particularly relates to a chitinase mutant and application thereof in promoting plant growth. BACKGROUND

[0002] Chitin is a natural high-molecular polysaccharide formed by N-acetylglucosamine through beta-1, 4-glycosidic bond, and is the main structural component of insect exoskeleton and egg shell, the shell of some crustaceans, and the cell wall of many fungi. Chitinase is a kind of glycoside hydrolase that can specifically act on chitin glycosidic bond and hydrolyze chitin into oligosaccharides. Chitinase can play a biological control role through mechanisms such as hydrolyzing pathogenic fungal cell walls, destroying pest body walls, and synergizing insecticidal effects. The target of chitinase (chitin) only exists in invertebrates, fungi and other organisms, and is completely absent in higher plants and animals. This unique target specificity makes chitinase have no toxic effect on higher plants and animals. The biological control technology developed based on chitinase not only can precisely act on target organisms, but also has the core advantages of strong environmental compatibility, high safety in use, and difficulty for target organisms to develop resistance, and has become a key technical direction for replacing high-residue and high-risk chemical pesticides in current agricultural production.

[0003] However, natural chitinase has obvious limitations in practical application. On the one hand, the catalytic efficiency of natural chitinase is low, and a high dose is needed to achieve ideal insecticidal and antibacterial effects, resulting in high application cost. On the other hand, the stability of natural chitinase is poor, and it is easy to be inactivated in field environment (such as high temperature, acid-base change), and it is difficult to maintain long-term control effect. In addition, some natural chitinases have insufficient broad-spectrum against different pests, and can only act on specific groups of pests, limiting their application range. Therefore, it is a key requirement to develop a chitinase mutant with high catalytic activity and strong environmental stability to promote the wide application of chitinase in the field of agriculture.

[0004] In view of this, the present application is proposed. SUMMARY

[0005] In view of the above problems, the purpose of the present application is to provide a chitinase mutant and application thereof in promoting plant growth. The mutant has higher enzyme activity and stronger environmental stability, and shows better effects when used for insecticidal and antibacterial purposes, and can effectively promote plant growth.

[0006] The above purpose of the present application is achieved by the following technical solutions: In a first aspect, the present application provides a chitinase mutant, wherein the amino acid sequence of the chitinase mutant is shown as SEQ ID NO. 3.

[0007] In a second aspect, the present application provides a gene encoding the chitinase mutant.

[0008] In a third aspect, the present application provides a recombinant expression vector comprising the gene encoding the chitinase mutant.

[0009] Further, the vector of the recombinant expression vector is plasmid pPICZ alpha A.

[0010] In a fourth aspect, the present application provides a recombinant strain comprising the recombinant expression vector.

[0011] Further, the host strain of the recombinant strain is Pichia pastoris.

[0012] In a fifth aspect, the present application provides an enzyme preparation comprising the chitinase mutant.

[0013] In a sixth aspect, the present application provides the use of the chitinase mutant or the enzyme preparation in the prevention of agricultural pests.

[0014] In a seventh aspect, the present application provides the use of the chitinase mutant or the enzyme preparation in the prevention of plant diseases.

[0015] In an eighth aspect, the present application provides the use of the chitinase mutant or the enzyme preparation in the promotion of plant growth.

[0016] Compared with the prior art, the present application has the following beneficial effects: 1. The present application uses error-prone PCR technology to direct the evolution of wild-type chitinase in vitro, and obtains a chitinase mutant with significantly improved enzyme activity and environmental stability. The enzyme activity of the mutant at 50℃ and pH 7 is 1051.36 U / mL, which is about 2.7 times that of the wild-type chitinase (385.45 U / mL).

[0017] 2. The chitinase mutant provided by the present application has good killing effect on pests such as Lepidoptera pests, Thysanoptera pests and Coleoptera pests, and shows good antibacterial activity on pathogens such as Phytophthora capsici, Pythium aphanidermatum, Botrytis cinerea, Alternaria solani and Curvularia inaequalis. The chitinase mutant can be used in the growth and development of vegetable plants such as Chinese cabbage, rape, tomato, and food plants such as rice and corn, and can significantly improve the yield and quality of plants.

