Pitaya U6 gene promoter and application thereof

Abstract

The invention discloses a pitaya U6 gene promoter and application thereof. The dragon fruit U6 gene promoter disclosed by the invention is any one of proHuU6.1, proHuU6.1. 2 and proHuU6.1.3, the DNA (Deoxyribose Nucleic Acid) nucleotide sequence of the proHuU6.1 is shown as SEQ ID NO.4, the DNA nucleotide sequence of the proHuU6.1. 2 is shown as SEQ ID NO.5, and the DNA nucleotide sequence of the proHuU6.1.3 is shown as SEQ ID NO.6. The dragon fruit U6 gene promoter disclosed by the invention has the advantages that the dragon fruit U6 gene promoter can be used for promoting the growth of the dragon fruit; the RNA polymerase III type promoter, namely the pitaya endogenous U6 promoter, of the pitaya U6 snRNA gene is obtained through cloning in the pitaya genome DNA for the first time, an efficient promoter sequence is provided for research on transformation of the pitaya and related plants, and the method has important significance on construction of a pitaya gene editing system and creation of pitaya germplasm resources with excellent characters.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, particularly the field of plant transgenic technology, and specifically relates to a dragon fruit U6 gene promoter and application thereof. BACKGROUND

[0002] Dragon fruit (S. longicaulis (Haw.) Britton & Rose) belongs to the genus of Cactaceae, and is one of the most distinctive fruit crops in tropical and subtropical regions. It occupies an increasingly important position in the global fruit market due to its unique taste, rich nutritional value, ornamental value, medicinal and industrial value. Dragon fruit is widely distributed in the tropical and subtropical regions of the world within 30° north and south latitudes. In China, dragon fruit is mainly distributed in southern coastal provinces such as Hainan, Guangdong and Guangxi. Dragon fruit has the characteristics of heat tolerance, drought tolerance, low requirement for soil fertility and strong adaptability. Its fruit is rich in dietary fiber, minerals, proteins, unsaturated fatty acids and various antioxidants, and has high nutritional value. Hylocereus undatus Hylocereus Gene editing technology is a revolutionary biotechnology that enables scientists to precisely edit and modify specific gene sequences based on various tools. Its application in agriculture includes improving crop disease resistance, stress tolerance, modifying nutritional components, increasing yield, and reducing pesticide use. Currently, the CRISPR-Cas system is widely used in plant gene editing. CRISPR-Cas technology is a gene editing technology developed based on the natural immune mechanism of bacteria, which precisely locates and cuts DNA through guide RNA and Cas protein to achieve targeted modification of the genome.

[0003] Gene editing technology is a revolutionary biotechnology that enables scientists to precisely edit and modify specific gene sequences based on various tools. Its application in agriculture includes improving crop disease resistance, stress tolerance, modifying nutritional components, increasing yield, and reducing pesticide use. Currently, the CRISPR-Cas system is widely used in plant gene editing. CRISPR-Cas technology is a gene editing technology developed based on the natural immune mechanism of bacteria, which precisely locates and cuts DNA through guide RNA and Cas protein to achieve targeted modification of the genome.

[0004] ​U6 promoter is a kind of RNA promoter specifically recognized by RNA polymerase III (Pol III), and its core function is to drive the transcription of U6 small nuclear RNA (U6 snRNA), and then participate in the splicing regulation of pre-mRNA in plant cells. U6 promoter has become a commonly used promoter to drive sgRNA expression in CRISPR-Cas system due to its high transcription activity and structural conservation. U6 promoter contains two core regulatory elements: upstream activating sequence (USE) element that regulates transcription activity, and TATA box element that is recognized and combined by RNA polymerase III to drive promoter transcription, which together determines the transcription efficiency and species specificity of the promoter. In plant gene editing, using endogenous U6 promoter (i.e. the U6 promoter of the target species itself) is usually more advantageous than borrowing the U6 promoter of other species across species. For example, in cotton, the editing efficiency of using cotton endogenous U6 promoter is higher than that of using Arabidopsis U6 promoter. Currently, endogenous U6 promoter has been used to construct CRISPR / Cas9 editing system in rice, Arabidopsis, tobacco, wheat, lettuce and grape, achieving high-efficiency editing system. In gene editing system, the CRISPR / Cas9 vector is too large, increasing the difficulty of infection, and previous studies have found that there is an inhibitor at the 5' end of the U6 promoter. For example, in cotton, the GbU6-5P promoter is truncated by 6 fragments of 672, 468, 358, 280, 202 and 105 bp, and the truncated 105 bp still has transcription activity, and the activity increases with the length of the truncated length. In jute, the CcU6.3 promoter is truncated to 550 bp, which has higher transcription activity than the full-length fragment promoter in N. benthamiana leaves and hairy roots. In apple, the U6 promoter on chromosome 10 is truncated to 1500, 959, 275 and 116 bp, and the 275 bp length promoter has the highest fluorescence value and the highest transcription activity in tobacco leaves. Therefore, the cloned U6 promoter with high transcription activity and appropriate length is conducive to the construction of CRISPR / Cas9 vector.

