Genes and applications of the interspecific hybrid sterility locus HS12 in rice (indica and japonica varieties)

Abstract

This invention discloses a gene locus HS12 for intersubspecies hybrid sterility in rice (indica-japonica) and its applications, belonging to the field of plant genetic engineering. This locus is located at the end of the long arm of chromosome 12, between molecular markers Sy55 and Sy8, and contains four fertility-related genes: iTx1, iTx2, iAd1, and jAd2. By functionally knocking out or suppressing the expression of genes iTx1 and / or iTx2, and then introducing iAd1 and / or jAd2, broadly compatible rice materials can be created. It also provides molecular markers for detecting HS12, which can be used for hybrid progeny detection and assisted breeding, effectively overcoming indica-japonica hybrid sterility and improving the seed setting rate of offspring.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to a gene controlling the hybrid sterility locus HS12 between indica and japonica rice subspecies and its application. Background Technology

[0002] Rice is the staple food for over 60% of my country's population, therefore increasing rice production is of great significance to ensuring national food security. Utilizing heterosis is an important way to increase rice yield. Indica and japonica are two subspecies of cultivated rice in Asia (Oryza sativa). Hybrid rice between these subspecies exhibits stronger heterosis than the currently promoted indica hybrid rice, and utilizing this intersubspecies heterosis is a crucial strategy for further increasing rice yield. However, reproductive isolation exists between indica and japonica rice, and their first-generation hybrids generally exhibit hybrid sterility, which is a problem that urgently needs to be solved in the breeding of indica-japonica hybrid rice. Therefore, cloning genes that control hybrid sterility between indica and japonica subspecies and studying the biological functions of these genes can provide theoretical support and technical guidance for the breeding of indica-japonica hybrid rice.

[0003] Hybrid sterility in indica-japonica hybrids is controlled by multiple independent loci. A single locus often leads to partial sterility in the hybrid, while the combined effects of multiple such loci cause an exponential decline in fertility, resulting in near-complete sterility. To date, only a few loci controlling hybrid sterility in indica-japonica hybrids, such as S5, Sa, and RHS12 / Se / pf12, have been cloned. The utilization of these loci is insufficient to completely solve the problem of hybrid sterility in indica-japonica hybrids. Therefore, it is necessary to further explore new loci and clone genes to provide new genetic targets for overcoming hybrid sterility in indica-japonica hybrids. Summary of the Invention

[0004] To address the problems existing in the prior art, this invention provides a hybrid sterility locus HS12 between indica and japonica rice subspecies and four key genes, revealing a "poison-antidote" mechanism of action, which can solve the problem of hybrid sterility in the offspring of crosses between indica and japonica rice subspecies, specifically manifested as pollen (male gamete) or embryo sac (female gamete) abortion.

[0005] On the one hand, the present invention provides a hybrid sterility locus HS12 between indica and japonica rice subspecies, located at the end of the long arm of chromosome 12, between molecular markers Sy55 and Sy8, and containing four fertility-related genes iTx1, iTx2, iAd1 and jAd2;

[0006] The amino acid sequence of the protein encoded by gene iTx1 is shown in SEQ ID NO.9, the amino acid sequence of the protein encoded by gene iTx2 is shown in SEQ ID NO.10, the amino acid sequence of the protein encoded by gene iAd1 is shown in SEQ ID NO.11, and the amino acid sequence of the protein encoded by gene jAd2 is shown in SEQ ID NO.12.

[0007] Specifically, the nucleotide sequence of the iTx1 gene is shown in SEQ ID NO.5, the nucleotide sequence of the iTx2 gene is shown in SEQ ID NO.6, the nucleotide sequence of the iAd1 gene is shown in SEQ ID NO.7, and the nucleotide sequence of the jAd2 gene is shown in SEQ ID NO.8.

[0008] On the one hand, the application of the rice intersubspecies hybrid sterility locus HS12 provided by this invention in overcoming intersubspecies hybrid sterility in rice, or in the decline of seed setting rate in indica-rice hybrids, or in the cultivation of fertile-compatible rice lines from indica-rice hybrids.

[0009] Specifically, the application includes the following steps: knocking out or suppressing the expression of genes iTx1 and / or iTx2 in the hybrid sterile rice subspecies iTx1, and / or transferring any one or any two of the following genes: gene iAd1 and gene jAd2.

[0010] Specifically, the method used for the functional knockout or expression inhibition is gene editing technology, such as CRISPR / Cas9 technology.

[0011] On the one hand, the present invention also provides a method for preparing a broad-affinity rice material, comprising the following steps:

[0012] (1) The function of the iTx1 gene and / or the iTx2 gene in rice materials containing the iTx1 gene and the iTx2 gene is destroyed or knocked out to obtain the modified material. The offspring are screened to obtain the wide-compatibility rice material.

[0013] Alternatively, (2) the iAd1 gene and / or jAd2 gene are transferred into rice materials, and screening and breeding are carried out to obtain widely compatible rice materials;

[0014] Alternatively, (3) in the modified material obtained in (1), the modification in step (2) is carried out simultaneously, and screening and cultivation are carried out to obtain widely compatible rice materials.