[0018] 3. The chitinase mutant of the present application realizes active extracellular expression of the gene encoding the chitinase mutant in the engineering bacteria Pichia pastoris, has high expression stability, and can be efficiently separated and purified from the target chitinase mutant after fermentation culture of the obtained chitinase mutant recombinant strain. DETAILED DESCRIPTION

[0019] The present application is further described in the following by specific embodiments. Unless otherwise specified, the technical means, materials, etc. involved in the following embodiments can be known to those skilled in the art, and appropriate ones can be selected from the means and materials known to solve the corresponding technical problems. In addition, the embodiments should be understood as illustrative rather than limiting the scope of the present application, and the essence and scope of the present application are only limited by the claims.

[0020] It should be understood that the scope of the present application is not limited to the defined processes, properties or components, as these embodiments and others are only illustrative of certain aspects of the present application. In fact, various changes to these embodiments that would be obvious to one skilled in the art or related fields without departing from the essence and scope of the present application are encompassed within the scope of the appended claims.

[0021] It should be noted that, unless otherwise defined, the scientific and technical terms used in the context of the present application should have the meaning commonly understood by those of ordinary skill in the art.

[0022] The chitinase mutants employed in the present application are marked as follows: The "amino acid replaced at original amino acid position" is used to represent the mutated amino acid in the chitinase mutant. For example, W57F means that the amino acid at position 57 is replaced by F from the wild-type chitinase, and the position number corresponds to the amino acid sequence number of the wild-type chitinase in SEQ ID NO. 1.

[0023] The chitinase mutant provided by the embodiments of the present application has an amino acid sequence as shown in SEQ ID NO. 3.

[0024] The present application is based on a wild-type chitinase with an amino acid sequence as shown in SEQ ID NO. 1, and a mutant library thereof is constructed by error-prone PCR, and then the chitinase mutant gene is connected with a carrier, and the host bacteria are used for gene expression, and then a chitinase mutant with significantly improved enzyme activity is screened. Sequencing shows that the mutation points of the chitinase mutant include: W57F, A104C, T108C, G174Q, F274C, F289Y, Y305C, G321A, E339C, Q347C, V372L, G408S, S420A, S431R, D525S, specifically, the tryptophan, alanine, threonine, glycine, phenylalanine, phenylalanine, tyrosine, glycine, glutamic acid, glutamine, valine, glycine, serine, serine, aspartic acid at the 57th, 104th, 108th, 174th, 274th, 289th, 305th, 321st, 339th, 347th, 372nd, 408th, 420th, 431st, and 525th sites are respectively mutated into phenylalanine, cysteine, cysteine, glutamine, cysteine, tyrosine, cysteine, alanine, cysteine, cysteine, leucine, serine, alanine, arginine, serine. The enzyme activity of the mutant is about 2.7 times that of the wild-type chitinase.

[0025] The present application further provides a coding gene of the chitinase mutant as described above, and the nucleotide sequence is shown in SEQ ID NO. 4.

[0026] The present application further provides a recombinant expression vector comprising the coding gene as described above. The recombinant expression vector includes a prokaryotic expression vector, a eukaryotic expression vector and other expression vectors, wherein the carrier of the prokaryotic expression vector includes pET series, pGEX series, pMAL series, pCold series, pTrcHis B and other vectors, and the carrier of the eukaryotic expression vector and other expression vectors includes pFastBac series, pPICZ alpha A, pPIC9K and the like.

[0027] The present application further provides a recombinant strain comprising the recombinant expression vector as described above. The host cell of the recombinant strain is selected according to the type of the recombinant expression vector, for example, when the recombinant expression vector is a prokaryotic expression vector, the host cell is selected from prokaryotic cells, and common prokaryotic cells include Escherichia coli, Bacillus subtilis and the like; when the recombinant expression vector is a eukaryotic expression vector or other expression vector, the host cell can be selected from eukaryotic cells or plant cells, including Pichia pastoris, Saccharomyces cerevisiae, plant cells transformed by Agrobacterium, plant cells transformed by protoplasts and the like.