[0005] At present, there is no systematic research on the sequence characteristics, transcriptional regulation mechanism and applicability of dragon fruit U6 promoter in gene editing system, which is the primary key technical obstacle for the establishment of dragon fruit gene editing technology system. SUMMARY

[0006] The purpose of the present application is to solve the above problems, and provide a dragon fruit U6 gene promoter and its application.

[0007] In order to achieve the purpose of the present application, the technical scheme adopted by the present application is: The first aspect of the present application provides a pitaya U6 gene promoter, wherein the pitaya U6 gene promoter is any one of proHuU6.1, proHuU6.1.2 and proHuU6.1.3, the DNA nucleotide sequence of the proHuU6.1 is shown in SEQ ID NO. 4, the DNA nucleotide sequence of the proHuU6.1.2 is shown in SEQ ID NO. 5, and the DNA nucleotide sequence of the proHuU6.1.3 is shown in SEQ ID NO. 6.

[0008] The second aspect of the present application provides an expression cassette containing the above-mentioned promoter.

[0009] The third aspect of the present application provides a recombinant vector containing the above-mentioned promoter or the above-mentioned expression cassette.

[0010] Preferably, the recombinant vector is a recombinant expression vector or a recombinant cloning vector.

[0011] Preferably, the backbone vector of the recombinant expression vector is a plant binary expression vector pCAMBIA1303, and the backbone vector of the recombinant cloning vector is pMD 19-T.

[0012] The fourth aspect of the present application provides a recombinant bacterium containing the above-mentioned promoter, expression cassette or recombinant vector.

[0013] The fifth aspect of the present application provides the above-mentioned pitaya U6 gene promoter for any one of the following applications: (1) application in constructing an expression cassette, a recombinant vector or a recombinant bacterium; (2) application in constructing a transgenic plant; (3) application in plant molecular breeding; (4) application in starting expression of a target gene in a plant; The plant is pitaya or Arabidopsis.

[0014] The sixth aspect of the present application provides a method for expressing a target nucleic acid molecule in a plant, the method comprising introducing a nucleic acid construct into the plant, wherein the nucleic acid construct contains the above-mentioned promoter and a target nucleic acid molecule operably linked to the promoter, and the plant is pitaya or Arabidopsis.

[0015] The present application has the following beneficial effects: This invention is the first to clone the type III RNA polymerase promoter of the dragon fruit U6 snRNA gene—the endogenous dragon fruit U6 promoter—from the dragon fruit genomic DNA. This promoter was fused with the GUS gene, and the inflorescences of Arabidopsis thaliana were infected using Agrobacterium-mediated transformation to obtain T2 generation transgenic Arabidopsis thaliana. Stable expression of GUS confirmed the transcriptional activity of this promoter in leaves, cauline leaves, stems, pods, and inflorescences, providing a U6 promoter sequence for dragon fruit gene editing and transformation research. Furthermore, this invention is the first to truncate the active dragon fruit U6 gene promoter proHuU6.1, obtaining the truncated dragon fruit U6 gene promoters proHuU6.1.2 and proHuU6.1.3. The construction of a fusion expression vector with the GUS gene verified that the truncated dragon fruit U6 gene promoters still possess transcriptional activity, with proHuU6.1.2 exhibiting the highest transcriptional activity. The dragon fruit U6 promoter of this invention provides an efficient promoter sequence for the study of transformation of dragon fruit and closely related plants, which is of great significance for constructing a dragon fruit CRISPR / Cas gene editing system and creating dragon fruit germplasm resources with superior traits. Attached Figure Description

[0016] Figure 1 This is a sequence comparison diagram of the dragon fruit proHuU6.1 promoter and the Arabidopsis thaliana U6 promoter.

