Compositions and methods comprising male fertility sequences

Abstract

The present application relates to compositions and methods comprising male fertility sequences. The present invention provides compositions and methods for modulating male fertility in plants. The compositions comprise nucleotide sequences that modulate male fertility, and active fragments and variants thereof. The present invention also provides expression cassettes comprising a male fertility polynucleotide, or an active fragment or variant thereof, operatively linked to a promoter wherein the expression of the polynucleotide modulates male fertility in a plant. Various methods are also provided in which the levels and / or activity of the sequences that affect male fertility are modulated in a plant or plant part.

Description

[0001] This application is a divisional of (application number: 202110682594.9, filing date 2013.09.06), the original parent application number is 201380046655.6 and the filing date is 2013.09.06. TECHNICAL FIELD

[0002] The present invention relates to the field of plant molecular biology, more specifically, to affecting male fertility. Incorporation by reference of electronically submitted sequence listing

[0003] The official copy of the sequence listing is submitted electronically via EFS-Web as an ASCII formatted sequence listing with a file name of 5282-PCT_ST25.txt, a date of September 6, 2013, and a size of 42 KB and is filed concurrently with the specification. The sequence listing contained in this ASCII formatted document is part of the specification and is herein incorporated by reference in its entirety. The foregoing text file is identical to the sequence listing file submitted electronically herewith. BACKGROUND

[0004] The development of hybrid plant breeding has made it possible to achieve considerable progress in quality and quantity of the crops produced. As a result of the hybridization procedure, yield increases, combinations of desired characteristics such as resistance to diseases and pests, heat and drought tolerance, and changes in plant composition can occur. These procedures in many cases rely primarily on the provision of a male parent that contributes pollen to a female parent to produce the resulting hybrid.

[0005] Field crops are bred through techniques that take advantage of a plant's method of pollination. A plant is self-pollinated if pollen from one flower is transferred to another flower of the same plant or to another flower on the same plant. A plant is cross-pollinated if the pollen comes from a flower on a different plant.

[0006] In certain species, such as Brassica campestris, plants are generally self-sterile and can only be cross-pollinated. In self-pollinated species, such as soybean and cotton, male and female plants are anatomically hermaphroditic. During natural pollination, the male reproductive organs of one flower pollinate the female reproductive organs of the same flower.

[0007] Common wheat (Triticum aestivum) is a hexaploid plant with three pairs of homologous chromosomes of defined genomes A, B, and D. The endosperm of a wheat grain includes 2 haploid complements from the maternal cell and 1 haploid complement from the paternal cell. The embryo of a wheat grain includes one haploid complement from each of the maternal and paternal cells. Hexaploidy is considered a significant obstacle in the process of studying and developing useful variants of wheat. Indeed, little is known about how the homologous genes of wheat interact, how expression of these homologous genes is regulated, and how the different proteins produced from the homologous genes function independently or in concert.

[0008] A necessary aspect of much of the work with genetic male sterility systems is the identification of genes that affect male fertility. Such genes can be used in a variety of systems, including those described herein, to control male fertility. SUMMARY

[0009] The present invention provides compositions and methods for modulating male fertility in plants. The compositions include nucleotide sequences that modulate male fertility, as well as active fragments and variants thereof. The present invention also provides expression cassettes comprising one or more of a male fertility polynucleotide, or active fragment or variant thereof, operably linked to a promoter, wherein expression of the polynucleotide modulates male fertility of a plant. The present invention also provides various methods in which the level and / or activity of a polynucleotide that affects male fertility is modulated in a plant or plant part. BRIEF DESCRIPTION OF DRAWINGS

[0010] Figure 1 An alignment across the MS26+ target site (SEQ ID NO: 21) is shown for the wheat MS26 gene, i.e., the A genome (SEQ ID NO: 28), the B genome (SEQ ID NO: 29), and the D genome (SEQ ID NO: 30), compared to the MS26 ortholog of maize (SEQ ID NO: 31), the MS26 ortholog of sorghum (SEQ ID NO: 32), and the MS26 ortholog of rice (SEQ ID NO: 33).

[0011] Figure 2 An alignment of NHEJ (non-homologous end joining) mutations induced by MS26+ homing endonuclease described herein is shown. The mutations were identified by deep sequencing. The reference sequence shows the unmodified locus, with the genomic target site underlined. The expected cleavage site is also indicated. Deletions due to imperfect NHEJ are shown as “-”. The reference sequence corresponds to Fielder wheat Ms26 (SEQ ID NO: 34).

[0012] Figure 3 Types of NHEJ mutations induced by MS26+ homing endonuclease are shown. The mutations were identified by sequencing subcloned PCR products in DNA vectors. MS26 allele labels 1, 2, and 3 likely refer to wheat genomic copies D, A, and B, respectively.

[0013] Figure 4 Alignments of NHEJ mutations induced by MS26+ homing endonuclease are shown. The top sequence is the MS26 target site (SEQ ID NO: 21) compared to the reference sequence showing the unmodified locus (SEQ ID NO: 45). Deletions due to imperfect NHEJ are shown as “-”, while gaps represent C nucleotide insertions in SEQ ID NO: 50. The mutations were identified by sequencing subcloned PCR products in DNA vectors. DETAILED DESCRIPTION

[0014] The present application is described in greater detail below, by way of example only, with reference to the accompanying drawings, wherein:

[0015] Many modifications and other embodiments of the inventions set forth herein will come to mind to one skilled in the art to which these inventions pertain having the benefit of the teachings presented in the foregoing descriptions and the associated drawings. Therefore, it is to be understood that the inventions are not to be limited to the specific embodiments disclosed and that modifications and other embodiments are intended to be included within the scope of the appended claims. Although specific terms are employed herein, they are used in a generic and descriptive sense only and not for purposes of limitation.

[0016] I. Male fertility polynucleotides

[0017] The compositions disclosed herein comprise polynucleotides and polypeptides that affect male fertility. In particular, isolated polynucleotides are provided that comprise a nucleotide sequence encoding the amino acid sequence set forth in SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, or 18, or an active fragment or variant thereof. Also provided are polypeptides having an amino acid sequence encoded by a polynucleotide described herein, such as those set forth in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, or 17, or an active fragment or variant thereof.

[0018] Sexually reproducing plants develop specialized tissues dedicated to the production of male and female gametes. Successful production of male gametes relies on proper formation of male reproductive tissues. Anthers, which embody the male reproductive organs of a plant, contain various cell types, including, for example, filaments, anthers, tapetum, and pollen. As used herein, "male tissue" refers to specialized tissues in a sexually reproducing plant responsible for the production of male gametes. Male tissue includes, but is not limited to, anthers, filaments, anthers, tapetum, and pollen.

[0019] The process of mature pollen grain formation begins with microsporogenesis, in which a microcyte is formed in the sporogenous tissue of the anther. This is followed by microgametogenesis, in which the microcyte divides mitotically, followed by development into a microgametophyte or pollen grain. The state of "male fertility" or "male fertile" refers to those plants that produce mature pollen grains that are capable of fertilizing a female gamete to produce progeny. As used herein, the terms "affecting male fertility" or "modulating male fertility" refer to any enhancement or decrease in the ability of a plant to produce mature pollen grains when compared to a suitable control. "Mature pollen grain" or "mature pollen" refers to any pollen grain that is capable of fertilizing a female gamete to produce progeny. Likewise, the terms "male fertility polynucleotide" or "male fertility polypeptide" refer to a polynucleotide or polypeptide that modulates male fertility. A male fertility polynucleotide may, for example, encode a polypeptide involved in the process of microsporogenesis or microgametogenesis.

[0020] The male fertility polynucleotides disclosed herein include homologs and orthologs of polynucleotides that have been demonstrated to affect male fertility. For example, the male fertility polynucleotides disclosed herein, and active fragments and variants thereof, include homologs and orthologs of Ms22 (also known as Msca1). Mutagenesis studies of Ms22 resulted in maize plants that were phenotypically male sterile, with anthers that did not emerge from the ear and lacked sporogenous tissue. West and Albertsen (1985) Maize Newsletter 59:87 (West and Albertsen, 1985, Maize Newsletter, vol. 59, p. 87); Neuffer et al. (1977) Mutants of Maize. Cold Spring Harbor Laboratory Press , Cold Spring Harbor, NY (Neuffer et al., 1977, Mutants of Maize, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY).

[0021] Plants lacking Ms22 expression exhibit physiological changes early in the development of reproductive tissues. It is believed that Ms22 has a role in another development that occurs earlier than the role of Ms45 or Ms26. Certain male sterility genes such as MAC1, EMS1, or GNE2 (Sorensen et al. (2002) Plant J. 29:581-594) prevent cell growth in the tetrads stage. Mutations in the SPOROCYTELESS / NOZZLE gene act early in development, but affect not only anther formation but also ovule formation, making the plant male and female sterile. The SPOROCYTELESS gene of Arabidopsis is required for the initiation of sporogenesis and encodes a novel nuclear protein (Genes Dev. 1999 Aug 15; 13(16):2108-17). Since Ms22 is critical for the progression of microsporogenesis, maintaining male fertility in Ms22 mutants is very reliable compared to other male sterility mutation constructs. As disclosed elsewhere herein, the Ms22 polynucleotide from wheat is set forth by SEQ ID NOs: 1, 3, and 5.

[0022] Additional male fertility polynucleotides include Ms26 polynucleotides and homologs and orthologs thereof. Ms26 polypeptides have been reported to have significant homology to P450 enzymes found in yeast, plants, and mammals. P450 enzymes have been extensively studied and characteristic protein domains have been elucidated. Ms26 proteins contain several structural motif features of eukaryotic P450 proteins, including a heme-binding domain FxxGxRxCxG (domain D; SEQ ID NO: 19), domain A A / GGXD / ETT / S (dioxygen binding domain; SEQ ID NO: 20), domain B (steroid binding domain), and domain C. Phylogenetic tree analysis indicates that Ms26 is most closely related to P450s involved in fatty acid omega hydroxylation found in Arabidopsis thaliana and Vicia sativa. See, e.g., U.S. Patent Publication No. 2012 / 0005792, which is incorporated herein by reference. As disclosed elsewhere herein, the Ms26 polynucleotide from wheat is set forth by SEQ ID NOs: 7, 9, and 11.

[0023] Additional male fertility polynucleotides and active fragments and variants thereof disclosed herein can also include homologs and orthologs of Ms45 polynucleotides. Ms45 polynucleotides are male fertility polynucleotides that are characterized in maize. Mutation of Ms45 during microspore vacuolization can result in the disruption of microspore development, thereby causing the mutated plant to be male sterile. When a cloned maize Ms45 polynucleotide is introduced into such a mutated male sterile plant, the gene can complement the mutation and confer male fertility. As disclosed elsewhere herein, Ms45 polynucleotides from wheat are shown by SEQ ID NOs: 13, 15, and 17.

[0024] Strategies to manipulate the expression of male fertility polynucleotides in wheat will need to take into account the ploidy level of the various wheat varieties. Common wheat is a hexaploid (N = 21) that contains three genomes designated A, B, and D; each genome contains seven pairs of non-homologous chromosomes. Einkorn wheat varieties are diploid (N = 7), while emmer wheat varieties are tetraploid (N = 14).

