Eggplant SmEPS1 protein or coding gene thereof and application of eggplant SmEPS1 protein in regulating eggplant bacterial wilt resistance

By GWAS to locate the linkage site of eggplant bacterial wilt resistance and screening the SmEPS1 gene, and regulating its protein expression level, the problem of insufficient gene localization and molecular markers in eggplant bacterial wilt resistance research was solved, and eggplant disease resistance was significantly improved.

CN120905199AActive Publication Date: 2025-11-07INST OF VEGETABLES GUANGDONG PROV ACAD OF AGRI SCI
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202511076056.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-01
Publication Date
2025-11-07
Estimated Expiration
2045-08-01

AI Technical Summary

Technical Problem

In the current technology, the research on the localization of resistance genes and molecular markers for eggplant bacterial wilt is relatively limited. In particular, the application of genome-wide association analysis in resistance to eggplant bacterial wilt has not been fully developed, and there is a lack of effective gene regulation methods.

Method used

By locating the linkage site for resistance to bacterial wilt in eggplant through genome-wide association analysis (GWAS), the candidate gene SmEPS1 for resistance to bacterial wilt in eggplant was screened out, and its copy number variation was verified to be highly linked to resistance through bioinformatics analysis. The expression level of SmEPS1 protein was regulated by gene editing technology to improve the disease resistance of eggplant.

Benefits of technology

This study provides a theoretical basis for molecular breeding of eggplant resistance to bacterial wilt, significantly improves the disease resistance of eggplant, and verifies the important role of the SmEPS1 gene in regulating eggplant resistance to bacterial wilt.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120905199A_ABST
    Figure CN120905199A_ABST
Patent Text Reader

Abstract

The invention belongs to the field of molecular biology, and particularly relates to an eggplant SmEPS1 protein or a coding gene thereof and application of the eggplant SmEPS1 protein in regulation and control of plant bacterial wilt resistance. Based on the SmEPS1 gene for regulating and controlling the eggplant bacterial wilt resistance and copy number variation of the SmEPS1 gene, the eggplant bacterial wilt resistance difference can be caused, and an important theoretical basis is provided for eggplant bacterial wilt resistance molecular breeding.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the field of molecular biology, and particularly relates to eggplant SmEPS1 protein or a coding gene thereof and application thereof in regulating resistance of plants to bacterial wilt. BACKGROUND

[0002] Eggplant bacterial wilt is one of important diseases affecting eggplant production, and the resistance thereof is controlled by multiple genes and belongs to a complex quantitative trait. Salicylic acid (SA) as a core signal molecule of plant immune response plays a key role in defense signal transduction, and synthesis thereof mainly depends on an isochorismate synthase (ICS) pathway (accounting for about 90%) and an AIM1-based beta-oxidation synthesis pathway. Accumulation of SA can induce expression of a disease-related (PR) gene (such as a PR1 gene), thereby enhancing the resistance of plants to pathogenic bacteria.

[0003] EPS1 (belonging to a BAHD acetyltransferase family protein) is a key regulatory factor for SA biosynthesis. Studies have shown that EPS1 has isohydroxymethyl-glutamate A ketoglutarate lyase activity, and can catalyze isochorismate-9-glutamate (IC-9-Glu) to generate SA. In Arabidopsis, EPS1 mutation can complement the dwarf phenotype of s3h / dmr6 double mutant plants; and in eps1 mutant, pathogen-induced accumulation of SA and expression of PR genes are impaired, resulting in decreased disease resistance, and exogenous SA supplementation can restore the resistance. The above studies confirm that EPS1 plays an important role in plant disease resistance by regulating SA synthesis.

[0004] At present, the research on gene positioning and development of molecular markers for eggplant bacterial wilt resistance is still limited, and in particular, the application of forward genetics based on genome-wide association analysis (GWAS) in this field has not been fully developed. Mining of bacterial wilt resistance genes is a prerequisite and key theoretical basis for realizing molecular marker-assisted selection breeding of eggplant bacterial wilt resistance. SUMMARY

[0005] On the basis of locating the linkage locus of eggplant bacterial wilt resistance by GWAS, the application screens and obtains an eggplant bacterial wilt resistance candidate gene SmEPS1 through bioinformatics analysis such as gene sequence analysis and haplotype analysis of 9 eggplants; it is found through analysis that the copy number variation of the candidate gene is highly linked to the resistance; the role of the candidate gene in regulating the resistance of eggplant bacterial wilt is determined by silencing the candidate gene in multiple copy materials and observing the disease resistance of the silenced plants and wild type plants, and the results can provide an important theoretical basis for eggplant bacterial wilt resistance molecular breeding.