[0028] In another specific embodiment of the present application, the recombinant expression vector is a eukaryotic expression vector, and the vector is plasmid pPICZα A. Correspondingly, the host cell of the recombinant strain is Pichia pastoris, specifically Pichia pastoris GS115.

[0029] The present application further provides an enzyme preparation comprising the chitinase mutant as described above. The enzyme preparation includes liquid and solid dosage forms, and in addition to the chitinase mutant, it can further comprise some auxiliary ingredients such as buffers, stabilizers, preservatives, etc. to ensure the quality and safety of the enzyme preparation during storage and use.

[0030] The present application further provides the use of the chitinase mutant or enzyme preparation as described above in the control of agricultural pests. The pests include lepidopteran pests such as Plutella xylostella, Helicoverpa armigera, Spodoptera exigua, Cnaphalocrocis medinalis, Pieris rapae, thrips pests such as Frankliniella occidentalis, and coleopteran pests such as Leptinotarsa decemlineata and Epilachna vigintioctopunctata. The chitinase mutant of the present application can destroy the physiological structure of the above pests through the action of cuticle degradation, molting interference, and eggshell dissolution, thereby achieving the control effect. This means that the chitinase mutant of the present application can be used as a component of insecticides to improve their insecticidal effect.

[0031] The present application further provides the use of the chitinase mutant or enzyme preparation as described above in the control of plant diseases. The plant diseases refer to diseases caused by pathogenic oomycetes or pathogenic fungi, such as Pythium aphanidermatum, Pythium ultimum, Botrytis cinerea, Alternaria solani (causing early blight of potato), and Curvularia inaequalis. The chitinase mutant of the present application can efficiently hydrolyze the key component chitin in the cell wall of the above pathogenic fungi, leading to the rupture of the hyphal tip, the collapse of the cell wall structure, and the failure of spore to germinate or rupture, thereby effectively inhibiting the growth, invasion, and reproduction of the pathogenic fungi.

[0032] The present application further provides the use of the chitinase mutant or enzyme preparation as described above in the promotion of plant growth. The plants are vegetable plants such as Chinese cabbage, rape, and tomato, or food plants such as rice and corn. The chitinase mutant of the present application can realize the promotion of plant growth through the synergistic action mechanisms of optimizing the rhizosphere microbial environment, activating the development of plant root system, and regulating plant physiological metabolism.

[0033] Further, the chitinase mutant of the present embodiment can be applied to the preparation of water-soluble fertilizer, to improve soil and increase plant stress resistance by enhancing the functionality of the fertilizer, thereby improving the quality and yield of the plant. The specific application method is as follows: the chitinase mutant of the present embodiment is used to enzymatically hydrolyze a chitin-containing material to obtain an enzymatic hydrolysate containing oligosaccharides and the like, and the enzymatic hydrolysate is added to the fertilizer raw material to mix uniformly, thereby obtaining the desired water-soluble fertilizer. More specifically, the chitin-containing material can be shrimp shells, crab shells, and the like, which are crushed, and then 2-2.5 times the mass of water is added, followed by the addition of 3-5% of the mass of the powdered chitinase mutant, and enzymatic hydrolysis is carried out at 37-42°C for 3-5 hours, after which the enzymatic hydrolysate is obtained by filtration. The fertilizer raw material is a conventional water-soluble fertilizer raw material, and the components and concentrations thereof can be selected by those skilled in the art according to the actual situation, and the present embodiment is not particularly limited. For example, the components of the fertilizer raw material include urea, potassium sulfate, zinc sulfate, and water-soluble organic carbon, and the concentrations thereof are 10-15 g / L, 10-15 g / L, 10-15 g / L, and 200-280 g / L, respectively, and the solvent is water. The amount of the enzymatic hydrolysate added is 0.5-2% of the mass of the fertilizer raw material.

[0034] In order to make the technical scheme of the present application clearer, the chitinase mutant is described in detail below through a plurality of specific embodiments.