[0017] Figure 2 The image shows an agarose gel electrophoresis diagram of the cloned HuU6+U6 snRNA sequence analysis. Lanes 1 and 2 in the diagram are the amplified bands of HuU6+U6 snRNA.

[0018] Figure 3 Agarose gel electrophoresis images of the amplification products of promoters proHuU6.1, proHuU6.1.2, and proHuU6.1.3.

[0019] Figure 4 Agarose gel electrophoresis image showing PCR-positive identification of the T1 generation transgenic Arabidopsis thaliana using the GUS fusion expression vector of the dragon fruit U6 promoter.

[0020] Figure 5 GUS staining image of leaves from T2 generation transgenic Arabidopsis thaliana plants with GUS fusion expression vector of dragon fruit U6 promoter.

[0021] Figure 6 The image shows the quantitative results of the GUS gene in the T2 generation transgenic Arabidopsis thaliana plants of the dragon fruit U6 promoter GUS fusion expression vector.

[0022] Figure 7 GUS staining images of various tissues of T2 generation transgenic Arabidopsis thaliana plants with the GUS fusion expression vector of dragon fruit U6 promoter. Detailed Implementation

[0023] In order to make the objectives, technical solutions and advantages of the present application clearer, the present application will be further described in detail below with reference to the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present application and not used to limit the present application.

[0024] The methods involved in the following examples are all conventional methods unless otherwise specified.

[0025] Example 1 Obtaining of the Pitaya U6 gene promoter and construction of the promoter GUS fusion expression vector According to the conservation of U6 gene sequence among different species, the 102bp U6 snRNA DNA sequence conserved in the AtU6-26 gene (Genebank accession number: X52528.1) of Arabidopsis thaliana was used for sequence comparison with the pitaya genomic sequence (http: / / www.pitayagenomic.com / download.php), and a pitaya candidate HuU6 gene was found. The upstream reference sequence of the gene was obtained, and the Arabidopsis U6 promoter + U6 snRNA sequence was compared with the pitaya U6 promoter + U6 snRNA sequence using the DNAMAN software, as shown in Figure 1 The pitaya U6 promoter contains a typical TATA-like box element (TATA-like box) and upstream sequence element USE combined with pol III RNA polymerase. The primer pair HuU6-1F and HuU6-1R was designed upstream and downstream of the obtained candidate pitaya U6 promoter + U6 snRNA sequence to amplify the pitaya U6 promoter + U6 snRNA sequence fragment.

[0026] 100mg of fresh pitaya stem segments were ground into powder by liquid nitrogen freezing and thawing method, and the pitaya stem segment genomic DNA was extracted by CATB method. The DNA concentration was measured using a spectrophotometer, and the quality was detected using 1% agarose gel.

[0027] The Pitaya stem segment genomic DNA was used as a template, and HuU6-1F and HuU6-1R were used as primers. PCR amplification was performed using PrimeSTAR® Max DNA Polymerase high-fidelity polymerase (TaKaRa, Japan). The reaction system was 50 μL, 1 μL of 10 μM HuU6-1F and HuU6-1R primers, 200 ng-500 ng of Pitaya genomic DNA, 25 μL of PrimeSTAR® Max DNA Polymerase, and sterile water was added to 50 μL. The PCR reaction program was as follows: 98°C pre-denaturation for 5 min; then 95°C for 30 s, 60°C for 45 s, 72°C for 90 s, 35 cycles; 72°C for 5 min. The sequences of the primers HuU6-1F and HuU6-1R were as follows: HuU6-1F (SEQ ID NO. 1): 5'-TTGTTTCCAGGGTAAGTCTGTCTGC-3'; HuU6-1R (SEQ ID NO. 2): 5'-AAAAAAATTTGGACCATTTCTCGATT-3'.

[0028] The amplification results are shown in Figure 2 The amplified band was 1217 bp (the sequence is shown in SEQ ID NO. 3), which was the Pitaya U6 promoter + U6 snRNA gene amplification band. The obtained PCR product was added with A tail and connected to T vector pMD 19-T (TaKaRa, Japan). The E. coli was transformed, and the bacterial liquid PCR was identified. After Sanger sequencing identification, the result was correct, and it was named p19T-U6.