[0006] In order to achieve the above purpose, the application can adopt the following technical scheme:

[0007] In a first aspect, the present application provides a Solanum melongena SmEPS1 protein, or a coding gene thereof, or a biological material comprising the coding gene thereof, wherein the SmEPS1 protein comprises any one of the following amino acid sequences:

[0008] (1) the amino acid sequence shown as SEQ ID NO. 1;

[0009] (2) an amino acid sequence of a protein having the same function obtained by substitution, insertion or deletion of one or more amino acids of the amino acid sequence shown as SEQ ID NO. 1.

[0010] Preferably, in the above-mentioned Solanum melongena SmEPS1 protein, or the coding gene thereof, or the biological material comprising the coding gene thereof, the coding gene of the SmEPS1 protein comprises any one of the following nucleotide sequences:

[0011] (1) the nucleotide sequence shown as SEQ ID NO. 2;

[0012] (2) a nucleotide sequence capable of encoding a protein having the same function obtained by substitution, deletion or insertion of one or more nucleotides of the nucleotide sequence shown as SEQ ID NO. 2.

[0013] Preferably, in the above-mentioned Solanum melongena SmEPS1 protein, or the coding gene thereof, or the biological material comprising the coding gene thereof, the biological material comprises a recombinant expression vector, an overexpression vector, an interference vector, a recombinant virus, a recombinant bacteria or a recombinant gene expression cassette.

[0014] In a second aspect, the present application provides an application of the above-mentioned Solanum melongena SmEPS1 protein, or the coding gene thereof, or the biological material comprising the coding gene thereof in regulating the bacterial wilt resistance of Solanum melongena.

[0015] Preferably, in the above-mentioned application, the bacterial wilt resistance of Solanum melongena is improved by increasing the expression level of the SmEPS1 protein in Solanum melongena.

[0016] In a third aspect, the present application provides an application of the above-mentioned Solanum melongena SmEPS1 protein, or the coding gene thereof, or the biological material comprising the coding gene thereof in cultivating Solanum melongena with bacterial wilt resistance.

[0017] Preferably, in the above-mentioned application, the bacterial wilt resistance of Solanum melongena is improved by increasing the expression level of the SmEPS1 protein in Solanum melongena.

[0018] In a fourth aspect, the present application provides an application of the above-mentioned Solanum melongena SmEPS1 protein, or the coding gene thereof, or the biological material comprising the coding gene thereof in improving the germplasm resources of Solanum melongena with bacterial wilt resistance.

[0019] Preferably, in the above application, the expression level of SmEPS1 protein in eggplant is increased, and the resistance of eggplant to bacterial wilt is improved.

[0020] In a fifth aspect, the present application provides a method for cultivating transgenic eggplant, characterized in that the method comprises:

[0021] regulating the expression level of SmEPS1 protein in eggplant;

[0022] The SmEPS1 protein comprises any one of the following amino acid sequences:

[0023] (1) the amino acid sequence shown as SEQ ID NO. 1;

[0024] (2) the amino acid sequence of a protein with the same function obtained by substitution, insertion or deletion of one or more amino acids of the amino acid sequence shown as SEQ ID NO. 1.

[0025] Preferably, in the above method, the expression level of SmEPS1 protein in eggplant is regulated by any one of the following methods:

[0026] gene editing, hybridization, backcrossing, selfing or vegetative propagation;

[0027] The gene editing preferably comprises one or more of the following methods: Ti plasmid, plant virus vector, direct DNA transformation, microinjection, gene gun, electroporation or Agrobacterium-mediated.

[0028] Specifically, 201 domestic and foreign representative eggplant germplasm resources are subjected to whole genome resequencing in the present application, and the genetic diversity and genetic structure of the germplasm are analyzed. In addition, the eggplant germplasm resources are subjected to artificial inoculation identification of P. solanacearum by the method of root irrigation for multiple times in succession for two years. Based on GWAS whole genome association analysis, the SmEPS1 gene locus (C / T SNP: Chr05.83797294) on chromosome 5 is identified to be significantly associated with the resistance to bacterial wilt, the gene belongs to the BAHD acetyltransferase family protein, has the activity of isohydroxymethyl-glutamate acetoacetate glutamate lyase, can catalyze the isochorismate-9-glutamate (IC-9-Glu) to produce salicylic acid (Salicylic acid, SA), plays a key role in the accumulation of SA induced by pathogens (Torrens-Spence, M.P., Bobokalonova, A., Carballo, V., Glinkerman, C.M., Pluskal, T., Shen, A. and Weng, J.K., 2019. PBS3 and EPS1 complete salicylic acid biosynthesis from isochorismate in Arabidopsis. Molecular plant, 12 (12), pp.1577-1586), and the SmEPS1 is preliminarily determined as a candidate gene related to the resistance to bacterial wilt of eggplant.