[0035] The components of the culture medium used in the embodiments of the present application are as follows: YPD solid culture medium: yeast extract 10 g, tryptone 20 g, glucose 20 g, agar powder 20 g, and deionized water to 1 L; BMGY culture medium: yeast extract 10 g, tryptone 20 g, glycerol 10 mL, 1 M potassium phosphate buffer (pH 6.0) 100 mL, 10×YNB (containing ammonium sulfate) 100 mL, 500×biotin (0.02%) 2 mL, and deionized water to 1 L; BMMY culture medium: yeast extract 10 g, tryptone 20 g, methanol 5 mL, 1 M potassium phosphate buffer (pH 6.0) 100 mL, 10×YNB (containing ammonium sulfate) 100 mL, 500×biotin (0.02%) 2 mL, and deionized water to 1 L; PDA culture medium: potato infusion powder 6 g, glucose 20 g, agar powder 15 g, and deionized water to 1 L.

[0036] It should be noted that the above culture media all need to be autoclaved at 120°C for 20 min.

[0037] In this embodiment of the invention, the enzyme activity of chitinase and its mutants was determined using the DNS method. The specific method was as follows: Colloidal chitin and enzyme solution were preheated at 45°C. 500 μL of the preheated enzyme solution was added to 500 mL of colloidal chitin solution. The reaction was carried out at 45°C for 30 min, and then 2 mL of DNS reagent was added to terminate the reaction. The mixture was then subjected to a water bath at 100°C for 10 min for color development. After cooling, the supernatant was collected by centrifugation, and the absorbance was measured at 540 nm. An enzyme activity unit is defined as the amount of enzyme required to generate 1 μmol of acetylglucosamine per minute.

[0038] Example 1: Preparation of chitinase mutant 1.1 Obtaining the wild-type chitinase gene The wild-type chitinase gene BcChiA-wt, with an amino acid sequence as shown in SEQ ID NO.1 and a nucleotide sequence as shown in SEQ ID NO.2, was amplified by PCR.

[0039] The amplification reaction system consisted of: 2 μL DNA template, 2 μL forward primer, 2 μL reverse primer, 1.5 μL Pfu DNA Polymerase, 10 μL 10× PCR Buffer, 1 μL 5 mM dNTP™ extract, and ddH2O to a final volume of 50 μL. The forward and reverse primers are as follows: Forward primer BcChiA-wt-F: GGAATTCCATATGGCTCGTCAATAAATCTAA, Reverse primer BcChiA-wt-R: CCGCTCGAGTTACAGCCACAGCCACCAAC.

[0040] The PCR conditions were: denaturation at 98℃ for 2 min; denaturation at 98℃ for 15 s, annealing at 60℃ for 15 s, extension at 72℃ for 1.5 min, 30 cycles, and incubation at 72℃ for 5 min.

[0041] The wild-type chitinase gene BcChiA-wt and plasmid pPICZα A, amplified above, were double-digested using Xba I and BamH I, respectively. The digestion reaction system was as follows: 5 μL of amplified product or plasmid pPICZα A, 1 μL of Xba I, 1 μL of BamH I, 5 μL of 10× CutSmart Buffer, and ddH2O was added to make up to 50 μL. After digestion at 37℃ for 1.5 h, agarose gel electrophoresis was performed. The BcChiA-wt gene fragment and the linearized pPICZα A plasmid fragment were recovered using a DNA gel recovery kit.

[0042] The above gene fragment and plasmid fragment are ligated to obtain a recombinant expression vector pPICZα A-BcChiA-wt.

[0043] 1.2 Construction of chitinase mutant library The wild-type chitinase genome is used as a DNA template for error-prone PCR amplification to obtain a randomly mutated chitinase gene.

[0044] The reaction system of PCR is as follows: 1 μL of DNA template, 2 μL of forward primer BcChiA-wt-F, 2 μL of reverse primer BcChiA-wt-R, 5 μL of 10×Taq PCR Buffer, 7 μL of MgCl2(25 mM), 1 μL of MnCl2(10 mM), 4 μL of dNTP mixture, 0.5 μL of Taq DNA polymerase, and ddH2O to make up to 50 μL.

[0045] The reaction program is as follows: 95°C for 5 min; 94°C for 30 s, 55°C for 30 s, 72°C for 2 min, for a total of 30 cycles; and finally 72°C for 10 min.