[0025] Disclosed herein are isolated or substantially purified nucleic acid molecule or protein compositions. An "isolated" or "purified" nucleic acid molecule, polynucleotide, or protein, or biologically active portion thereof, is substantially or essentially free of components of the natural environment with which it is found in nature. Thus, an isolated or purified polynucleotide or protein is essentially free of other cellular material, or culture medium when produced by recombinant techniques, or essentially free of chemical precursors or other chemicals when chemically synthesized. Optimally, an "isolated" polynucleotide is free of some of the sequences that naturally flank the polynucleotide in the genomic DNA of the organism in which the polynucleotide is found (i.e., sequences located at the 5' and 3' ends of the polynucleotide) (optimally, protein coding sequences). For example, in various embodiments, an isolated polynucleotide can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or 0.1 kb of nucleotide sequences that naturally flank the polynucleotide in genomic DNA of the cell from which the polynucleotide is derived. Proteins that are substantially free of cellular material include preparations of protein having less than about 30%, 20%, 10%, 5%, or 1% (by dry weight) of contaminating protein. When a polypeptide disclosed herein, or biologically active portion thereof, is produced by recombinant techniques, optimally, the culture medium is essentially free of the chemical precursors or other chemicals used to produce the polypeptide.

[0026] A "subject plant" or "subject plant cell" is a plant or plant cell in which a genetic alteration, such as a transformation, has been made to a gene of interest, or is a plant or plant cell that is genetically descended from, and comprises the alteration made in, a plant or cell so altered. A "control" or "control plant" or "control plant cell" provides a reference point against which to measure a change in phenotype of a subject plant or plant cell.

[0027] A control plant or plant cell can, for example, comprise: (a) a wild-type plant or plant cell, i.e., a plant or plant cell having the same genotype as the starting material used to make the genetic alteration that results in the subject plant or cell; (b) a plant or plant cell having the same genotype as the starting material but that has been transformed with a null construct, i.e., a construct that does not have a known effect on the trait of interest, such as a construct comprising a marker gene; (c) a plant or plant cell that is a non-transformed segregant in the progeny of the subject plant or plant cell; (d) a plant or plant cell that is genetically identical to the subject plant or plant cell but that has not been exposed to a condition or stimulus that induces expression of the gene of interest; or (e) the subject plant or plant cell itself under conditions in which the gene of interest is not expressed.

[0028] A. Fragments and variants of male fertility sequences

[0029] Also provided are fragments and variants of the disclosed polynucleotides and proteins encoded thereby. By "fragment" is meant a portion of a polynucleotide or a portion of an amino acid sequence encoded thereby, and thus a portion of a protein encoded thereby. Fragments of a polynucleotide can encode a protein fragment that retains a biological activity of the native protein, and thus affects male fertility. Alternatively, a fragment of a polynucleotide that is useful as a hybridization probe generally does not encode a fragment protein that retains a biological activity. Thus, a fragment of a nucleotide sequence can range from at least about 20 nucleotides, about 50 nucleotides, about 100 nucleotides, up to the full-length polynucleotide that encodes a polypeptide disclosed herein.

[0030] A fragment of a polynucleotide that encodes a biologically active portion of a polypeptide that affects male fertility will encode at least 15, 25, 30, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 525, or 537 contiguous amino acids, or up to the total number of amino acids present in a full-length polypeptide that affects male fertility (e.g., SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, and 18, respectively). A fragment of a polynucleotide that encodes a polypeptide that affects male fertility that is useful as a hybridization probe or PCR primer generally need not encode a biologically active portion of a polypeptide that affects male fertility.

[0031] Accordingly, fragments of the male fertility polynucleotides as disclosed herein can encode a biologically active portion of a male fertility polypeptide, or they can be fragments that can be used as hybridization probes or PCR primers using the methods disclosed below. Biologically active portions of male fertility polypeptides can be prepared by isolating a portion of one of the male fertility polynucleotides disclosed herein, expressing the encoded portion of the male fertility protein (e.g., by recombinant expression in vitro), and assessing the activity of the encoded portion of the male fertility polypeptide. Polynucleotides that are fragments of the male fertility polynucleotides comprise at least 16, 20, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, or 1629 nucleotides, or up to the number of nucleotides present in the full-length male fertility polynucleotides disclosed herein (i.e., SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, or 17, respectively).

[0032] A "variant" is intended to mean a substantially similar sequence. For polynucleotides, variants include deletions and / or additions of one or more nucleotides within one or more internal sites of a native polynucleotide, and / or substitutions of one or more nucleotides at one or more sites within the native polynucleotide. As used herein, a "native" or "wild-type" polynucleotide or polypeptide comprises a naturally occurring nucleotide sequence or amino acid sequence, respectively. For polynucleotides, conservative variants include sequences that encode the same amino acid sequence of one of the male fertility polypeptides disclosed herein due to the degeneracy of the genetic code. Naturally occurring allelic variants such as these can be identified in attested molecular biology techniques, e.g., using polymerase chain reaction (PCR) and hybridization techniques as outlined below. Variant polynucleotides also include polynucleotides that have been made by synthesis, such as those generated, for example, by using site-directed mutagenesis, but which still encode a male fertility polypeptide. In general, variants of a particular polynucleotide disclosed herein will have at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity to that particular polynucleotide (e.g., any one of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, or 17), as determined by sequence alignment programs and parameters described elsewhere herein.

[0033] Variants of the particular polynucleotides disclosed herein (i.e., reference polynucleotides) can also be assessed by comparing the percent sequence identity between the polypeptide encoded by the variant polynucleotide and the polypeptide encoded by the reference polynucleotide. Thus, for example, isolated polynucleotides encoding polypeptides having a given percent sequence identity to the polypeptide of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, or 18 are disclosed. The percent sequence identity between any two polypeptides can be calculated using the sequence alignment programs and parameters described elsewhere herein. In any given case in which a pair of the polynucleotides disclosed herein is assessed by comparing the percent sequence identity shared by the two polypeptides they encode, the percent sequence identity between the two encoded polypeptides is at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more.

[0034] A "variant" protein is intended to mean a protein derived from a native protein by deletion or addition of one or more amino acids at one or more internal sites in the native protein and / or substitution of one or more amino acids at one or more sites of the native protein. The variant proteins disclosed herein have biological activity, i.e., they continue to have the desired biological activity of the native protein, i.e., the male fertility activity described herein. Such variants can result, for example, from genetic polymorphism or from human manipulation. A biologically active variant of the male fertility protein disclosed herein will have at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity to the amino acid sequence of the native protein (e.g., any of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, or 18), as determined by the sequence alignment programs and parameters described elsewhere herein. A biologically active variant of the protein disclosed herein can differ from that protein by as few as 1-15 amino acid residues, as few as 1-10 (such as 6-10), as few as 5, as few as 4, 3, 2, or even 1 amino acid residues.

[0035] The proteins disclosed herein can be altered by various means including amino acid substitutions, deletions, truncations and insertions. Methods for such manipulations are well known in the art. For example, amino acid sequence variants and fragments of the male fertility polypeptide can be prepared by mutations in the DNA. Methods for mutagenesis and polynucleotide alteration are well known in the art. See, for example, Kunkel (1985) Proc. Natl. Acad. Sci. USA 82:488-492; Kunkel et al. (1987) Methods in Enzymol. 154:367-382; U.S. Patent No. 4,873,192; Walker and Gaastra, eds. (1983) Techniques in Molecular Biology (MacMillan Publishing Company, New York) and references cited therein. Guidance in appropriate amino acid substitutions that do not affect the biological activity of the protein of interest can be found in the models of Dayhoff et al. (1978) Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found., Washington, D.C.), which is incorporated herein by reference. Conservative substitutions, such as exchanging one amino acid for another with similar properties, can be optimal.

[0036] Accordingly, the genes and polynucleotides disclosed herein include both naturally occurring sequences as well as DNA sequence variants that retain function. Likewise, the male fertility polypeptides and proteins encompass both naturally occurring polypeptides as well as variants and modified forms thereof. Such polynucleotide and polypeptide variants will continue to have the desired male fertility activity. Mutations that will be made in the DNA encoding the variant must not place the sequence out of reading frame and optimally will not create complementary regions that could produce secondary mRNA structure. See, EP Patent Application Publication No. 75,444.

[0037] Deletions, insertions, and substitutions of protein sequences contemplated herein are not expected to produce any significant changes in the properties of the protein. However, when it is difficult to predict the exact effect of a substitution, deletion, or insertion in advance of doing so, one skilled in the art will appreciate that the effect will be evaluated by routine screening assays. That is, the activity can be evaluated by assaying male fertility activity.

[0038] Enhancement or reduction of male fertility can be assayed in a number of ways. One of ordinary skill in the art can readily assess the activity of a variant or fragment by introducing the polynucleotide into a plant that is homozygous for a stable male sterile allele of the polynucleotide, and then observing the development of male tissue in the plant. For example, to assay the male fertility activity of Ms22 (i.e., SEQ ID NO: 1, 3, or 5), one of skill in the art can begin by constructing a plant that is homozygous for a mutation in the natural Ms22 gene that results in male sterility. Then, one can remedy the mutation by providing a Ms22 polynucleotide, or an active fragment or variant thereof, and then observing whether the male tissue of the plant develops normally and is capable of producing mature pollen. Likewise, it is disclosed herein that the same procedure can be performed to assay the male fertility activity of a variant or fragment of Ms26 (i.e., SEQ ID NO: 7, 9, or 11) or Ms45 (i.e., SEQ ID NO: 13, 15, or 17).

[0039] Functional variant polynucleotides and proteins also encompass sequences and proteins obtained by mutagenesis and recombination procedures, such as DNA shuffling. With such procedures, one or more different male fertility sequences can be manipulated to produce a new male fertility polypeptide having desired properties. In this manner, libraries of recombined polynucleotides are generated from a population of related polynucleotide sequences encoding a sequence region that has substantial sequence identity and can homologously recombine in vitro or in vivo. For example, using this approach, sequence motifs encoding a domain of interest can be shuffled between the male fertility polynucleotides disclosed herein and other known male fertility polynucleotides to obtain a new polynucleotide that encodes a male fertility polypeptide with improved properties of interest, such as increased K mStemmer (1994) Proc. Natl. Acad. Sci. USA 91 : 10747-10751; Stemmer (1994) Nature 370:389-391; Crameri et al. (1997) Nature Biotech. 15:436-438; Moore et al. (1997) J. Mol. Biol. 272:336-347; Zhang et al. (1997) Proc. Natl. Acad. Sci. USA 94:4504-4509; Crameri et al. (1998) Nature 391 :288-291; and U.S. Patent Nos. 5,605,793 and 5,837,458.

[0040] II. Sequence analysis

[0041] As used herein, "sequence identity" or "identity" in the context of two polynucleotide or polypeptide sequences refers to the residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window. When percentage of sequence identity is used in reference to proteins it is recognized that residue positions that are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues that have similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties of the molecule. When sequences differ in conservative substitutions, the percent sequence identity can be adjusted upwards to correct for the conservative nature of the substitution. Sequences that differ by such conservative substitutions are said to have "sequence similarity" or "similarity". Methods of making this adjustment are well known in the art. Typically, this involves rating conservative substitutions on a point scale (e.g. giving 2 points for every conservative substitution) and adding these points to the percent sequence identity. For example, if identical amino acids give 1 point and non-conservative substitutions give 0 points, then conservative substitutions give a fraction of points between 0 and 1. The scoring of conservative substitutions is calculated, for example, as performed in the program PC / GENE (Intelligenetics, Mountain View, California, USA).

[0042] "Percent sequence identity," as used herein, means the value determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window can comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percent sequence identity is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window, and multiplying the result by 100 to yield the percent sequence identity.

[0043] Unless otherwise indicated, sequence identity / similarity values provided herein are obtained using GAP version 10 or any equivalent program using the following parameters: % identity and % similarity for nucleotide sequences using GAP Weight of 50 and Length Weight of 3, and the nwsgapdna.cmp scoring matrix; % identity and % similarity for amino acid sequences using GAP Weight of 8 and Length Weight of 2, and the BLOSUM62 scoring matrix. By "equivalent program" is intended any sequence comparison program that, for any two sequences in question, generates an alignment having identical nucleotide or amino acid residue matches and an identical percent sequence identity when compared to the alignment generated by GAP version 10.