[0029] According to the sequence of the U6 promoter + U6 snRNA sequence of the pitaya shown in SEQ ID NO. 3 obtained by sequencing, the 802 bp upstream of the transcription start G of the pitaya U6 snRNA gene was used as the U6 promoter, named proHuU6.1 (the sequence is shown in SEQ ID NO. 4), and two different promoter truncations were obtained by 5' end truncation of the promoter: the first one was 584 bp, named proHuU6.1.2 (the sequence is shown in SEQ ID NO. 5); the second one was 329 bp, named proHuU6.1.3 (the sequence is shown in SEQ ID NO. 6). The PCR amplification primers of the proHuU6.1 promoter and its truncated fragments were designed, and 15 bp upstream and downstream of the vector restriction enzyme site was added at the 5' end of the primers. PCR amplification was performed using p19T-U6 bacterial liquid as the template, using PrimeSTAR® Max DNA Polymerase high-fidelity polymerase for PCR amplification, the reaction system was 50 μL, 10 μM of the upstream and downstream primers 1 μL each, p19T-U6 bacterial liquid 1 μL, PrimeSTAR® Max DNA Polymerase 25 μL, sterilized water supplemented to 50 μL; the PCR reaction program was: 95°C pre-denaturation for 5 min; 95°C for 30 s, 65°C for 45 s, 72°C for 90 s, 35 cycles; 72°C for 5 min. The amplification primers of the promoters proHuU6.1, proHuU6.1.2, and proHuU6.1.3 are as follows (the bases shown in underlined lowercase letters are the vector homologous arm sequences): The amplification primer pair of proHuU6.1 is proHuU6.1-F / proHuU6.1-R: proHuU6.1-F (SEQ ID NO. 7): 5’- cggtacccggggatc GTAAGTGAGCAAAGAGGAACCTTCT-3’; proHuU6.1-R (SEQ ID NO. 8): 5’ -gtcagatctaccatg AGCAACAAGCCTGTTCTGCAG-3’; The amplification primer pair of proHuU6.1.2 is proHuU6.1.2-F / proHuU6.1-R (SEQ ID NO. 8): proHuU6.1.2-F (SEQ ID NO. 9) 5’- cggtacccggggatc GTGGCAGAATATGTGGTGCAGTG-3’; The amplification primer pair for proHuU6.1.3 is proHuU6.1.3-F / proHuU6.1-R (SEQ ID NO.8): proHuU6.1.3-F (SEQ ID NO.10): 5'- cggtacccggggatc TGCATAGAACTCCTAGATTATTTTG-3'.

[0030] The downstream amplification primers for promoters proHuU6.1.2 and proHuU6.1.3 are both proHuU6.1-R (SEQ ID NO: 6.1-R). ID NO.8).

[0031] PCR products were identified using a 1% agarose gel electrophoresis, such as... Figure 3 As shown, amplified bands containing vector homologous arms (proHuU6.1, proHuU6.1.2, and proHuU6.1.3) were successfully obtained. The PCR products were purified and recovered to obtain the promoter fragments, which were then sequenced. The sequences of the proHuU6.1, proHuU6.1.2, and proHuU6.1.3 amplified bands were the corresponding promoter sequences (shown in SEQ ID NO.4, SEQ ID NO.5, or SEQ ID NO.6) plus the vector homologous arm sequences at both ends. BamHI and Nco The plant binary expression vector pCAMBIA1303 (selected for the hygromycin gene) was digested overnight with restriction enzyme I, and the linearized vector was purified and recovered. The promoter and linearized vector were ligated using the ClonExpress II One Step Cloning Kit (Novozymes, China). The ligation system consisted of: 2 μL of 5*CE II Buffer, 200 ng of linearized vector, 50 ng of recovered promoter fragment, and sterile water to a final volume of 10 μL. Homologous recombination was performed at 37℃ for 30 min to obtain the recombinant product. The recombinant product was transformed into *E. coli*, and bacterial PCR was performed to identify the successful acquisition of the dragon fruit U6 promoter GUS fusion expression vectors: pCAMBIA1303-proHuU6.1::GUS expression vector, pCAMBIA1303-proHuU6.1.2::GUS expression vector, and pCAMBIA1303-proHuU6.1.3::GUS expression vector.