[0046] The error-prone PCR amplification product is subjected to 1% agarose gel electrophoresis, and the product is recovered by a DNA gel recovery kit to obtain a randomly mutated chitinase gene.

[0047] 1.3 Expression and screening of chitinase mutants Referring to the foregoing method, the randomly mutated chitinase gene is double digested with the plasmid pPICZα A, and then ligated to obtain a recombinant expression vector containing the mutant gene. The recombinant strain is obtained by transforming the recombinant expression vector into host cells of Pichia pastoris GS115 by an electroporation method, and a chitinase mutant with high enzyme activity is screened. The specific transformation and screening method is as follows: (1) The recombinant expression vector containing the mutant gene is subjected to linearization treatment, 5 μL of the linearization product is mixed with 80 μL of Pichia pastoris GS115 competent cells, and then subjected to electroporation under the conditions of 1.5 kV, 25 μF, and 200 Ω. Immediately after the electroporation, 1 mL of pre-cooled sorbitol (1 mol / L) is added to obtain a bacterial solution; (2) 200 μL of the bacterial solution is spread on YPD solid medium containing 100 μg / mL Zeocin, and cultured at 30°C for 2-4 d until single colonies appear; (3) picking a single colony and inoculating into BMGY medium (containing 1% glycerol), culturing at 30 °C, 250 rpm until OD600=2-6, centrifuging to collect the bacterial cells, resuspending with BMMY medium (containing 0.5% methanol) to OD600=1.0, continuing to culture at 30 °C, 250 rpm, adding 100% methanol to the medium every 24 h to a final concentration of 0.5%, culturing for 72-96 h, centrifuging to obtain the supernatant (chitinase mutant crude enzyme solution), and determining the enzyme activity at 50 °C, pH 7; (4) linearizing the aforementioned recombinant expression vector pPICZα A-BcChiA-wt according to the above method, preparing a wild-type chitinase crude enzyme solution and determining the enzyme activity, comparing the enzyme activity of the chitinase mutant crude enzyme solution with the determined enzyme activity, and preliminarily screening to obtain a chitinase mutant crude enzyme solution with improved enzyme activity. The above steps are repeated for re-screening, and finally a chitinase mutant crude enzyme solution with significantly improved enzyme activity is screened.

[0048] 1.4 Purification of chitinase mutant The chitinase mutant crude enzyme solution obtained after the final screening is subjected to protein precipitation using 26% ammonium sulfate, the precipitate is collected by centrifugation, resuspended with a pH 6.5, 20 mM KH2PO4-Na2HPO4 buffer, centrifuged to remove the solid after resuspension, and a resuspension solution is obtained. The resuspension solution is dialyzed in the above buffer at 4 °C for 24 h, the supernatant is collected by centrifugation, filtered through a 0.22 μm organic membrane, and then loaded onto a Ni-NTA chromatography column. The impurities are eluted with 2 column volumes of A liquid (25 mM Tris-HCl buffer, 500 mM NaCl, pH 7.4) and gradient elution of A liquid containing 15, 30, 45 mM imidazole, and then eluted with 2 column volumes of B liquid (25 mM Tris-HCl buffer, 500 mM NaCl, 300 mM imidazole). The collected eluate is the purified chitinase mutant enzyme solution. The enzyme solution is freeze-dried to obtain a powdery chitinase mutant.

[0049] The obtained chitinase mutant is sequenced, and the amino acid sequence is shown as SEQ ID NO. 3, and the nucleotide sequence is shown as SEQ ID NO. 4.

[0050] The enzyme activity of the chitinase mutant at 50 °C, pH 7 is determined, and the enzyme activity is 1051.36 U / mL, which is about 2.7 times that of the wild-type chitinase (385.45 U / mL).

[0051] Example 2 Investigation of the enzymatic properties of chitinase mutant 2.1 Optimum temperature of chitinase mutant The chitinase mutant was measured for enzyme activity at 30-80 °C at pH 7. The temperature of the highest enzyme activity was the optimum temperature of the chitinase mutant, and the enzyme activity was defined as 100%, and the relative enzyme activity at the rest of the temperature conditions was calculated.

[0052] The measurement results are shown in Table 1, and the optimum temperature of the chitinase mutant of the present application was 55 °C, and the relative enzyme activity was maintained at 90% or more at 45-65 °C.