[0044] The use of the term "polynucleotide" is not intended to be limited to polynucleotides comprising DNA. One of ordinary skill in the art will recognize that polynucleotides can comprise ribonucleotides, and combinations of ribonucleotides and deoxyribonucleotides. Such deoxyribonucleotides and ribonucleotides can include naturally occurring molecules and synthetic analogs. The polynucleotides disclosed herein also encompass all forms of sequences, including but not limited to single-stranded forms, double-stranded forms, hairpin structures, stem-loop structures, and the like.

[0045] III. Expression cassettes

[0046] The male fertility polynucleotides disclosed herein can be provided in an expression cassette for expression in an organism of interest. The expression cassette can comprise 5' and 3' regulatory sequences operably linked to the male fertility polynucleotides disclosed herein. "Operably linked" is intended to mean a functional linkage between two or more elements. For example, operable linkage between a polynucleotide of interest and a regulatory sequence (e.g., a promoter) is functional linkage wherein the polynucleotide of interest is under the transcriptional control of the regulatory sequence. Elements that are operably linked to each other can be contiguous or non-contiguous. When used in reference to the linkage of two protein coding regions, operably linked means that the coding regions are in the same reading frame.

[0047] The expression cassettes disclosed herein can comprise, in the 5'-3' transcriptional direction, a transcriptional and translational initiation region (i.e., a promoter) functional in the host cell (i.e., a plant), a polynucleotide of interest, and a transcriptional and translational termination region (i.e., a termination region). The expression cassette is also provided with a plurality of restriction sites and / or recombination sites to allow insertion of the male fertility polynucleotide under the transcriptional control of the regulatory regions described elsewhere herein. The regulatory regions (i.e., the promoter, the transcriptional regulatory region, and the translational termination region) and / or the polynucleotide of interest can be native / isogenic to the host cell or to each other. Alternatively, the regulatory regions and / or the polynucleotide of interest can be heterologous to the host cell or to each other. As used herein, "heterologous" with reference to a polynucleotide or polypeptide sequence is a sequence that originates from a foreign species or, if from the same species, is substantially modified from its original form in composition and / or genic locus by deliberate human intervention. For example, a promoter operably linked to a heterologous polynucleotide is a promoter from a species different from the species from which the polynucleotide was derived, or, if from the same species, one or both is substantially modified from its original form and / or genic locus, or the promoter is not the native promoter for the operably linked polynucleotide. As used herein, a chimeric polynucleotide includes a coding sequence operably linked to a transcriptional initiation region that is heterologous to the coding sequence.

[0048] In certain embodiments, the polynucleotides disclosed herein can be stacked with any combination of the polynucleotide sequences or expression cassettes disclosed elsewhere herein. For example, the male fertility polynucleotides disclosed herein can be stacked with any other polynucleotides encoding male gamete-disruption polynucleotides or polypeptides, cytotoxins, markers, or other male fertility sequences disclosed elsewhere herein. The stacked polynucleotides can be operably linked to the same promoter as the male fertility polynucleotides, or can be operably linked to additional promoter polynucleotides.

[0049] As described elsewhere herein, an expression cassette can comprise a promoter operably linked to a polynucleotide of interest, along with a corresponding termination region. The termination region can be native to the transcriptional initiation region, native to the operably linked male fertility polynucleotide or male fertility promoter sequence of interest, native to the plant host, or can be derived from another source (i.e., foreign or heterologous). Convenient termination regions are available from the Ti plasmid of A. tumefaciens, such as the octopine synthase and nopaline synthase termination regions. See also Guerineau et al. (1991) Mol. Gen. Genet. 262: 141-144; Proudfoot (1991) Cell 64: 671-674; Sanfacon et al. (1991) Genes Dev. 5: 141-149; Mogen et al. (1990) Plant Cell 2: 1261-1272; Munroe et al. (1990) Gene 91: 151-158; Ballas et al. (1989) Nucleic Acids Res. 17: 7891-7903; and Joshi et al. (1987) Nucleic Acids Res. 15: 9627-9639.

[0050] If appropriate, the polynucleotide of interest can be optimized for increased expression in the transformed plant. That is, the polynucleotide can be synthesized using plant-preferred codons to improve expression. For a discussion of host-preferred codon usage, see, for example, Campbell and Gowri (1990) Plant Physiol. 92: 1-11. Methods are available in the art for synthesizing plant-preferred genes. See, for example, U.S. Patent Nos. 5,380,831 and 5,436,391, and Murray et al. (1989) Nucleic Acids Res. 17: 477-498, which are incorporated herein by reference.

[0051] Additional sequence modifications are known to enhance gene expression in a cellular host. These include elimination of sequences encoding predicted transposon-like repetitive sequences and other such well-characterized sequences that can be deleterious to gene expression. The G-C content of the sequence can be adjusted to be average for a given cellular host, as calculated by reference to known genes expressed in the host cell. When possible, the sequence is modified to avoid predicted hairpin secondary mRNA structures.

[0052] The expression cassette can additionally contain a 5' leader sequence. Such leader sequences can serve to enhance translation. Translation leader sequences are known in the art and include: picomavirus leader sequences, e.g., EMCV leader (Encephalomyocarditis 5' noncoding region) (Elroy-Stein et al. (1989) Proc. Natl. Acad. Sci. USA 86:6126-6130); potyvirus leaders, e.g., TEV leader (Tobacco Etch Virus) (Gallie, et al., (1995) Gene 165(2):233-238, MDMV leader (Maize Dwarf Mosaic Virus) (Johnson, et al., (1986) Virology 154:9-20, and human immunoglobulin heavy chain binding protein (BiP) (Macejak, et al., (1991) Nature 353:90-94); the untranslated leader sequence of the coat protein mRNA of alfalfa mosaic virus (AMV RNA 4) (Jobling et al. (1987) Nature 325:622-625); the tobacco mosaic virus leader (TMV) (Gallie et al. (1989) in Molecular Biology of RNA, ed. Cech (Liss, New York), pp. 237-256); and the maize chlorotic mottle virus leader (MCMV) (Lommel et al. (1991) Virology 81 :382-385). See also Della-Cioppa et al. (1987) Plant Physiol. 84:965-968. Other methods known in the art for enhancing translation, such as introns, etc., can also be utilized.

[0053] In preparing the expression cassette, the various DNA segments can be manipulated as necessary to provide DNA sequences in the correct orientation and, where necessary, the correct reading frame. To this end, adapters or linkers can be employed to join the DNA segments together or other manipulations can be involved to provide convenient restriction sites, to remove excess DNA, to remove restriction sites, etc. For this purpose, in vitro mutagenesis, primer repair, restriction enzyme cleavage, annealing, resubstitutions (e.g., transitions and transversions) can be involved.

[0054] A. Expression cassettes comprising male fertility polynucleotides

[0055] In particular embodiments, the expression cassettes disclosed herein comprise a promoter operably linked to a male fertility polynucleotide, or active fragment or variant thereof, as disclosed herein. In certain embodiments, a male fertility promoter or active fragment or variant thereof is operably linked to a male fertility polynucleotide disclosed herein, such as the male fertility polynucleotide set forth in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, or 17, or active fragment or variant thereof.

[0056] In certain embodiments, plant promoters can preferentially initiate transcription in certain tissues (such as anthers, anther sacs, filaments, and pollen) or developmental growth stages (such as sporogenous tissue, microspores, and gametophytes). Such plant promoters are referred to as "tissue preferred," "cell type preferred," or "growth stage preferred." A promoter that initiates transcription only in certain tissues is referred to as "tissue specific." Likewise, a promoter that initiates transcription only at certain growth stages is referred to as "growth stage specific." A "cell type specific" promoter drives expression only in certain cell types in one or more organs (e.g., anther cells) or in each cell type within an anther (such as anther sacs, filaments, or pollen cells).

[0057] The male fertility polynucleotides disclosed herein, and active fragments and variants thereof, can be operably linked to a male tissue-specific or male tissue-preferred promoter, including, for example, an anther-specific or anther-preferred promoter, anther sac-specific or anther sac-preferred promoter, pollen-specific or pollen-preferred promoter, tapetum-specific promoter or tapetum-preferred promoter, and the like. The promoter can be selected based on the desired result. For example, the polynucleotide of interest can be operably linked to a constitutive promoter, a tissue-preferred promoter, a growth stage-preferred promoter, or other promoter for expression in a plant.

[0058] In one embodiment, the promoter can be one that preferentially expresses the polynucleotide of interest in the male tissues of a plant. There is no requirement in this process that a particular male fertility tissue-preferred promoter be used, but rather any of a number of such promoters known to those of skill in the art can be used. One such promoter is the 5126 promoter, which preferentially directs expression of a polynucleotide to which it is linked to the male tissues of a plant, as described in U.S. Patent Nos. 5,837,851 and 5,689,051. Other examples include the maize Ms45 promoter described in U.S. Patent No. 6,037,523; the SF3 promoter described in U.S. Patent No. 6,452,069; the BS92-7 promoter described in WO 02 / 063021; the SGB6 regulatory element described in U.S. Patent No. 5,470,359; the TA29 promoter (Koltunow, et al., (1990) Plant Cell 2: 1201-1224; Goldberg, et al., (1993) Plant Cell 5: 1217-1229 and U.S. Patent No. 6,399,856); the type 2 metallothionein-like gene promoter (Charbonnel-Campa a, et al., Gene (2000) 254: 199-208); and the Brassica Bca9 promoter (Lee, et al., (2003) Plant Cell Rep. 22: 268-273).

[0059] In some embodiments, the expression cassette comprises a male gamete-preferred promoter operably linked to the male fertility polynucleotide. Male gamete-preferred promoters include the PG47 promoter (US 5,412,085; US 5,545,546; Plant J 3(2):261-271 (1993)), and the ZM13 promoter (Hamilton, et al., (1998) Plant Mol. Biol. 38:663-669); actin depolymerization factor promoters (such as Zmabpl, Zmabp2; see, e.g., Lopez, et al., (1996) Proc. Natl. Acad. Sci. USA 93:7415-7420); the promoter of the maize pectin methylesterase-like gene ZmC5 (Wakeley, et al., (1998) Plant Mol. Biol. 37:187-192); the actin depolymerization factor gene promoter Zmprol (Kovar, et al., (2000) The Plant Cell 12:583-598); the sulfated pentapeptide phytosulphokine gene promoter ZmPSKl (Lorbiecke, et al., (2005) Journal of Experimental Botany 56(417):1805-1819); the calmodulin-binding protein promoter Mpcbp (Reddy, et al., (2000) J. Biol. Chem. 275(45):35457-70).

[0060] As disclosed herein, constitutive promoters include, for example, the core promoter of the Rsyn7 promoter and other constitutive promoters disclosed in WO 99 / 43838 and U.S. Patent No. 6,072,050; the CaMV 35S core promoter (Odell et al. (1985) Nature 313:810-812); the rice actin (McElroy et al. (1990) Plant Cell 2:163-171); ubiquitin (Christensen et al. (1989) Plant Mol. Biol. 12:619-632 and Christensen et al. (1992) Plant Mol. Biol. 18:675-689); pEMU (Last et al. (1991) Theor. Appl. Genet. 81:581-588); MAS (Velten et al. (1984) EMBO J. 3:2723-2730); ALS promoter (U.S. Patent No. 5,659,026), and the like. Other constitutive promoters include, for example, U.S. Patent Nos. 5,608,149, 5,608,144, 5,604,121, 5,569,597, 5,466,785, 5,399,680, 5,268,463, 5,608,142, and 6,177,611.