[0032] Example 2: Genetic transformation of dragon fruit U6 promoter GUS fusion expression vector and verification of promoter function I. Genetic Transformation of Dragon Fruit U6 Promoter GUS Fusion Expression Vector The pCAMBIA1303-proHuU6.1::GUS expression vector, the pCAMBIA1303-proHuU6.1.2::GUS expression vector, and the pCAMBIA1303-proHuU6.1.3::GUS expression vector obtained in Example 1 were transformed into GV3101 Agrobacterium by a liquid nitrogen quick-freezing method. The GUS fusion expression vector of the pitaya U6 promoter was transformed into Arabidopsis thaliana by a transformation method of infecting Arabidopsis thaliana inflorescences with Agrobacterium, with wild-type Arabidopsis thaliana (col) as the receptor.

[0033] Seeds of Arabidopsis thaliana obtained after the GUS fusion expression vector of the pitaya U6 promoter was infected with GV3101 Agrobacterium were collected, the seeds were sterilized with 75% alcohol, and then were sowed on 1 / 2 MS medium containing 60 mg / L of a selection antibiotic hygromycin for resistance screening. Arabidopsis thaliana seedlings with true leaves and roots were transplanted into soil for further culture. Five Arabidopsis thaliana seedlings transformed with each of the GUS fusion expression vectors of the pitaya U6 promoter were selected for PCR identification. Genomic DNA of transgenic Arabidopsis thaliana rosette leaves was extracted for PCR identification. The proHuU6.1 promoter fragment was identified by PCR using primers proHuU6.1-F and proHuU6.1-R, the proHuU6.1.2 promoter fragment was identified by PCR using primers proHuU6.1.2-F and proHuU6.1-R, and the proHuU6.1.3 promoter fragment was identified by PCR using primers proHuU6.1.3-F and proHuU6.1-R. PCR was performed using 2× Taq Master Mix (Novozyme, China), and the PCR reaction system was as follows: 1 μL of each of 10 μM upstream and downstream primers, 100-200 ng of transgenic Arabidopsis thaliana rosette leaf genomic DNA, 5 μL of 2× Taq Master Mix, and sterilized water to make up to 10 μL. The PCR reaction program was as follows: 95°C for 7 min; 95°C for 30 s, 64°C for 45 s, and 72°C for 1 min, for 35 cycles; and 72°C for 5 min. The PCR amplification products were detected by agarose electrophoresis, as shown in FIG. 3, the sizes of the three promoter amplification bands in the transgenic Arabidopsis thaliana rosette leaf genomic DNA were correct. Figure 4

[0034] II. Verification of the functions of the pitaya proHuU6.1, proHuU6.1.2, and proHuU6.1.3 promoters Seeds of the positive T1 generation Arabidopsis thaliana plants selected were collected, the seeds were sterilized with 75% alcohol, and then were sowed on 1 / 2 MS medium containing 60 mg / L of a selection antibiotic hygromycin for resistance screening. Arabidopsis thaliana seedlings with true leaves and roots were transplanted into soil for further culture. T2 generation transgenic Arabidopsis thaliana plants of the GUS fusion expression vector of the pitaya U6 promoter were obtained.​

[0035] GUS histochemical staining results of T2 generation transgenic Arabidopsis plants with dragon fruit U6 promoter GUS fusion expression vector are shown in

[0036] The wild type Arabidopsis plants were used as negative control, and the rosette leaves, petioles, stems, pods and flowers of the transgenic plants and wild type plants were placed in the prepared GUS staining solution (200Ml: 0.7444 g EDTA-2Na + 0.3292 g potassium ferricyanide + 0.4224 g potassium ferrocyanide + 190 mL sodium phosphate buffer (PH 7.0) + 1 mL 10 mM X-Gluc), and stained at 37°C for 48 h. After staining, the samples were repeatedly decolorized to remove chlorophyll until the green color faded, and then photographed under a body microscope. The leaf tissues of T2 generation transgenic Arabidopsis and wild type Arabidopsis were quickly frozen in liquid nitrogen, ground into powder, and GUS protein was extracted according to the instructions of the GUS reporter gene quantitative detection kit (Shanghai Bolson, China). The protein content was determined according to the instructions of the Bradford protein concentration determination kit (Shanghai Bolson, China), and the protein standard curve was prepared. The 4-MUG standard curve was prepared and the 4-MUG fluorescence value was determined according to the instructions of the GUS reporter gene quantitative detection kit.