[0029] The present application has the beneficial effects including that the SmEPS1 gene provided in the present application for regulating the resistance to bacterial wilt of eggplant, and the copy number variation thereof can cause the difference in the resistance to bacterial wilt of eggplant, thereby providing an important theoretical basis for the molecular breeding of eggplant resistant to bacterial wilt. BRIEF DESCRIPTION OF DRAWINGS

[0030] Figure 1a It is a phenotypic diagram for field bacterial wilt resistance identification of eggplant germplasm resources;

[0031] Figure 1b It is a GWAS analysis of eggplant bacterial wilt resistance related locus based on multiple years and multiple points.

[0032] Figure 2 It is the relationship between the copy number variation of eggplant SmEPS1 and the bacterial wilt resistance phenotype;

[0033] Figure 3a It is the construction of PTRV2-SmEPS1 eggplant VIGS vector. The structure diagram of PTRV2-SmEPS1 vector;

[0034] Figure 3bPTRV2-SmEPS1 plasmid for EcorV electrophoresis detection; wherein, M1 is Marker [DL5000]: 5000, 3000, 2000, 1000, 750, 500, 250, 100 bp, 1 is EcorV enzyme cutting band: 399, 657, 1923, 8503 bp;

[0035] Figure 4a Expression amount of SmEPS1 in wild type plants and silenced plants;

[0036] Figure 4b Disease resistance phenotype of wild type plants and SmEPS1 silenced plants after being infected by P. solanacearum; DETAILED DESCRIPTION

[0037] The examples are used to better illustrate the present application, but the present application is not limited to the examples. Therefore, those skilled in the art can make non-essential improvements and adjustments to the embodiments according to the above description, which still belong to the protection scope of the present application.

[0038] The terms used herein are used only to describe specific embodiments and are not intended to limit the present disclosure. Unless there is a clear distinction in the context, the singular form includes the plural form. As used herein, it should be understood that terms such as "include", "have", "contain", etc. are intended to indicate the presence of features, numbers, operations, components, parts, elements, materials or combinations. The terms of the present application are disclosed in the specification, and are not intended to exclude the possibility that one or more other features, numbers, operations, components, parts, elements, materials or combinations can exist or can be added. As used herein, " / " can be interpreted as "and" or "or" depending on the circumstances.

[0039] In order to better understand the present application, the content of the present application will be further illustrated below in combination with specific examples, but the content of the present application is not limited only to the following examples.

[0040] In the following examples, the molecular biology experimental techniques used include DNA extraction, RNA extraction and reverse transcription, PCR amplification, enzyme digestion of PCR products and vectors, ligation, transformation of competent E. coli DH5a and Agrobacterium GV3101, etc. Unless otherwise specified, the operations are generally performed according to the conventional methods, and the specific methods can be found in "Molecular Cloning Laboratory Guide" (3rd edition) (Sambrook J, Russell DW, Janssen K, Argentine J. Huang Peitang et al. Translated, 2002, Beijing: Science Press) or according to the conditions recommended by the manufacturer.

[0041] Example 1

[0042] The embodiment of the present application provides a GWAS positioning condition of a resistance candidate gene of aubergine bacterial wilt, and specifically as follows:

[0043] First, in order to locate the genomic region related to the resistance of aubergine bacterial wilt, the root irrigation method (as recorded in the literature (Li Zhiliang, Li Zhenxing, He Zifuk, Yu Hao. Aubergine resource seedling stage field bacterial wilt resistance identification. Guangdong Agricultural Sciences, 2006, 1: 39-4.) is used to evaluate the resistance of 201 germplasms to bacterial wilt multiple times in 2022 and 2023 summer, and the like. Figure 1a After artificial inoculation for one week, the disease condition of each material is recorded (2 times per week), and when the disease condition of each material is basically stable, the incidence rate is calculated.