[0061] "Seed-preferred" promoters include those that are active during seed development (such as the promoters of the seed storage proteins) as well as those that are active during seed germination. See Thompson et al. (1989) BioEssays 10:108, which is incorporated herein by reference. Such seed-preferred promoters include, but are not limited to, Ciml (cytokinin-induced message); cZ19B1 (maize 19 kDa zein); milps (myo-inositol-l-phosphate synthase) (see WO 00 / 11177 and U.S. Patent No. 6,225,529; which are incorporated herein by reference). The gamma-zein gene promoter is an endosperm-specific promoter. The Globulin-1 (Glob-1) gene promoter is a representative embryo-specific promoter. For dicots, seed-specific promoters include, but are not limited to, the bean beta-phaseolin gene promoter, the napin gene promoter, the beta-conglycinin gene promoter, the glycinin gene promoter, the cruciferin gene promoter, and the like. For monocots, seed-specific promoters include, but are not limited to, the maize 15 kDa zein gene promoter, the 22 kDa zein gene promoter, the 27 kDa zein gene promoter, the gamma-zein gene promoter, the waxy gene promoter, the shrunken 1 gene promoter, the shrunken 2 gene promoter, the Globulin 1 gene promoter, and the like. See also WO 00 / 12733, which discloses seed-preferred promoters from the endl and end2 genes; which is incorporated herein by reference. Additional embryo-specific promoters are disclosed in Sato et al. (1996) Proc. Natl. Acad. Sci. 93:8117-8122; Nakase et al. (1997) Plant J 12:235-46; and Postma-Haarsma et al. (1999) Plant Mol. Biol., 39:257-71.Additional endosperm-specific promoters are disclosed in Albani et al. (1984) EMBO 3: 1405-15; Albani et al. (1999) Theor. Appl. Gen. 98: 1253-62; Albani et al. (1993) Plant J. 4:343-55; Mena et al. (1998) The Plant Journal 116:53-62, and Wu et al. (1998) Plant Cell Physiology 39:885-889.

[0062] Preferred promoters for dividing cells or meristems have been disclosed in Ito et al. (1994) Plant Mol. Biol. 24:863-878; Reyad et al. (1995) Mo. Gen. Genet. 248:703-711; Shaul et al. (1996) Proc. Natl. Acad. Sci. 93:4868-4872; Ito et al. (1997) Plant J. 11 :983-992; and Trehin et al. (1997) Plant Mol. Biol., 35:667-672.

[0063] Stress-inducible promoters include salt / water stress-inducible promoters such as P5CS (Zang et al. (1997) Plant Sciences 129:81-89); cold-inducible promoters such as corl5a (Hajela et al. (1990) Plant Physiol. 93: 1246-1252), corl5b (Wilhelm et al. (1993) Plant Mol Biol 23: 1073-1077), wsc120 (Ouellet et al. (1998) FEBS Lett. 423-324-328), ci7 (Kirch et al. (1997) Plant Mol Biol. 33:897-909), ci21A (Schneider et al. (1997) Plant Physiol. 113:335-45); drought-inducible promoters such as Trg-31 (Chaudhary et al (1996) Plant Mol. Biol. 30: 1247-57), rd29 (Kasuga et al. (1999) Nature Biotechnology 18:287-291); osmotic-inducible promoters such as Rabl7 (Vilardell, et al., (1991) Plant Mol. Biol. 17:985-93) and osmotin (Raghothama et al.(1993) Plant Mol Biol 23: 1117-28); and heat-inducible promoters such as heat shock proteins (Barros et al. (1992) Plant Mol. 19:665-75; Marrs et al. (1993) Dev. Genetics 14:27-41; and smHSP (Waters et al. (1996) J. Experimental Botany 47:325-338). Other stress-inducible promoters include rip2 (U.S. Patent No. 5,332,808 and U.S. Patent Publication No. 2003 / 0217393) and rp29a (Yamaguchi-Shinozaki et al. (1993) Mol. Genetics 236:331-340).

[0064] As described elsewhere herein, an expression cassette comprising a male fertility polynucleotide can be stacked with other polynucleotides of interest. Any polynucleotide of interest can be stacked with a male fertility polynucleotide, including, for example, male gamete-disrupting polynucleotides and marker polynucleotides.

[0065] The male fertility polynucleotides disclosed herein can be stacked in or with an expression cassette comprising a promoter operably linked to a polynucleotide having male gamete-destroying properties, i.e., a polynucleotide that interferes with the function, formation, or dissemination of a male gamete. Male gamete-destroying polynucleotides can be manipulated by any of a variety of methods to prevent the function, formation, or dissemination of a male gamete. By way of example and not limitation, this can include the use of a polynucleotide that encodes a gene product such as a DAM-methylase or a Bacillus RNase (see, e.g., U.S. Patent Nos. 5,792,853 or 5,689,049, PCT / EP89 / 00495); encodes a gene product that interferes with starch accumulation or affects osmotic balance in pollen (see, e.g., U.S. Patent Nos. 7,875,764, 8,013,218, 7,696,405); inhibits the formation of a gene product important for the function, formation, or dissemination of a male gamete (see, e.g., U.S. Patent Nos. 5,859,341, 6,297,426); encodes a gene product that binds to another gene product to prevent the formation or function of a male gamete (see U.S. Patent Nos. 6,162,964, 6,013,859, 6,281,348, 6,399,856, 6,248,935, 6,750,868, 5,792,853); is antisense to a gene essential for the function, formation, or dissemination of a male gamete, or causes cosuppression of the gene (see U.S. Patent Nos. 6,184,439, 5,728,926, 6,191,343, 5,728,558, 5,741,684); interferes with the expression of a male fertility polynucleotide by the use of hairpin-forming constructs (Smith et al. (2000) Nature 407:319-320; WO 99 / 53050 and WO 98 / 53083), and the like.

[0066] Male gamete-disrupting polynucleotides include dominant negative genes such as methylase genes and growth inhibitory genes. See U.S. Patent No. 6,399,856. Dominant negative genes include the diphtheria toxin A chain gene (Czako and An (1991) Plant Physiol. 95:687-692; Greenfield et al. (1983) PNAS 80:6853); cell cycle division mutants such as CDC in maize (Colasanti et al. (1991) PNAS 88:3377-3381); WT gene (Farmer et al. (1994) Mol. Genet. 3:723-728); and P68 (Chen et al. (1991) PNAS 88:315-319).

[0067] Additional examples of male gamete-disrupting polynucleotides include, but are not limited to, the pectate lyase gene pelE from Erwinia chrysanthemi (Kenn et al (1986) J. Bacteriol. 168:595); the CytA toxin gene from Bacillus thuringiensis Israeliensis (McLean et al (1987) J. Bacteriol. 169:1017 (1987), U.S. Patent No. 4,918,006); a DNAse, RNAse, protease, or a polynucleotide expressing antisense RNA. The male gamete-disrupting polynucleotide can encode a protein involved in inhibiting pollen and stigma interaction, pollen tube growth, fertilization, or a combination thereof.

[0068] The male fertility polynucleotides disclosed herein can be stacked with an expression cassette disclosed herein comprising a promoter operably linked to a polynucleotide of interest encoding a reporter molecule or marker product. Examples of suitable reporter molecule polynucleotides known in the art can be found in, for example, Jefferson et al. (1991) in Plant Molecular Biology Manual, ed. Gelvin et al. (Kluwer Academic Publishers), pp. 1-33; DeWet et al. Mol. Cell. Biol. 7:725-737 (1987); Goff et al. EMBO J. 9:2517-2522 (1990); Kain et al. BioTechniques 19:650-655 (1995); and Chiu et al. Current Biology 6:325-330 (1996). In certain embodiments, the polynucleotide of interest encodes a selectable reporter molecule. These polynucleotides can include polynucleotides that confer resistance to antibiotics or herbicides. Examples of suitable selectable marker polynucleotides include, but are not limited to, genes encoding resistance to chloramphenicol, methotrexate, hygromycin, streptomycin, spectinomycin, bleomycin, sulfonamides, bromoxynil, glyphosate, and phosphinothricin.

[0069] In some embodiments, the expression cassettes disclosed herein comprise a polynucleotide of interest that encodes a scorable or screenable marker, wherein the presence of the polynucleotide results in a measurable product. Examples include the beta-glucuronidase or uidA gene (GUS), which encodes an enzyme known for various chromogenic substrates (e.g., U.S. Patent Nos. 5,268,463 and 5,599,670); chloramphenicol acetyltransferase and alkaline phosphatase. Other screenable markers include anthocyanin / flavonoid polynucleotides, including, for example, R-locus polynucleotides that encode products that regulate the production of anthocyanin pigments (red color) in plant tissues, genes that control the biosynthesis of flavonoid pigments, such as the maize Cl and C2, B genes, pi genes, and bronze locus genes, and the like. Additional examples of suitable markers encoded by a polynucleotide of interest include cyan fluorescent protein (CYP) genes, yellow fluorescent protein genes, luminescent genes that encode luciferase (the presence of which can be detected using, for example, X-ray film, scintillation counting, fluorospectrophotometry, low-light video camera, photon counting camera, or multiwell luminometry), green fluorescent protein (GFP), and DsRed2, wherein plant cells transformed with the marker gene are red and thus visually selectable. Additional examples include p-lactamase genes that encode enzymes known for various chromogenic substrates (e.g., PADAC, chromogenic cephalosporins), xylE genes that encode catechol dioxygenase that can convert chromogenic catechols, alpha-amylase genes, and tyrosinase genes that encode enzymes capable of oxidizing tyrosine to dopa and dopaquinone, which in turn condense to form melanin, a compound that is easily detected.

[0070] The expression cassette can also include a selectable marker gene for selection of transformed cells. Selectable marker genes are used to select transformed cells or tissues. Marker genes include genes encoding antibiotic resistance, such as those encoding neomycin phosphotransferase II (NEO) and hygromycin phosphotransferase (HPT), as well as genes conferring resistance to herbicidal compounds, e.g., glufosinate ammonium, bromoxynil, imidazolinones, and 2,4-dichlorophenoxyacetate (2,4-D). Additional selectable markers include phenotypic markers such as beta-galactosidase and fluorescent proteins such as green fluorescent protein (GFP) (Su et al. (2004) Biotechnol Bioeng 85:610-9 and Fetter et al. (2004) Plant Cell 16:215-28), cyan fluorescent protein (CYP) (Bolte et al. (2004) J. Cell Science 117:943-54 and Kato et al. (2002) Plant Physiol 129:913-42), and yellow fluorescent protein (PhiYFP from Evrogen, Inc. TM, see Bolte et al. (2004) J. Cell Science 117:943-54). For additional selectable markers, see generally Yarranton (1992) Curr. Opin. Biotech. 3:506-511; Christopherson et al. (1992) Proc. Natl. Acad. Sci. USA 89:6314-6318; Yao et al. (1992) Cell 71 :63-72; Reznikoff (1992) Mol. Microbiol. 6:2419-2422; Barkley et al. (1980) in The Operon, pp. 177-220; Hu et al. (1987) Cell 48:555-566; Brown et al. (1987) Cell 49:603-612; Figge et al. (1988) Cell 52:713-722; Deuschleet al. (1989) Proc. Natl. Acad. Aci. USA 86:5400-5404; Fuerst et al. (1989) Proc. Natl. Acad. Sci. USA 86:2549-2553; Deuschle et al.(1990) Science 248:480-483 (Deuschle et al., 1990, Science, Vol. 248, pp. 480-483); Gossen (1993) Ph.D. Thesis, University of Heidelberg; Reines et al. (1993) Proc. Natl. Acad. Sci. USA 90:1917-1921; Labow et al. (1990) Mol. Cell. Biol. 10:3343-3356; Zambretti et al. (1992) Proc. Natl. Acad. Sci. USA 89:3952-3956; Baim et al. (1991) Proc. Natl. Acad. Sci. USA 88:5072-5076; Wyborski et al. (1991) Nucleic Acids Res. 19:4647-4653; Hillen and Wissman (1989) Topics Mol. Struc. Biol. 10:143-162; Degenkolb et al. (1991) Antimicrob. Agents Chemother. 35:1591-1595; Kleinschnidt et al. (1988) Biochemistry 27:1094-1104; Bonin (1993) Ph.D.Thesis, University of Heidelberg (Bonin, 1993, Ph.D. Thesis, University of Heidelberg); Gossen et al. (1992) Proc. Natl. Acad. Sci. USA 89:5547-5551; Oliva et al. (1992) Antimicrob. Agents Chemother. 36:913-919; Hlavka et al. (1985) Handbook of Experimental Pharmacology, Vol. 78 (Springer- Verlag, Berlin); Gill et al. (1988) Nature 334:721-724. The disclosures of these publications are incorporated herein by reference. The above list of selectable marker genes is not meant to be limiting. Any selectable marker gene can be used in the compositions and methods disclosed herein.