[0036] GUS histochemical staining results of T2 generation transgenic Arabidopsis plants with dragon fruit U6 promoter GUS fusion expression vector are shown in Figure 5 No blue color was observed in the wild type Arabidopsis, but blue color was observed in the leaves of proHuU6.1, proHuU6.1.2 and proHuU6.1.3 transgenic Arabidopsis, with different shades of blue color. The blue color of proHuU6.1 was lighter, while the blue color of pHUU6.1.2 and pHUU6.1.3 was darker. GUS staining of the three promoters was mainly concentrated in the leaf veins and petioles.

[0037] GUS histochemical staining results of T2 generation transgenic Arabidopsis plants with dragon fruit U6 promoter GUS fusion expression vector are shown in Figure 6 The GUS activity of proHuU6.1.2 promoter was the highest, reaching 9023.3 pmol / min / mg, followed by proHuU6.1.3 promoter, with a GUS activity of 7650.1 pmol / min / mg, and the GUS activity of proHuU6.1 was the lowest, reaching 5139.9 pmol / min / mg.

[0038] The GUS staining and GUS gene quantitative detection results of transgenic Arabidopsis leaves showed that the three promoters had transcriptional activity in Arabidopsis, and the proHuU6.1.2 promoter with a truncated proHuU6.1 of 584 bp had the highest transcriptional activity.

[0039] GUS histochemical staining results of T2 generation transgenic Arabidopsis plants with dragon fruit U6 promoter GUS fusion expression vector are shown inFigure 7 As shown in the figure, no blue color is observed in the rosette leaf, leaf sheath, stem, fruit pod and flower tissue of the wild type Arabidopsis plant, and GUS staining is detected in the rosette leaf, leaf sheath, stem, fruit pod and flower tissue of the transgenic Arabidopsis plant with the proHuU6.1 promoter, the proHuU6.1.2 promoter and the proHuU6.1.3 promoter, which indicates that the proHuU6.1 promoter, the proHuU6.1.2 promoter and the proHuU6.1.3 promoter have transcriptional activity in the rosette leaf, leaf sheath, stem, fruit pod and flower tissue.

[0040] The nucleotide sequence of the pitaya U6 gene promoter in the application is as follows: 1. The sequence (SEQ ID NO. 4) of the promoter proHuU6.1 is as follows: GTAAGTGAGCAAAGAGGAACCTTCTGAGGATGTGAATTAAGTCATGGCTCCTTGTATTTCTCTAAGCTATCTGAGTACTTCAGCACTTGTATACTTCAACTTTGTGATCAATCCTCTAGTATTCAGCAACAGCAATCCTTTTTTGAGACTGATTAGTTTGAGTTCTGCTTGTGTGATGGTTAGTGCTTTTGTCCAACTTATGAGAGCATCCTACAAATGTGGCAGAATATGTGGTGCAGTGTTCTGCGGACATCGTAGAGTTTAGACCTATGATGCTATTTTCACCTTGAGACAGGTCAAGGAGCCAATCCTCCGGAGTTTGAAGCCACAGAAATCCCCAGCGGTCCAGAAAGACAGGAGTGGTTTGTTAGTAATAAGGTGAATACTTTTGCTGCGTCGTTGTTGTCATGTTATATGCATCTTACTTGCTCTTTTTAGTTTAACACACACAACTGCTGCTTGCAAATAACGGTTGCATAGAACTCCTAGATTATTTTGCAAATCATGGTATGTCACCGGTTTTTTCCCCTGTATAAGTTCATCGAATAACTTACAACGAGTTTGTGAACTTAATCGGTGTGCAGTACTTCCACCCTTGTTAATTGTGGTTCAAATTGAAGGGTCCTTTGGCAGGAGAGGGGATTTTCAGGCAGGAGGGCTTTGCATAGCCGTTTGTCAATAGGGTTTGTGCGTTCATAGAGGTGTGATGTGGGCCTAGCATGCCTAATGCAGAGGAAAGTCCCACATTGCTATTTATGTAATTCAGTTGTTGTTGATATTCCTGCAGAACAGGCTTGTTGCT.