[0053] Table 1 Relative enzyme activity of chitinase mutant at different temperatures .

[0054] 2.2 Optimum pH of chitinase mutant The chitinase mutant was measured for enzyme activity at pH 2-10 at a temperature of 50 °C. The pH of the highest enzyme activity was the optimum pH of the chitinase mutant, and the enzyme activity was defined as 100%, and the relative enzyme activity at the rest of the pH conditions was calculated.

[0055] The measurement results are shown in Table 2, and the optimum pH of the chitinase mutant of the present application was 6, and the relative enzyme activity was maintained at 90% or more at pH 4-8, and the relative enzyme activity was maintained at 85% or more at pH 3-9.

[0056] Table 2 Relative enzyme activity of chitinase mutant at different pHs .

[0057] 2.3 Thermal stability of chitinase mutant The thermal stability of the chitinase mutant was measured at pH 6, i.e., after water bath incubation at 45-80 °C for 2 h, the residual enzyme activity of the chitinase mutant was measured and calculated, and the initial enzyme activity at 0 h was set as 100%, and the measurement results are shown in Table 3. The residual enzyme activity of the chitinase mutant of the present application was maintained at 90% or more after treatment at 30-65 °C for 2 h.

[0058] Table 3 Thermal stability measurement results of chitinase mutant .

[0059] 2.4 pH stability of chitinase mutant The pH stability of the chitinase mutants was determined at 55°C, i.e. the chitinase mutants were incubated at pH 2-10 for 12 h, the residual enzyme activity of the chitinase mutants was determined and calculated, the initial enzyme activity of 0 h incubation was set as 100%, and the determination results are shown in Table 4. The residual enzyme activity of the chitinase mutants of the present application remained above 90% after being treated at pH 5-8 for 12 h.

[0060] Table 4 Determination results of the pH stability of the chitinase mutants .

[0061] Example 3 Application of the chitinase mutants in the control of agricultural pests (1) The insecticidal activity of the chitinase mutants against Plutella xylostella, Helicoverpa armigera, Spodoptera exigua, Cnaphalocrocis medinalis, Pieris rapae, Leptinotarsa decemlineata and Epilachna vigintioctopunctata was determined as follows: Fresh leaves of the target pest host plants (e.g. cabbage leaves for Plutella xylostella, cotton leaves for Helicoverpa armigera, and potato leaves for Leptinotarsa decemlineata) were cut into 2 cm*2 cm in size, and were soaked in chitinase mutant enzyme solution at a concentration of 100 μg / mL, 200 μg / mL, and 300 μg / mL, and wild-type chitinase enzyme solution at a concentration of 300 μg / mL for 10 s, respectively, taken out and drained, and placed in a culture dish lined with wet filter paper, 10 standardized larvae were introduced into each culture dish, and incubated in an environment with a temperature of 25±1°C, a relative humidity of 70±5%, and a light illumination of 16L:8D. The number of deaths was checked and recorded every 24 h, the mortality rate (number of deaths / total number, %) was calculated, and the insect was considered dead if it could not move after being lightly touched with a brush pen. After 72 h of incubation, the mortality rates of Plutella xylostella, Helicoverpa armigera, Spodoptera exigua, Cnaphalocrocis medinalis, Pieris rapae, Leptinotarsa decemlineata, and Epilachna vigintioctopunctata were as shown in Table 5.

[0062] Table 5 Determination results of the mortality rate of the target pests after 72 h of incubation under different treatments (%) .