[0071] In some embodiments, the expression cassettes disclosed herein comprise a first polynucleotide of interest encoding a male fertility polynucleotide operably linked to a first promoter polynucleotide stacked with a second polynucleotide of interest encoding a male gamete-destroying gene product operably linked to a male tissue-preferred promoter polynucleotide. In other embodiments, the expression cassettes described herein can also be stacked with a third polynucleotide of interest encoding a marker polynucleotide operably linked to a third promoter polynucleotide.

[0072] In particular embodiments, the expression cassettes disclosed herein comprise a first polynucleotide of interest encoding a wheat male fertility gene (such as Ms22, Ms26, or Ms45) operably linked to a constitutive promoter, such as the Cauliflower Mosaic Virus (CaMV) 35S promoter. The expression cassette can also comprise a second polynucleotide of interest encoding a male gamete- disruptive gene product operably linked to a male tissue-preferred promoter. In certain embodiments, the expression cassettes disclosed herein can also comprise a third polynucleotide of interest encoding a marker gene (such as the phosphinothricin acetyltransferase (PAT) gene from Streptomyces viridochromagenes) operably linked to a constitutive promoter, such as the Cauliflower Mosaic Virus (CaMV) 35S promoter.

[0073] IV. Plants

[0074] A. Plants having altered levels / activities of male fertility polypeptides

[0075] Also provided are plants having altered levels and / or activity of a male fertility polypeptide and / or altered levels of male fertility. In some embodiments, the plants disclosed herein have stably integrated into their genome a heterologous male fertility polynucleotide or active fragment or variant thereof as disclosed herein. Accordingly, provided are plants, plant cells, plant parts, and seeds comprising at least one heterologous male fertility polynucleotide as set forth in any of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, or 17, or any active fragment or variant thereof, as disclosed herein.

[0076] Also provided are plants comprising an expression cassette disclosed herein comprising a male fertility polynucleotide operably linked to a promoter active in a plant. In some embodiments, expression of the male fertility polynucleotide modulates male fertility of the plant. In certain embodiments, expression of the male fertility polynucleotide enhances male fertility of the plant. For example, provided are plants comprising an expression cassette comprising a Ms22 polynucleotide as set forth in SEQ ID NO: 1, 3, or 5, or an active fragment or variant thereof, operably linked to a constitutive promoter, such as the CaMV 35S promoter. When the Ms22 polynucleotide is expressed, male fertility of the plant is enhanced.

[0077] In certain embodiments, a male sterile plant is provided with an expression cassette comprising a heterologous male fertility polynucleotide, or active fragment or variant thereof, as disclosed herein operably linked to a promoter active in a plant. When the heterologous male fertility polynucleotide is expressed, the male fertility of the plant is restored. In particular embodiments, a plant disclosed herein comprises an expression cassette with a heterologous male fertility polynucleotide, or active fragment or variant thereof, as disclosed herein operably linked to a promoter stacked with one or more expression cassettes comprising a polynucleotide of interest operably linked to a promoter active in a plant. For example, the polynucleotide of interest stacked can include a male gamete-disruption polynucleotide and / or a marker polynucleotide.

[0078] A plant disclosed herein can also comprise a stacked expression cassette described herein with at least two polynucleotides such that the at least two polynucleotides are inherited together (i.e., not randomly) in more than 50% of meioses. Thus, when a plant or plant cell comprising a stacked expression cassette with two polynucleotides undergoes meiosis, the two polynucleotides segregate into the same progeny (daughter) cell. In this way, the stacked polynucleotides will likely be expressed together in any cell to which they are presented. For example, a plant can comprise an expression cassette with a male fertility polynucleotide stacked with an expression cassette comprising a male gamete-disruption polynucleotide such that the male fertility polynucleotide and the male gamete-disruption polynucleotide are inherited together. In particular, a male sterile plant can comprise an expression cassette with a male fertility polynucleotide as disclosed herein operably linked to a constitutive promoter stacked with an expression cassette comprising a male gamete-disruption polynucleotide operably linked to a male tissue-preferred promoter such that the plant produces mature pollen grains. However, in such a plant, development of pollen daughter cells with the male fertility polynucleotide will be prevented by expression of the male gamete-disruption polynucleotide.

[0079] B. Introduction of plants and methods

[0080] As used herein, the term "plant" includes plant cells, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, plant clumps, and plant cells that are intact in plants or parts of plants such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruit, kernels, ears, cobs, husks, stalks, roots, root tips, anthers, grain, etc. As used herein, "grain" means a mature seed produced by a commercial grower for the purpose of cultivating or propagating a species beyond the seed. Progeny, variants, and mutants of the regenerated plants are also included within the scope of the application, provided that these parts comprise the introduced nucleic acid sequence.

[0081] The methods disclosed herein include introducing a polypeptide or polynucleotide into a plant cell. "Introducing" is intended to mean presenting a polynucleotide or polypeptide to the plant in such a manner that the sequence of the polynucleotide or polypeptide gains access to the interior of a cell of the plant. The methods disclosed herein do not depend on a specific method for introducing the sequence into the host cell, so long as the polynucleotide or polypeptide can gain access to the interior of at least one cell of the host. Methods for introducing a polynucleotide or polypeptide into a host cell (i.e., a plant) are known in the art, including but not limited to stable transformation methods, transient transformation methods, and virus-mediated methods.

[0082] "Stably transformed" is intended to mean that a nucleotide construct introduced into a host (i.e., a plant) is integrated into the genome of the plant and can be inherited by its progeny. "Transiently transformed" is intended to mean that a polynucleotide is introduced into a host (i.e., a plant) and is expressed for a short period of time, or a polypeptide is introduced into a host (i.e., a plant).

[0083] Transformation protocols as well as protocols for introducing polypeptides or polynucleotide sequences into plants can vary depending on the type of plant or plant cell, i.e., monocot or dicot, to be transformed. Suitable methods for introducing polypeptides and polynucleotides into plant cells include microinjection (Crossway et al. (1986) Biotechniques 4:320-334), electroporation (Riggs et al. (1986) Proc. Natl. Acad. Sci. USA 83:5602-5606), Agrobacterium-mediated transformation (Townsend et al., U.S. Patent No. 5,563,055; Zhao et al., U.S. Patent No. 5,981,840), direct gene transfer (Paszkowski et al. (1984) EMBO J. 3:2717-2722), and ballistic particle acceleration (see, e.g., Sanford et al., U.S. Patent No. 4,945,050; Tomes et al., U.S. Patent No. 5,879,918; Tomes et al., U.S. Patent No. 5,886,244; Bidney et al., U.S. Patent No. 5,932,782; Tomes et al. (1995) “Direct DNA Transfer into Intact Plant Cells via Microprojectile Bombardment,” in Plant Cell, Tissue, and Organ Culture: Fundamental Methods, ed. Gamborg and Phillips (Springer-Verlag, Berlin); McCabe et al. (1988) Biotechnology 6:923-926); and Lec1 transformation (WO 00 / 28058). See also Weissinger et al. (1988) Ann. Rev.Genet. 22:421-477 (Weissinger et al. 1988, Annu. Rev. Genet. 22:421-477); Sanford et al. (1987) Particulate Science and Technology 5:27-37 (Sanford et al. 1987, Particulate Science and Technology 5:27-37) (onion); Christou et al. (1988) Plant Physiol. 87:671-674 (Christou et al. 1988, Plant Physiol. 87:671-674) (soybean); McCabe et al. (1988) Bio / Technology 6:923-926 (McCabe et al. 1988, Bio / Technology 6:923-926) (soybean); Finer and McMullen (1991) In Vitro Cell Dev. Biol. 27P:175-182 (Finer and McMullen 1991, In Vitro Cell Dev. Biol. 27P:175-182) (soybean); Singh et al. (1998) Theor. Appl. Genet. 96:319-324 (Singh et al. 1998, Theor. Appl. Genet. 96:319-324) (soybean); Datta et al. (1990) Biotechnology 8:736-740 (Datta et al. 1990, Biotechnology 8:736-740) (rice); Klein et al. (1988) Proc. Natl. Acad. Sci. USA 85:4305-4309 (Klein et al. 1988, Proc. Natl. Acad. Sci. USA 85:4305-4309) (maize); Klein et al. (1988) Biotechnology 6:559-563 (Klein et al. 1988, Biotechnology 6:559-563) (maize); Tomes, U.S. Patent No. 5,240,855; Buising et al., U.S. Patent Nos. 5,322,783 and 5,324,646; Tomes et al.(1995) "Direct DNA Transfer into Intact Plant Cells via Microprojectile Bombardment," in Plant Cell, Tissue, and Organ Culture: Fundamental Methods, ed. Gamborg (Springer- Verlag, Berlin) (maize) ; Klein et al. (1988) Plant Physiol. 91 :440-444 (maize); Fromm et al. (1990) Biotechnology 8:833-839 (maize); Hooykaas-Van Slogteren et al. (1984) Nature (London) 311 :763-764; Bowen et al., U.S. Patent No. 5,736,369 (cereals); Bytebier et al. (1987) Proc. Natl. Acad. Sci. USA 84:5345-5349 (Liliaceae); De Wet et al. (1985) in The Experimental Manipulation of Ovule Tissues, ed. Chapman et al. (Longman, New York), pp. 197-209 (pollen); Kaeppler et al. (1990) Plant Cell Reports 9:415-418, and Kaeppler et al. (1992) Theor. Appl.Genet. 84:560-566 (Kaeppler et al., 1992, Theor. Appl. Genet. 84:560-566) (whisker-mediated transformation); D'Halluin et al. (1992) Plant Cell 4: 1495-1505 (D'Halluin et al., 1992, Plant Cell 4:1495-1505) (electroporation); Li et al. (1993) Plant Cell Reports 12:250-255 (Li et al., 1993, Plant Cell Reports 12:250-255) and Christou and Ford (1995) Annals of Botany 75:407-413 (Christou and Ford, 1995, Annals of Botany 75:407-413) (rice); Osjoda et al. (1996) Nature Biotechnology 14:745-750 (Osjoda et al., 1996, Nature Biotechnology 14:745-750) (maize, through Agrobacterium tumefaciens); all of which are incorporated herein by reference.

[0084] In particular embodiments, a plant can be provided with a male fertility polynucleotide or expression cassette disclosed herein using a variety of transient transformation methods. Such transient transformation methods include, but are not limited to, introducing a male fertility polypeptide or variants and fragments thereof directly into a plant, or introducing a male fertility transcript into a plant. Such methods include, for example, microinjection or particle bombardment. See, for example, Crossway et al. (1986) Mol Gen. Genet. 202: 179-185; Nomura et al. (1986) Plant Sci. 44: 53-58; Hepler et al. (1994) Proc. Natl. Acad. Sci. 91 : 2176-2180; and Hush et al. (1994) The Journal of Cell Science 107: 775-784, all of which are incorporated herein by reference. Alternatively, a male fertility polynucleotide or expression cassette disclosed herein can be transiently transformed into a plant using techniques known in the art. Such techniques include viral vector systems and precipitation of the polynucleotide in a manner that avoids subsequent release of the DNA. Thus, transcription can occur from particle-bound DNA, but its release for integration into the genome is greatly reduced. Such methods include the use of particles coated with polyethylenimine (PEI; Sigma #P3143).