[0041] 2. The sequence of the promoter proHuU6.1.2 (SEQ ID NO. 5) is: GTGGCAGAATATGTGGTGCAGTGTTCTGCGGACATCGTAGAGTTTAGACCTATGATGCTATTTTCACCTTGAGACAGGTCAAGGAGCCAATCCTCCGGAGTTTGAAGCCACAGAAATCCCCAGCGGTCCAGAAAGACAGGAGTGGTTTGTTAGTAATAAGGTGAATACTTTTGCTGCGTCGTTGTTGTCATGTTATATGCATCTTACTTGCTCTTTTTAGTTTAACACACACAACTGCTGCTTGCAAATAACGGTTGCATAGAACTCCTAGATTATTTTGCAAATCATGGTATGTCACCGGTTTTTTCCCCTGTATAAGTTCATCGAATAACTTACAACGAGTTTGTGAACTTAATCGGTGTGCAGTACTTCCACCCTTGTTAATTGTGGTTCAAATTGAAGGGTCCTTTGGCAGGAGAGGGGATTTTCAGGCAGGAGGGCTTTGCATAGCCGTTTGTCAATAGGGTTTGTGCGTTCATAGAGGTGTGATGTGGGCCTAGCATGCCTAATGCAGAGGAAAGTCCCACATTGCTATTTATGTAATTCAGTTGTTGTTGATATTCCTGCAGAACAGGCTTGTTGCT.

[0042] 3. The sequence of the promoter proHuU6.1.3 (SEQ ID NO. 6) is: TGCATAGAACTCCTAGATTATTTTGCAAATCATGGTATGTCACCGGTTTTTTCCCCTGTATAAGTTCATCGAATAACTTACAACGAGTTTGTGAACTTAATCGGTGTGCAGTACTTCCACCCTTGTTAATTGTGGTTCAAATTGAAGGGTCCTTTGGCAGGAGAGGGGATTTTCAGGCAGGAGGGCTTTGCATAGCCGTTTGTCAATAGGGTTTGTGCGTTCATAGAGGTGTGATGTGGGCCTAGCATGCCTAATGCAGAGGAAAGTCCCACATTGCTATTTATGTAATTCAGTTGTTGTTGATATTCCTGCAGAACAGGCTTGTTGCT.

Claims

1. A Hylocereus U6 gene promoter, characterized in that: The fire dragon fruit U6 gene promoter is any one of proHuU6.1, proHuU6.1.2, and proHuU6.1.3, the DNA nucleotide sequence of the proHuU6.1 is shown as SEQ ID NO. 4, the DNA nucleotide sequence of the proHuU6.1.2 is shown as SEQ ID NO. 5, and the DNA nucleotide sequence of the proHuU6.1.3 is shown as SEQ ID NO.

6.

2. An expression cassette comprising the promoter of claim 1.

3. A recombinant vector comprising the promoter of claim 1 or the expression cassette of claim 2.

4. The recombinant vector of claim 3, wherein: The recombinant vector is a recombinant expression vector or a recombinant cloning vector.

5. The recombinant vector of claim 4, wherein: The backbone vector of the recombinant expression vector is a plant binary expression vector pCAMBIA1303, and the backbone vector of the recombinant cloning vector is pMD 19-T.

6. A recombinant bacterium comprising the promoter of claim 1, the expression cassette of claim 2, or the recombinant vector of claim 3.

7. The fire dragon fruit U6 gene promoter of claim 1 is applied in any one of the following: (1) in the construction of an expression cassette, a recombinant vector, or a recombinant bacterium; (2) in the construction of a transgenic plant; (3) in plant molecular breeding; (4) in the expression of a target gene in a plant; The plant is a fire dragon fruit or Arabidopsis thaliana.

8. A method of expressing a nucleic acid molecule of interest in a plant, comprising: The method comprises introducing a nucleic acid construct into a plant, the nucleic acid construct comprising the promoter of claim 1 and a target nucleic acid molecule operably linked to the promoter; and the plant is a fire dragon fruit or Arabidopsis thaliana.

Images