[0063] (2) The insecticidal activity of the chitinase mutants against Frankliniella occidentalis was determined as follows: A layer of parafilm film was laid on the bottom of a culture dish, and chitinase mutant enzyme solutions with concentrations of 100 μg / mL, 200 μg / mL, and 300 μg / mL and a wild-type chitinase enzyme solution with a concentration of 300 μg / mL were each uniformly dropped on the surface of the film (500 μL per dish, to ensure that the film surface was completely wet), and then air-dried at room temperature for 30 min to form a uniform drug film. Ten western flower thrips adults were introduced, and the culture dish was sealed with a breathable film (a small hole was left for ventilation) and placed in an environment with a temperature of 25±1 ℃, a relative humidity of 70±5%, and light of 16L:8D. The number of deaths was checked and recorded every 24 h, and the mortality rate was calculated (number of deaths / total number, %). Those that could not move when touched with a brush tip were considered dead. After 72 h of culture, the mortality rates of the western flower thrips under the treatment of chitinase mutant enzyme solutions with concentrations of 100 μg / mL, 200 μg / mL, and 300 μg / mL were 54.2%, 72.4%, and 89.4%, respectively; and the mortality rate of the western flower thrips under the treatment of a wild-type chitinase enzyme solution with a concentration of 300 μg / mL was 16.7%.

[0064] Example 4. Application of chitinase mutants in the prevention and treatment of plant diseases The chitinase mutants were tested for antibacterial activity against five pathogenic fungi, i.e., Phytophthora capsici, Pythium aphanidermatum, Botrytis cinerea, Alternaria solani, and Curvularia inaequalis. The testing method was as follows: Chitinase mutant enzyme solutions with concentrations of 100 μg / mL, 200 μg / mL, and 300 μg / mL and a wild-type chitinase enzyme solution with a concentration of 300 μg / mL were mixed with PDA solid medium cooled to about 50°C at a ratio of 1:9 (v / v) to prepare drug-containing plates. Plates to which an equal amount of sterile water was added were used as blank controls. A 5-mm-diameter fungus cake was taken from the edge of a pre-cultured pathogenic fungus colony and invertedly inoculated in the center of the drug-containing plate, which was then cultured in the dark at 25 ℃. After 7 d of culture, the colony diameters of the treatment groups were measured, and the mycelial growth inhibition rate was calculated according to the following formula. The calculation results are shown in Table 6.

[0065] .

[0066] Table 6. Mycelial growth inhibition rates of pathogenic fungi under different treatments (%) .

[0067] Example 5. Application of chitinase mutants in promoting plant growth (1) Promoting effect of chitinase mutants on the growth of Chinese cabbage Select plump, disease-free Chinese cabbage seeds, rinse them with sterile water, and then completely immerse them in chitinase mutant enzyme solutions at concentrations of 100 μg / mL, 200 μg / mL, and 300 μg / mL, as well as wild-type chitinase enzyme solution at a concentration of 300 μg / mL. Use sterile water as a blank control. After soaking at 25 ℃ for 12 h, germinate the seeds. When the radicle reaches 0.5 cm in length, sow them in substrate soil for cultivation. After 30 days of cultivation, measure the fresh weight and root length of the Chinese cabbage. The results are shown in Table 7.

[0068] Table 7. Results of fresh weight and root length measurement of Chinese cabbage under different treatments .

[0069] (2) The promoting effect of chitinase mutant on rice growth Select plump, disease-free rice seeds, rinse them with sterile water, and then completely immerse them in chitinase mutant enzyme solutions at concentrations of 100 μg / mL, 200 μg / mL, and 300 μg / mL, as well as wild-type chitinase enzyme solution at a concentration of 300 μg / mL. Use sterile water as a blank control. After soaking at 25 ℃ for 12 h, germinate the seeds. When the embryos grow to 1-2 cm, sow them in substrate soil and cultivate until maturity. Measure the effective panicle number, panicle grain number, and thousand-grain weight of the rice. The results are shown in Table 8.

[0070] Table 8. Results of determination of effective panicle number, grain number per panicle, and thousand-grain weight of rice under different treatments. .

[0071] Experimental Example 6 The chitinase mutant was used to prepare a water-soluble fertilizer. The preparation method is as follows: Water-soluble fertilizer sample 1: Prepare fertilizer raw materials, the components of which include urea, potassium sulfate, zinc sulfate and water-soluble organic carbon, with concentrations of 10 g / L, 10 g / L, 15 g / L and 200 g / L respectively, and water as the solvent; After crushing the shrimp shells, add twice the weight of water, then add 3% of the powdered chitinase mutant from Example 1, and enzymatically hydrolyze at 37 °C for 3 h. After filtration, the enzymatic hydrolysate is obtained. Add 0.5% of the enzymatic hydrolysate by mass to the fertilizer raw material and mix well to obtain water-soluble fertilizer.