[0085] In other embodiments, the male fertility polynucleotides or expression cassettes disclosed herein can be introduced into a plant by contacting the plant with a virus or viral nucleic acid. Generally, such methods involve the incorporation of the nucleotide constructs disclosed herein into the interior of a viral DNA or RNA molecule. It is recognized that the male fertility sequences disclosed herein can be synthesized initially as part of a viral polyprotein, which can then be processed by proteolysis, either in vivo or in vitro, to thereby generate the desired recombinant protein. Methods involving viral DNA or RNA molecules for introducing polynucleotides into plants and expressing the proteins encoded therein are known in the art. See, for example, U.S. Patent Nos. 5,889,191; 5,889,190; 5,866,785; 5,589,367; 5,316,931, and Porta et al. (1996) Molecular Biotechnology 5:209-221; which are incorporated herein by reference.

[0086] Methods for targeted insertion of a polynucleotide at a specific location in the genome of a plant are known in the art. In one embodiment, a site-specific recombination system is used to effect insertion of a polynucleotide at a desired genomic location. See, for example, WO 99 / 25821; WO 99 / 25854; WO 99 / 25840; WO 99 / 25855; and WO 99 / 25853; all of which are incorporated herein by reference. Briefly, a polynucleotide disclosed herein can be included in a transfer cassette flanked by two non-identical recombination sites. The transfer cassette is introduced into a plant that has stably integrated into its genome a target site flanked by two non-identical recombination sites corresponding to the sites of the transfer cassette. An appropriate recombinase is provided, and the transfer cassette is integrated at the target site. The polynucleotide of interest is thus integrated at a specific chromosomal location in the plant genome.

[0087] The transformed cells can be grown into plants in accordance with conventional ways. See, for example, McCormick et al. (1986) Plant Cell Reports 5:81-84. These plants can then be grown, either to seed or to maturity, pollinated, and the resulting progeny examined for the desired expression of the identified phenotypic characteristic. Two or more generations can be grown to ensure that expression of the desired phenotypic characteristic is stably maintained and inherited in the desired manner. The seed can then be harvested to ensure that the desired expression of the phenotypic characteristic has been achieved. In this way, the present disclosure provides transformed seed (also referred to as "transgenic seed") that has stably integrated into its genome a male fertility polynucleotide disclosed herein (e.g., an expression cassette disclosed herein). Seed comprising any of the expression cassettes disclosed herein can be sorted according to size parameters, including but not limited to seed length, seed width, seed density, or any combination thereof.

[0088] The male fertility polynucleotides and expression cassettes disclosed herein can be used for transformation of any plant species, including but not limited to monocots and dicots. Examples of plant species of interest include, but are not limited to: corn (Zea mays), Brassica species (e.g., B. napus, B. rapa, B. juncea), alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secale cereale), sorghum (Sorghum bicolor, Sorghum vulgare), millet (e.g., pearl millet (Pennisetum glaucum), proso millet (Panicum miliaceum), foxtail millet (Setaria italica), finger millet (Eleusine coracana)), sunflower (Helianthus annuus), safflower (Carthamus tinctorius), wheat (Triticum aestivum), soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solanum tuberosum), peanuts (Arachis hypogaea), cotton (Gossypium barbadense, Gossypium hirsutum), sweet potato (Ipomoea batatus), cassava (Manihot esculenta), coffee (Coffea spp.), coconut palm (Cocos nucifera), pineapple (Ananas comosus), citrus trees (Citrus spp.), cocoa (Theobroma cacao), tea (Camellia sinensis), banana (Musa spp.), avocado (Persea americana), fig (Ficus casica), guava (Psidium guajava), mango (Mangifera indica), olive (Olea europaea), papaya (Carica papaya), cashew (Anacardium occidentale), macadamia nut (Macadamia integrifolia), almond (Prunus amygdalus), sugar beets (Beta vulgaris), sugarcane (Saccharum spp.), oats, barley, vegetables, ornamentals, grasses, and conifers.

[0089] In particular embodiments, wheat plants are used in the methods and compositions disclosed herein. As used herein, the term "wheat" refers to any species of the genus Triticum, including its parents as well as its progeny resulting from crosses with other species. Wheat includes "hexaploid wheat" and "tetraploid wheat", the former having a genomic structure of AABBDD, composed of 42 chromosomes, and the latter having a genomic structure of AABB, composed of 28 chromosomes. Hexaploid wheat includes T. aestivum, T. spelta, T. mocha, T. compactum, T. sphaerococcum, T. vavilovii, and their intergeneric hybrid varieties. Tetraploid wheat includes T. durum (also known as Durum wheat or Triticum turgidum ssp. durum), T. dicoccoides, T. dicoccum, T. polonicum, and their intergeneric hybrid varieties. In addition, the term "wheat" includes possible parents of hexaploid or tetraploid wheat species, such as T. urartu, which provides the A genome, T. monococcum or T. boeoticum, which provide the B genome, Aegilops speltoides, which provides the B genome, and T. tauschii (also known as Aegilops squarrosa or Aegilops tauschii), which provides the D genome. Wheat cultivars used in the present disclosure can belong to, but are not limited to, any of the above listed species. Plants produced by sexual crosses using the Triticum species as parents with non-Triticum species, such as rye (Secale cereale), including but not limited to triticale, using conventional techniques are also encompassed. In some embodiments, wheat plants are suitable for commercial production of grain having suitable agronomic characteristics known to those of skill in the art, such as commercial varieties of hexaploid wheat or durum wheat.

[0090] Vegetables include tomatoes (Lycopersicon esculentum), lettuce (e.g., Lactuca sativa), green beans (Phaseolus vulgaris), lima beans (Phaseolus limensis), peas (Lathyrus spp.), and members of the genus Cucumis such as cucumber (C. sativus), cantaloupe (C. cantalupensis), and musk melon (C. melo). Ornamentals include azalea (Rhododendron spp.), hydrangea (Macrophylla hydrangea), hibiscus (Hibiscus rosasanensis), rose (Rosa spp.), tulip (Tulipa spp.), daffodil (Narcissus spp.), petunia (Petunia hybrida), carnation (Dianthus caryophyllus), poinsettia (Euphorbia pulcherrima), and chrysanthemum.

[0091] Conifers that can be used to practice the methods and compositions disclosed herein include, for example, pines such as loblolly pine (Pinus taeda), slash pine (Pinus elliotii), ponderosa pine (Pinus ponderosa), Monterey pine (Pinus radiata), and black pine (Pinus contorta), as well as Douglas-fir (Pseudotsuga menziesii), Western red cedar (Thuja plicata), Alaska yellow-cedar (Chamaecyparis nootkatensis), Northern white cedar (Thuja occidentalis), and redwood (Sequoia sempervirens). In particular embodiments, the plants disclosed herein are crop plants (e.g., corn, alfalfa, sunflower, Brassica, soybean, cotton, safflower, peanut, sorghum, wheat, millet, tobacco, etc.). In other embodiments, corn and soybean plants are optimal, and in still other embodiments, corn plants are optimal.

[0092] Other plants of interest include cereal plants, oilseed plants, and leguminous plants that provide seeds of interest. Seeds of interest include cereal seeds, such as corn, wheat, barley, rice, sorghum, rye, etc. Oilseed plants include cotton, soybean, safflower, sunflower, Brassica, maize, alfalfa, palm, coconut, etc. Leguminous plants include beans and peas. Beans include guar, locust bean, fenugreek, soybean, garden beans, cowpea, mungbean, lima bean, fava bean, lentil, chickpea, etc.

[0093] Generally, an intermediate host cell will be used to practice the methods and compositions disclosed herein to increase the copy number of the cloning vector. As the copy number increases, a very large number of vectors containing the nucleic acid of interest can be isolated for introduction into the desired plant cell. In one embodiment, a plant promoter is employed that does not cause expression of the polypeptide in bacteria.

[0094] Prokaryotes most often are represented by various strains of Escherichia coli; however, other microbial strains can also be used. Commonly used prokaryotic control sequences defined herein to include a promoter, optionally with an operator, and ribosome binding site for transcription initiation, include promoters such as the beta-lactamase (penicillinase) and lactamase (Chang et al. (1977) Nature 198:1056), the tryptophan (trp) promoter system (Goeddel et al. (1980) Nucleic Acids Res. 8:4057), and the lambda derived P L promoters, as well as the N-gene ribosome binding site (Shimatake et al. (1981) Nature 292:128). It is also useful to include a selectable marker in the DNA vector when it is transfected into E. coli. Examples of such markers include genes that confer resistance to ampicillin, tetracycline, or chloramphenicol.

[0095] The vector is selected to enable introduction into an appropriate host cell. Bacterial vectors are usually of plasmid or bacteriophage origin. Appropriate bacterial cells are infected with bacteriophage vector particles or transfected with naked bacteriophage vector DNA. If a plasmid vector is used, the bacterial cells are transfected with plasmid vector DNA. Expression systems for expressing the proteins disclosed herein can be provided with Bacillus species and Salmonella (Palva et al. (1983) Gene 22:229-235); Mosbach et al. (1983) Nature 302:543-545.

[0096] In some embodiments, the expression cassettes or male fertility polynucleotides disclosed herein are maintained in a hemizygous state in the plant. A hemizygous state is a genetic state that exists when only one copy of a gene (or set of genes) is present, and no corresponding allele is present on a sister chromosome. In certain embodiments, the expression cassettes disclosed herein comprise a first promoter operably linked to a male fertility polynucleotide stacked with a male gamete-destroying polynucleotide operably linked to a male tissue-preferred promoter, and such expression cassettes are introduced into a male sterile plant in a hemizygous state. When the male fertility polynucleotide is expressed, the plant is able to successfully produce mature pollen grains because the male fertility polynucleotide restores the plant to a fertile state. In view of the expression cassette being in a hemizygous state, only certain of the microspore cells will inherit the expression cassette during pollen grain formation. The microspore cells that inherit the expression cassette comprising the male fertility polynucleotide will not develop into mature pollen grains due to the stacked male tissue-preferred expression of the encoded male gamete-destroying gene product. Those pollen grains that do not inherit the expression cassette will continue to develop into mature pollen grains and be functional, but they will not comprise the male fertility polynucleotide of the expression cassette and thus will not transmit the male fertility polynucleotide through pollen to progeny.

[0097] V. Modulating concentration and / or activity of male fertility polypeptides

[0098] Methods for modulating the concentration and / or activity of the male fertility polypeptides disclosed herein in a plant are provided. The term "affecting" or "modulating" with respect to the concentration and / or activity of a male fertility polypeptide herein means any increase or decrease in the concentration and / or activity of the male fertility polypeptide when compared to an appropriate control. Generally, the concentration and / or activity of the male fertility polypeptides disclosed herein is increased or decreased at least 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% relative to a natural control plant, plant part, or cell. The modulation disclosed herein can be performed during and / or after the plant has been grown to the desired stage of development. In particular embodiments, the male fertility polypeptides disclosed herein are modulated in monocots, particularly wheat.

[0099] A variety of methods can be employed to measure the modulation of the concentration and / or activity of the male fertility polypeptide. For example, the expression level of the male fertility polypeptide can be measured directly, e.g., by measuring the level of the male fertility polypeptide in the plant (i.e., Western blotting or Northern blotting), or indirectly, e.g., by measuring the male fertility activity of the male fertility polypeptide in the plant. Methods for measuring male fertility activity are described elsewhere herein. In particular embodiments, the modulation of the male fertility polypeptide concentration and / or activity comprises modulation (i.e., increase or decrease) of the level of the male fertility polypeptide in the plant. Methods for measuring the level and / or activity of the male fertility polypeptide are known in the art and discussed elsewhere herein. In other embodiments, the level and / or activity of the male fertility polypeptide in the vegetative tissue, in the reproductive tissue, or in both the vegetative and reproductive tissues is modulated.