[0044] Then, the S126 is used as a reference genome (https: / / db.cngb.org / cnsa / assembly / page / batch / sub062525 / view / , sample_accession: CNS1199603)

[0045] GWAS (genome-wide association study) analysis is performed, the linear mixed model (LMM) of Gemma (v.0.98.3) software is used to perform association analysis with the kinship matrix (K) and principal components (PCs) as covariates, and the CMplot (v.4.4.1) software package of Rstudio (v.4.3.2) is used to draw a Manhattan plot. The threshold value of GWAS is calculated by using GEC (v.0.2) software to calculate the effective SNP number, so as to adjust the Bonferroni correction threshold (P<1.46x10 -6 ); considering that complex quantitative traits are usually jointly regulated by multiple small-effect loci, a relatively loose second threshold (P<1x10 -5 ) is used to facilitate the capture of variation sites associated with disease resistance traits. The results show that strong association signals are mainly identified on Chr05; through analysis of the significant sites (Peak point C / T SNP: Chr05.83797294) of Chr05 and the candidate gene analysis of the strong linkage LD interval, it is shown that the SNP of the highest P value (Peak) is directly located in the SmEPS1 gene (evm.model.Chr05.2786) Figure 1b

[0046] Embodiment 2

[0047] The present application embodiment tests the relationship between SmEPS1 copy number variation and aubergine bacterial wilt resistance, and specifically as follows:

[0048] ​By comparing 9 eggplant reference genomes ( https: / / db.cngb.org / cnsa / assembly / page / batch / sub062525 / view ), it was found that the SmEPS1 gene had copy number variation (Table 1), and this copy number variation was related to the phenotype of eggplant resistance to bacterial wilt.

[0049] Table 19 eggplant genome SmEPS1 copy number and bacterial wilt resistance

[0050] Genome number Copy number of SmEPS1 Disease resistance S027 0 Disease resistance S054 0 Disease resistance S076 0 Disease resistance S092 4 Disease resistance S98 1 Disease resistance S126 1 Disease resistance S181 3 Disease resistance S184 3 Disease resistance S185 4 Disease resistance

[0051] Subsequently, by analyzing the distribution of SmEPS1 gene copy number variation and bacterial wilt resistance in 160 eggplant germplasm resources, the results showed that SmEPS1 gene copy number variation was significantly linked to bacterial wilt resistance, that is, when SmEPS1 had only one or zero copies, the incidence rate was high, and it showed a higher susceptibility to bacterial wilt, and when SmEPS1 had 3-4 copies, the incidence rate was low, and it showed a higher resistance to bacterial wilt ( Figure 2 ).

[0052] Example 3

[0053] The embodiment of the present application verifies the biological function of SmEPS1 gene in resisting bacterial wilt of eggplant, which is as follows:

[0054] (1) Construction of PTRV2-SmEPS1 eggplant VIGS vector:

[0055] Using the cds of eggplant SmEPS1 as a template, primers (F: tgtaattgtgtgaatgcgaatg; R: ctacaaaaactgaacctttacttaatatc; target fragment 277bp) were designed according to the conserved sequence of its homologous genes to perform PCR amplification reaction, and the amplification system was 25 μL: ddH2O 10 μL, PCR mix (Genstar) 12.5 μL, Primer F (10 μmol / L) 1 μL, Primer R (10 μmol / L) 1 μL, DNA template (500 ng / μL) 0.5 μL. The PCR reaction program was: 94℃ pre-denaturation for 1 min; 94℃ denaturation for 30 s, 50℃ annealing for 45 s, 72℃ extension for 30 s, 31 cycles; 72℃ extension for 10 min. After the reaction, 5 μL of the product was electrophoresed on 1.5% agarose, 5 v / cm voltage, 20 min. After Goldview staining, the gel imaging system was used to observe and take pictures.

[0056] The SmEPS1 gene homologous conserved fragment was obtained, and the obtained conserved SmEPS1 gene fragment was connected with the Ptrv2 vector. The enzyme cutting linking system and reaction conditions were as follows: system 20 μL: nuclease-free water 12 μL, 10*buffer 2 μL, XbaI 1 μL, KpnI 1 μL, PTRV2 4 μL. The reaction condition was: 37°C for 1 h. The vector enzyme cutting was purified by a PCR purification kit (the purified product was marked as PTRV2(D)) for the next step of recombination reaction. The recombination reaction system and conditions were as follows: system 20 μL: Biorun2*EasyClone Mix 10 μL, rDNA G15 μL, PTRV2(D) 5 μL. The reaction condition was: 37°C for 30 h. From the enzyme cutting electrophoresis detection result, it can be seen that PTRV2-SmEPS1 was cut into four different fragments: 399, 657, 1923 and 8503 bp, which indicated that the PTRV2-SmEPS1 recombination vector was successfully constructed Figure 3a and Figure 3b );

[0057] (2) Effect of VIGS silencing SmEPS1 gene on the resistance of silencing plants to bacterial wilt:

[0058] The SmEPS1 gene of S092 was silenced by VIGS technology (You, Q., Li, H., Wu, J., Li, T., Wang, Y., Sun, G., Li, Z. and Sun, B., 2023. Mapping and validation of the epistatic D and P genes controlling anthocyanin biosynthesis in the peel of eggplant (Solanum melongena L.) fruit. Horticulture Research, 10(2), p. uhac268.) in eggplant. Through quantitative PCR detection, it was found that the expression amount of the candidate gene SmEPS1 in the silencing plant (TRV::SmEPS1) was significantly lower than that in the empty vector plant (TRV::00) Figure 4a ), which indicated that the eggplant bacterial wilt resistance candidate gene SmEPS1 was successfully silenced in the eggplant seedling plant; after artificial inoculation of Ralstonia solanacearum for 5 days, it was found that the silencing plant showed wilting Figure 4b ) compared with the empty vector control plant, which indicated that the VIGS silencing of SmEPS1 gene reduced the resistance to bacterial wilt. The results proved that the SmEPS1 gene may be one of the eggplant bacterial wilt resistance regulatory genes and plays an important role in the process of eggplant bacterial wilt resistance.

[0059] Finally, it is to be explained that the above embodiments are only used to illustrate the technical solutions of the present application but not to limit the present application. Although the present application is described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that the technical solutions of the present application can be modified or equivalently replaced without departing from the purpose and scope of the technical solutions of the present application, and all of them should be covered in the scope of the claims of the present application.

Claims

1. A Solanum melongena SmEPS1 protein, a gene encoding the same, or a biological material comprising the gene; the SmEPS1 protein comprises any one of the following amino acid sequences: (1) an amino acid sequence as shown in SEQ ID NO. 1; or (2) an amino acid sequence obtained by substitution, insertion or deletion of one or more amino acids of the amino acid sequence as shown in SEQ ID NO. 1, and having the same function as the SmEPS1 protein. The gene encoding the SmEPS1 protein comprises any one of the following nucleotide sequences: (1) a nucleotide sequence as shown in SEQ ID NO. 2; or (2) a nucleotide sequence obtained by substitution, deletion or insertion of one or more nucleotides of the nucleotide sequence as shown in SEQ ID NO. 2, and capable of encoding a protein having the same function as the SmEPS1 protein. The biological material comprises a recombinant expression vector, an overexpression vector, an interference vector, a recombinant virus, a recombinant bacterium or a recombinant gene expression cassette.

2. Eggplant SmEPSl protein according to claim 1, or a gene encoding it, or a biological material comprising a gene encoding it, characterized in that, 4.The Solanum melongena SmEPS1 protein, the gene encoding the same, or the biological material comprising the gene of any one of claims 1 to 3 for use in regulating the resistance of Solanum melongena to bacterial wilt. 5.The Solanum melongena SmEPS1 protein, the gene encoding the same, or the biological material comprising the gene of any one of claims 1 to 3 for use in breeding Solanum melongena with resistance to bacterial wilt. 6.The Solanum melongena SmEPS1 protein, the gene encoding the same, or the biological material comprising the gene of any one of claims 1 to 3 for use in improving germplasm resources of Solanum melongena with resistance to bacterial wilt.

3. Eggplant SmEPSl protein, or a gene encoding the same, or a biological material comprising the gene encoding the same, according to claim 1 or 2, characterized in that, The resistance of Solanum melongena to bacterial wilt is improved by increasing the expression level of the SmEPS1 protein in Solanum melongena. The method comprises: regulating the expression level of the SmEPS1 protein in Solanum melongena; The SmEPS1 protein comprises any one of the following amino acid sequences: (1) an amino acid sequence as shown in SEQ ID NO. 1; or (2) an amino acid sequence obtained by substitution, insertion or deletion of one or more amino acids of the amino acid sequence as shown in SEQ ID NO. 1, and having the same function as the SmEPS1 protein.

7. Use according to any one of claims 4 to 6, characterized in that, The method for regulating the expression level of the SmEPS1 protein in Solanum melongena comprises any one of the following methods:

8. A method of breeding a transgenic Solanum melongena plant, comprising: gene editing, hybridization, backcrossing, selfing or vegetative reproduction; The gene editing preferably comprises one or more of the following methods: Ti plasmid, plant virus vector, direct DNA transformation, microinjection, gene gun, electroporation or Agrobacterium-mediated method. ​ ​ ​ 9. The method of claim 8, wherein, ​ ​ ​

Citation Information

Patent Citations

  • Solanum melongena L. SmWRKY transcription factor and application thereof in improving resistance of Solanum melongena L. to ralstonia solanacearum

    CN112225788A

  • Eggplant E3 ubiquitin ligase gene SmDDA1b and application thereof in improving bacterial wilt resistance

    CN113789312A

  • StEIP gene enhancing resistance to Bacterial wilt and use thereof

    KR1020130054545A