[0072] Water-soluble fertilizer sample 2: Prepare fertilizer raw materials, the components of which include urea, potassium sulfate, zinc sulfate and water-soluble organic carbon, with concentrations of 12 g / L, 12 g / L, 13 g / L and 240 g / L respectively, and water as the solvent; The crab shell was crushed and added to 2.3 times the mass of water, and 4% of the mass of the powdered chitinase mutant of Example 1 was added, and enzymolysis was carried out at 40°C for 5 hours, and then filtration was carried out to obtain an enzymolysis liquid; The enzymolysis liquid was added to the fertilizer raw material at a mass fraction of 0.15%, and mixed uniformly to obtain a water-soluble fertilizer.

[0073] Water-soluble fertilizer sample 3: A fertilizer raw material was prepared, and the components included urea, potassium sulfate, zinc sulfate, and water-soluble organic carbon, with concentrations of 15 g / L, 15 g / L, 10 g / L, and 280 g / L, respectively, and the solvent was water; The shrimp shell and crab shell were mixed at a mass ratio of 1:1, crushed, and then added to 2.5 times the mass of water, and 5% of the mass of the powdered chitinase mutant of Example 1 was added, and enzymolysis was carried out at 42°C for 4 hours, and then filtration was carried out to obtain an enzymolysis liquid; The enzymolysis liquid was added to the fertilizer raw material at a mass fraction of 0.2%, and mixed uniformly to obtain a water-soluble fertilizer.

[0074] Control fertilizer sample: fertilizer raw material without the addition of enzymolysis liquid, and the components were the same as those of the water-soluble fertilizer sample 1.

[0075] (1) Application of water-soluble organic fertilizer in promoting the growth of tomatoes The above water-soluble fertilizer and control fertilizer sample were diluted 800 times, and sprayed on tomatoes at the seedling stage, flowering stage, and fruiting stage, with a spraying amount of 30 L per mu at the seedling stage, 30 L per mu at the flowering stage, and 40 L per mu at the fruiting stage. After the tomatoes matured, the incidence of gray mold and yield were measured, and the results are shown in Table 9.

[0076] Table 9 Effect of different fertilizer treatments on the incidence of tomato gray mold and yield

[0077] (2) Application of water-soluble organic fertilizer in promoting the growth of wheat The above water-soluble fertilizer and control fertilizer sample were diluted 800 times, and sprayed on wheat at the green-up and jointing stage, with a spraying amount of 30 L per mu. After the wheat matured, the number of ears, number of grains per ear, and yield were measured, and the results are shown in Table 10.

[0078] Table 10 Effect of different fertilizer treatments on the number of wheat ears, number of grains per ear, and yield .

[0079] Finally, it should be noted that although the application has been described in detail with reference to the foregoing embodiments, those skilled in the art can still make modifications to the technical solutions recorded in the foregoing embodiments, or make equivalent replacements to part of the technical features, and any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the application shall be included in the protection scope of the application.

Claims

1. A chitinase mutant characterized in that, The amino acid sequence of the chitinase mutant is shown as SEQ ID NO.

3.

2. A gene encoding the chitinase mutant according to claim 1.

3. A recombinant expression vector, characterized in that, A gene encoding the chitinase mutant according to claim 2.

4. The recombinant expression vector of claim 3, wherein, The vector of the recombinant expression vector is plasmid pPICZα A.

5. A recombinant strain, characterized in that, A recombinant expression vector according to claim 3 or 4.

6. The recombinant bacterial strain of claim 5, wherein The host strain of the recombinant strain is Pichia pastoris.

7. Enzyme preparation, characterized in that, A chitinase mutant according to claim 1.

8. Use of the chitinase mutant according to claim 1, or the enzyme preparation according to claim 7 in the control of agricultural pests.

9. Use of the chitinase mutant according to claim 1, or the enzyme preparation according to claim 7 in the control of plant diseases.

10. Use of the chitinase mutant according to claim 1, or the enzyme preparation according to claim 7 in the promotion of plant growth.

Images