[0100] In one embodiment, the activity and / or concentration of the male fertility polypeptide is increased by introducing the male fertility polypeptide or a corresponding male fertility polynucleotide into the plant. Subsequently, plants having the introduced male fertility sequence are selected using methods known to those of skill in the art, such as, but not limited to, Southern blot analysis, DNA sequencing, PCR analysis, or phenotypic analysis. In certain embodiments, a marker polynucleotide is introduced along with the male fertility polynucleotide to aid in the selection of plants having or lacking the male fertility polynucleotide disclosed herein. The plants or plant parts altered or modified by the foregoing embodiments are grown under conditions that form a plant for a time sufficient to modulate the concentration and / or activity of the male fertility polypeptide in the plant. Conditions that form a plant are well known in the art.

[0101] As discussed elsewhere herein, many methods for providing a polypeptide to a plant are known in the art, including but not limited to introducing the polypeptide directly into the plant, or introducing a polynucleotide construct encoding a male fertility polypeptide into the plant (either transiently or stably). It will also be recognized that the methods disclosed herein can employ a polynucleotide that is not capable of directing expression of a protein or RNA in the transformed plant. Thus, the level and / or activity of a male fertility polypeptide can be increased by altering the gene encoding the male fertility polypeptide or its promoter. See, e.g., U.S. Patent 5,565,350 to Kmiec; PCT / US93 / 03868 to Zarling et al. Accordingly, mutagenized plants are provided that carry a mutation in a male fertility gene, wherein the mutation increases expression of the male fertility gene or increases the activity of the encoded male fertility polypeptide.

[0102] In other embodiments, the concentration and / or activity of a male fertility polypeptide is increased by introducing into a plant an expression cassette comprising a male fertility polynucleotide (e.g., SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, or 17) or an active fragment or variant thereof as disclosed elsewhere herein. The male fertility polynucleotide can be operably linked to a promoter that is heterologous to the plant or native to the plant. By increasing the concentration and / or activity of a male fertility polypeptide in a plant, the male fertility of the plant is also increased. Thus, the male fertility of a plant can be increased by increasing the concentration and / or activity of a male fertility polypeptide. For example, a male sterile plant can be restored to male fertility by increasing the concentration and / or activity of a male fertility polypeptide.

[0103] It is also recognized that the level and / or activity of the polypeptide can be modulated by employing a polynucleotide that is not capable of directing the expression of a protein or RNA in the transformed plant. For example, the polynucleotides disclosed herein can be used to design polynucleotide constructs that can be used in methods for altering or mutating genomic nucleotide sequences in an organism. Such polynucleotide constructs include, but are not limited to, RNA:DNA vectors, RNA:DNA mutational vectors, RNA:DNA repair vectors, mixed duplex oligonucleotides, self-complementary RNA:DNA oligonucleotides, and recombination- inducing oligonucleotides. Such nucleotide constructs and methods of use are known in the art. See U.S. Patent Nos. 5,565,350; 5,731,181; 5,756,325; 5,760,012; 5,795,972; and 5,871,984, all of which are incorporated herein by reference. See also WO 98 / 49350; WO 99 / 07865; WO 99 / 25821; and Beetham, et al. (1999) Proc. Natl. Acad. Sci. USA 96:8774-8778; which are incorporated herein by reference. It is thus recognized that the methods disclosed herein do not rely on the integration of the entire polynucleotide into the genome, but rather the polynucleotide is introduced into the cell such that the plant or cell thereof is altered.

[0104] In one embodiment, the genome can be altered after the polynucleotide is introduced into the cell. For example, the polynucleotide or any portion thereof can be integrated into the genome of the plant. Alterations of the genome disclosed herein include, but are not limited to, additions, deletions, and substitutions of nucleotides in the genome. While the methods disclosed herein do not rely on any particular number of additions, deletions, and substitutions of nucleotides, it is recognized that such additions, deletions, or substitutions comprise at least one nucleotide.

[0105] Table 1: Summary of SEQ ID NOs

[0106]

[0107]

[0108] The words "a" and "an," as used herein, mean "one" or "more than one" (i.e., at least one) of the grammatical object of the term. By way of example, "an element" means one or more elements.

[0109] All publications and patent applications mentioned in this specification indicate the level of skill of one skilled in the art to which this invention pertains. All publications and patent applications are incorporated herein by reference as if each individual publication or patent application were specifically and independently identified and incorporated herein by reference.

[0110] Although the invention has been described in considerable detail by way of example and illustration for clarity of understanding, it is obvious that some changes and modifications may be made within the scope of the claims.

[0111] Experiments

[0112] Example 1: Identification of male fertility polynucleotides in wheat

[0113] Bioinformatics methods can be used to identify the male fertility polynucleotides disclosed herein. For example, sequences presumed to represent male fertility genes in wheat are initially identified by a computer (in silico) search of proprietary databases using known fertility genes from other species, such as maize. Candidate ESTs are selected based on protein-level homology with reference sequences and consideration of the libraries from which the candidate sequences originate, such as those representing expression in male reproductive tissues. Primers are created based on the candidate EST sequences and used to screen proprietary wheat BAC libraries. The identified super-pools are further screened using appropriate primers to identify specific BAC clones containing the ESTs.

[0114] The following cycling parameters can be used for falling PCR ( PCR system 9700 (Applied Biosystems): 94°C for 3 minutes (1 cycle); 94°C for 1 minute, 55°C for 1 minute, followed by 72°C for 1 minute 30 seconds (35 cycles); 72°C for 7 minutes, ending at 4°C. Pfu Ultra Hotstart TM DNA polymerase (Stratagene) is likely preferred because it has a very low average error rate (less than 0.5% of amplified fragments per 500 bp).

[0115] The wheat DNA insert isolated from the BAC clone was digested for DNA blot confirmation using candidate EST clones as probes. The BAC fragment was subcloned into… (Stratagene Inc., La Jolla, CA, USA). White colonies grew on LB medium and were transferred to a membrane using a dot blot procedure. After denaturation, the membrane was probed with candidate EST clones. Positive clones were identified and sequenced.

[0116] Example 2: Comparison of wheat male fertility polynucleotides to known sequences

[0117] Table 2: Global identities of wheat, maize, and rice Ms22 polynucleotides and polypeptides

[0118]

[0119] (Polynucleotide results are listed in shaded boxes; polypeptide results are listed in non-shaded boxes.)

[0120] Table 3: Global identity of wheat, maize, and rice Ms26 polynucleotides and polypeptides

[0121]

[0122] (Polynucleotide results are listed in shaded boxes; polypeptide results are listed in non-shaded boxes.)

[0123] Table 4: Global identity of wheat, maize, and rice Ms45 polynucleotides and polypeptides

[0124]

[0125] (Polynucleotide results are listed in shaded boxes; polypeptide results are listed in non-shaded boxes.)

[0126] Example 3: Wheat transformation

[0127] Wheat transformation protocols are known to those of skill in the art. See, e.g., He et al. (2010) J. Exp. Botany 61(6): 1567-1581; Wu et al. (2008) Transgenic Res. 17: 425-436; Nehra et al. (1994) Plant J. 5(2): 285-297; Rasco-Gaunt et al. (2001) J. Exp. Botany 52(357): 865-874; Razzaq et al. (2011) African J. Biotech. 10(5): 740-750.

[0128] Example 4: Directed modification of MS26 .

[0129] This example describes methods for mutating wheat genes using double-strand break technology to enable directed DNA modification or gene insertion via homologous recombination. More specifically, this example describes a method that includes, but is not limited to, delivering a custom homing endonuclease MS26+ to recognize, cleave wheat chromosomal DNA and mutate that DNA through imprecise non-homologous end joining (NHEJ) repair.

[0130] Vectors and transformation :

[0131] The male fertility MS26 gene located within wheat genomes A, B, and D comprises a 22 base pair sequence (5'-GATGGTGACGTACGTGCCCTAC-3'; SEQ ID NO: 21) that is recognized by the MS26+ homing endonuclease as a substrate for introducing a double-strand break. The 22 bp MS26 recognition site is present within the A, B, and D wheat genomes and is conserved among the entire Zea, Sorghum, and Oryza MS26 orthologs Figure 1). It has been demonstrated that MS26+ homing endonucleases generate mutations in maize, rice and sorghum plants, see WO2013 / 066423 published May 10, 2013. In order to generate mutations in the genome Ms26 gene of wheat plants, PHP42063 was introduced into the wheat Fielder variety by Agrobacterium-mediated transformation methods similar to those described in Tamas-Nyitrai et al Plant Cell Cultures Protocols Methods in Molecular Biology 877, 2012, 357-384 (Tamas-Nyitrai et al., Plant Cell Cultures Protocols Methods in Molecular Biology, 2012, vol. 877, pp. 357-384); He, et al., (2010) J. Exp. Botany 61(6): 1567-1581 (He et al., 2010, J. Exp. Botany, vol. 61, no. 6, pp. 1567-1581); Wu, et al., (2008) Transgenic Res. 17:425-436 (Wu et al., 2008, Transgenic Res., vol. 17, pp. 425-436); Nehra, et al., (1994) Plant J. 5(2):285-297 (Nehra et al., 1994, Plant J., vol. 5, no. 2, pp. 285-297); Rasco-Gaunt, et al., (2001) J. Exp. Botany 52(357):865-874 (Rasco-Gaunt et al., 2001, J. Exp. Botany, vol. 52, no. 357, pp. 865-874); Razzaq, et al., (2011) African J. Biotech. 10(5):740-750 (Razzaq et al., 2011, African J. Biotech., vol. 10, no. 5, pp. 740-750).

[0132] PHP42063 contains a single-stranded MS26+ gene under transcriptional control of the maize CAS1 promoter. The CAS1 promoter can be induced transcriptionally by the sulfonylurea safener 2-CBSU or by high temperature (US Patent Application 13 / 896,437, filed May 17, 2013). PHP42063 also contains a blue fluorescent gene (CFP) regulated by the ZmEND2 promoter, which is used as a visual marker for selecting the integration of T-DNA into wheat cells. Furthermore, PHP42063 contains a copy of a red fluorescent gene regulated by the maize histone 2B promoter. A portion of the red fluorescent gene in this construct is replicated in a forward orientation and consists of two fragments of the RFP gene with 369 bp overlap. These two fragments are separated by a 136 bp spacer containing the MS26 target site. Blue fluorescent callus was selected and used for the regeneration of wheat plants, which were then grown in a greenhouse to maturity and fruit set. Copy number analysis was used to validate the TDNA insertion of PHP42063 in wheat plants. Four independent plants transformed with single-copy or low-copy PHP42063 were selected for additional experiments. Immature embryos exhibiting blue fluorescence were harvested 14–20 days after pollination, sterilization, placement on maintenance medium, and incubation at 37°C in the dark for 24 hours. At the end of this period, the embryos incubated at high temperature were moved to room temperature (<26°C) and subsequently allowed to grow in the dark. Approximately 72 hours after the onset of the high-temperature treatment, embryos incubated at 37°C began to develop red fluorescent portions. This observation indicates that the heat-inducible cassette CAS1:MS26+ has induced a double-strand break at the MS26 target site between two overlapping sequences of the RF-FP reporter gene, thereby promoting intramolecular recombination and generating a functional RFP gene, which is indicated by the appearance of cells exhibiting red fluorescence against a blue fluorescent background. Red fluorescent callus events were selected for further molecular characterization and plant regeneration.

[0133] Identification of mutations at the TaMS26 target site in plant tissue .

[0134] Total genomic DNA was extracted from heat-treated and untreated callus tissue transformed with MS26+ homing endonuclease, and then... High-fidelity PCR amplification premixed reagent ( The High Fidelity PCR MasterMix (New England Biolabs, M0531L) amplifies the region surrounding the genomic target site using PCR, thereby adding the sequence necessary for the amplicon-specific barcode. Illumnia sequencing is then performed using "tailed" primers through two rounds of PCR. The primers used in the primary PCR reaction are shown in Table 5.

[0135] Table 5: PCR primer sequences

[0136]

[0137] The primers used in the secondary PCR reaction were AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACG (forward, SEQ ID NO: 24) and CAAGCAGAAGACGGCATA (reverse, SEQ ID NO: 25). Genomic DNA extracted from leaves of untransformed Fielder plants served as a negative control.

[0138] The resulting PCR amplification products were concentrated using Qiagen Minielute PCR Purification Spin Columns, followed by electrophoresis on a 2% agarose gel, after which the appropriate amplification products were excised and purified using a Qiagen Gel Extraction Spin Column. Gel-purified amplification products were measured for concentration in equimolar ratios using a fluorescence assay based on Hoechst dye, followed by deep 100 nucleotide length single read sequencing on an Illumina Genome Analyzer IIx (ELIM Biopharmaceuticals, Inc.) with a 30-40% (v / v) spike-in of PhiX Control v3 (Illumina, FC-110-3001) (to offset sequence bias). Only those reads that had indels >1 occurring within a 6 nucleotide window centered on the expected cleavage site, and that were not present at similar levels in the negative control, were classified as NHEJ mutations. The total number of NHEJ mutations was then used to calculate the percentage (%) of mutant reads based on the total number of reads with the appropriate length containing a perfect match to the barcode and forward primer.

[0139] The frequency of NHEJ mutations recovered from unheat treated and heat treated calli transformed with MS26+ homing endonuclease are shown in Table 6 compared to the negative control. The ten most prevalent NHEJ mutation types recovered from heat treated calli are shown in Table 6. These data demonstrate that MS26+ homing endonuclease efficiently introduced NHEJ mutations and alterations into the native MS26 wheat gene. Figure 2

[0140] Table 6: Percentage (%) of mutant reads at the wheat MS26+ homing endonuclease target locus .

[0141]

[0142] ​Identification of mutations at the TaMS26 target site in regenerated plants .

[0143] Plant regeneration was performed on events that exhibited red fluorescence. Plants were grown in a greenhouse and leaf DNA from each of the regenerated wheat plants (n = 122) was screened for mutations at the MS26-1 target site by amplifying the region using primers pair UNIMS26 5'-2 (GACGTGGTGCTCAACTTCGTGAT; SEQ ID NO: 26) and UNIMS26 3'-1 (GCCATGGAGAGGATGGTCATCAT; SEQ ID NO: 27) by PCR followed by digestion of the amplified product using the DNA restriction enzyme BsiWI which recognizes the sequence 5'-CGTACG-3'. The products of these reactions were run on a 1% agarose gel followed by screening for bands that were resistant to BsiWI digestion, which indicated mutations at the MS26-1 target site.

[0144] Ten of the 122 regenerated plants screened from heat-treated embryos of PHP42063 contained PCR products that were resistant to BsiWI restriction enzyme digestion, which indicated mutations at the MS26 target site. Subcloning and DNA sequence analysis of these PCR products revealed a variety of mutations ranging from insertion of a single nucleotide to deletion of 4 to 98 nucleotides across the MS26 target site. Seven different mutations were identified in total among these regenerated wheat plants. Figure 3 ). Plants containing these mutations were self-pollinated. Progeny plants were screened for meiotic transmission of the above mutations by PCR amplification to show bands that were resistant to BsiWI digestion, which indicated mutations at the MS26-1 target site (as described above). BsiWI resistant PCR amplification products were identified in progeny plants grown from selfed seed obtained from parent plants containing mutant Ms26 alleles, and DNA sequence analysis of these products confirmed that the original mutations were transmitted to the next generation through sexual reproduction.

[0145] This example demonstrates modification of a wheat gene by targeted delivery of a double-strand break reagent, in this case a custom homing endonuclease, which recognizes, cuts, and mutates wheat chromosomal DNA through end-joining repair.

Claims

1. A method of conferring male fertility to a mutant MS45 male sterile wheat plant relative to a control plant, wherein the method comprises: introducing into the mutant MS45 male sterile wheat plant a polynucleotide operably linked to a promoter that drives expression in a plant, the polynucleotide comprising a nucleotide sequence selected from the group consisting of: (a) a nucleotide sequence comprising SEQ ID NO: 15; and (b) a nucleotide sequence comprising at least 95% sequence identity to SEQ ID NO: 15, wherein the nucleotide, when expressed in the plant, confers male fertility to a mutant MS45 male sterile plant; and expressing the polynucleotide in the plant to confer male fertility to the plant.

2. The method of claim 1, wherein the promoter is a constitutive promoter, an inducible promoter, a tissue-preferred promoter, or a growth stage-preferred promoter.

3. The method of claim 2, wherein the tissue-preferred promoter is a male tissue-preferred promoter.

4. An isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of: (a) a nucleotide sequence comprising SEQ ID NO: 1, 7, or 13; (b) a nucleotide sequence encoding an amino acid sequence comprising SEQ ID NO: 2, 8, or 14; (c) a nucleotide sequence having at least 85% sequence identity to SEQ ID NO: 1, 7, or 13, wherein the polynucleotide encodes a polypeptide that modulates male fertility; (d) a nucleotide sequence comprising at least 50 contiguous nucleotides of SEQ ID NO: 1, 7, or 13, wherein the polynucleotide encodes a polypeptide that modulates male fertility; and (e) a nucleotide sequence encoding a polypeptide having at least 85% identity to SEQ ID NO: 2, 8, or 14, wherein the polypeptide modulates male fertility.

5. The isolated polynucleotide of claim 4, wherein the nucleotide sequence is selected from the group consisting of: (a) a nucleotide sequence comprising SEQ ID NO: 3, 5, 9, 11, 15, or 17; and (b) a nucleotide sequence encoding an amino acid sequence comprising SEQ ID NO: 4, 6, 10, 12, 16, or 18.

6. A polynucleotide comprising an expression cassette comprising a first polynucleotide operably linked to a first heterologous promoter that drives expression in a plant, the first polynucleotide being the polynucleotide of any one of claims 4-5.

7. The polynucleotide of claim 6, wherein the first promoter of the expression cassette is a constitutive promoter, an inducible promoter, a tissue-preferred promoter, or a growth stage-preferred promoter.

8. The polynucleotide of claim 7, wherein the first promoter of the expression cassette is a male tissue-preferred promoter.

9. The polynucleotide of any one of claims 6-8, further comprising a second polynucleotide operably linked to a second promoter that drives expression in a plant.

10. The polynucleotide of claim 9, wherein the second polynucleotide encodes a polynucleotide or polypeptide that interferes with the function, formation, or transmission of male gametes.

11. The polynucleotide of claim 10, wherein the second polynucleotide encodes a barnase, a DAM-methylase, an amylase, or an ADP-ribosylating enzyme.

12. The polynucleotide of any one of claims 9-11, further comprising a third polynucleotide operably linked to a third promoter, wherein the third polynucleotide encodes a marker gene product.

13. The expression cassette of claim 12, wherein the marker gene product comprises an antibiotic resistance marker gene product or a visual marker gene product.

14. An isolated polypeptide comprising an amino acid sequence selected from the group consisting of: (a) an amino acid sequence comprising SEQ ID NO: 2, 8, or 14; (b) an amino acid sequence having at least 85% sequence identity to SEQ ID NO: 2, 8, or 14, wherein the polypeptide modulates male fertility; and (c) an amino acid sequence comprising at least 50 contiguous amino acids of SEQ ID NO: 2, 8, or 14, wherein the polypeptide modulates male fertility.

15. The isolated polypeptide of claim 14, comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 4, 6, 10, 12, 16, and 18.

16. A vector comprising the expression cassette of any one of claims 6-13.

17. A plant cell comprising the polynucleotide of any one of claims 4-5, wherein the polynucleotide is heterologous to the plant cell.

18. The plant cell of claim 17, wherein the polynucleotide is operably linked to its native promoter sequence.

19. A plant cell comprising the expression cassette of any one of claims 6-13.

20. The plant cell of any one of claims 17-19, wherein the plant cell is from a monocot or a dicot.

21. The plant cell of claim 20, wherein the plant is maize, barley, millet, wheat, rice, sorghum, rye, soybean, canola, alfalfa, sunflower, safflower, sugarcane, tobacco, Arabidopsis, or cotton.

22. A plant comprising the plant cell of any one of claims 17-21.

23. The plant of claim 22, wherein expression of the polynucleotide modulates male fertility of the plant when compared to a control plant.

24. The plant of claim 22 or 23, wherein the plant has enhanced male fertility when compared to a control plant.

25. The plant of any one of claims 22-24, wherein expression of the polynucleotide confers male fertility to a male sterile plant.

26. The plant of any one of claims 22-25, wherein the plant is a female fertile plant. ​ ​ ​ 27. The plant of any one of claims 22-26, wherein formation of at least one male tissue of the plant is modulated upon expression of the first polynucleotide when compared to a control plant.

28. The plant of claim 27, wherein the male tissue comprises a stamen, anther, filament, or pollen.

29. The plant of claim 27 or 28, wherein the modulated formation of at least one male tissue comprises increased formation of at least one male tissue.

30. The plant of any one of claims 22-26, wherein the heterologous first polynucleotide is stably integrated into the genome of the plant.

31. A seed of the plant of any one of claims 22-30, wherein the seed comprises the heterologous first polynucleotide.

32. A method for increasing activity and / or levels of a polypeptide in a plant comprising providing the plant with the polypeptide of any one of claims 14 or 15.

33. A method of increasing activity and / or levels of a polypeptide in a plant comprising introducing into the plant a polynucleotide operably linked to a promoter active in the plant, the polynucleotide comprising a nucleotide sequence selected from the group consisting of: (a) a nucleotide sequence comprising SEQ ID NO: 1, 7, or 13; (b) a nucleotide sequence encoding an amino acid sequence comprising SEQ ID NO: 2, 8, or 14; (c) a nucleotide sequence having at least 85% sequence identity to SEQ ID NO: 1, 7, or 13, wherein the polynucleotide encodes a polypeptide that modulates male fertility; (d) a nucleotide sequence comprising at least 50 consecutive nucleotides of SEQ ID NO: 1, 7, or 13, wherein the polynucleotide encodes a polypeptide that modulates male fertility; and (e) a nucleotide sequence encoding a polypeptide having at least 85% identity to SEQ ID NO: 2, 8, or 14, wherein the polypeptide modulates male fertility.

34. The method of claim 33, wherein the polynucleotide comprises the nucleotide sequence set forth in SEQ ID NO: 3, 5, 9, 11, 15, or 17.

35. The method of any one of claims 33-34, wherein expression of the polynucleotide modulates male fertility in the plant when compared to a control plant.

36. The method of claim 35, wherein expression of the polynucleotide enhances male fertility in the plant when compared to a control plant.

37. The method of any one of claims 33-36, wherein expression of the polynucleotide confers male fertility to a male sterile plant.

38. The method of any one of claims 33-37, wherein the plant is a female fertile plant.

39. The method of any one of claims 33-38, wherein the promoter is a constitutive promoter, an inducible promoter, a tissue-preferred promoter, or a growth stage-preferred promoter.

40. The method of claim 39, wherein the promoter is a male tissue-preferred promoter. ​ ​ ​ ​ ​ 41. The method of any one of claims 33-40, wherein expression of the polynucleotide modulates formation of at least one male tissue when compared to a control plant.

42. The method of claim 41, wherein the male tissue comprises stamens, anthers, filaments, or pollen.

43. The method of claim 41 or 42, wherein the modulated formation of at least one male tissue comprises increased formation of at least one male tissue.

Images