[0015] Specifically, the method used for the functional knockout or expression inhibition is gene editing technology, such as CRISPR / Cas9 technology.

[0016] On the one hand, the present invention utilizes the preparation method described above in the cultivation of fertile-compatible rice lines of indica-rice hybrids, by hybridizing the rice materials constructed by the method with japonica rice lines to produce fertile hybrids.

[0017] On the other hand, the present invention provides a molecular marker for identifying the presence of the interspecific hybrid sterility locus HS12 in rice materials, wherein the molecular markers are Sy55 and Sy8, the forward primer sequence of the molecular marker Sy55 is shown in SEQ ID NO.1 and the reverse primer sequence is shown in SEQ ID NO.2, the forward primer sequence of the molecular marker Sy8 is shown in SEQ ID NO.3 and the reverse primer sequence is shown in SEQ ID NO.4.

[0018] Specifically, the molecular markers are used for the detection of hybrid offspring or for marker-assisted selection breeding.

[0019] Beneficial technical effects:

[0020] (1) This invention cloned the HS12 locus and four key genes iTx1, iTx2, iAd1 and jAd2 for the first time, filling the research gap on new sites of indica-japonica hybrid sterility and providing new genetic targets for breeding;

[0021] (2) Provide efficient solutions for indica-japonica hybrid sterility, significantly improve the seed setting rate of hybrid offspring through gene editing and transfer technology, and help cultivate strong-yielding indica-japonica hybrid rice;

[0022] (3) Molecular markers can accurately detect locus HS12, accelerate the screening of hybrid offspring, improve breeding efficiency, and reduce costs; they also explain the "poison-antidote" mechanism, providing a new theoretical basis for rice breeding. Attached Figure Description

[0023] Figure 1 This describes the construction and genomic composition of the HS12 near-isogenous line NIL12, where A represents the NIL12 construction process and B represents the NIL12 genomic composition.

[0024] Figure 2This section describes the identification and fine mapping of pollen abortion phenotypes caused by the HS12 locus. A represents the plant typology comparison of KY131, NIL12, and their hybrid F1 (scale bar: 20 cm); B represents pollen grains from I2-KI stained KY131, NIL12, and their hybrid F1, with red arrows indicating aborted pollen; the percentages below indicate pollen fertility (scale bar: 100 micrometers); C represents the gamete transmission rate of F1 after testcrosses with KY131 by both male and female parents; D represents the number of individual plants of each genotype in the F2 population; E represents H... The fine mapping of S12 shows that the region of HS12 has 9 and 10 candidate genes in the japonica and indica rice genomes, respectively; F indicates the sequence differences between japonica and indica rice in the coding regions of the four genes that make up HS12; green and blue bars represent the exons of alleles in japonica and indica rice, respectively; white bars represent the sequences before the start codon and after the stop codon; horizontal lines represent introns; * indicates premature termination, the allele of Ad2 in indica rice terminates prematurely, the alleles of Tx1 and Ad1 in japonica rice terminate prematurely, and Tx2 is completely deleted in japonica rice.

[0025] Figure 3 This describes the mechanism by which HS12 controls pollen fertility in the F1 generation of indica-japonica hybrids. A represents the pollen fertility of three independent knockout families (1#, 2#, and 3#) obtained by knocking out iTx1 in F1 using CRISPR / Cas9 technology (scale bar: 100 micrometers); B represents the segregation ratio of the HS12 genotype in its self-pollinated population after knocking out iTx1 in F1; C represents the pollen fertility of three independent knockout families (1#, 2#, and 3#) obtained by knocking out iTx2 in F1 using CRISPR / Cas9 technology (scale bar: 100 micrometers); D represents the segregation ratio of the HS12 genotype in its self-pollinated population after knocking out iTx2 in F1; and E represents the hemizygous iAd1 transgenic... Changes in pollen fertility in F1 caused by the iAd1 transgene, scale bar: 100 micrometers; F indicates the change in the segregation ratio of the HS12 genotype in the self-pollinated population caused by the hemizygous iAd1 transgene; G indicates that the homozygous iAd1 transgene completely restores the pollen fertility of F1 to normal, scale bar: 100 micrometers; H indicates that the homozygous iAd1 transgene restores the segregation ratio of the HS12 genotype in the self-pollinated population to normal; I indicates the staining status of aborted pollen in F1 with I2-KI; J indicates the staining status after knocking out jAd2 in F1; K indicates the pollen fertility of the jAd2 and iTx1 double mutant; L indicates the pollen fertility of the jAd2 and iTx2 double mutant; red scissors indicate gene knockout, and the numbers below the image indicate pollen fertility rate.

[0026] Figure 4HS12 regulates female gamete fertility and seed setting rate, where A represents the seed setting rate of wild-type F1; B represents the seed setting rate of F1 with jAd2 knockout; C represents the seed setting rate of F1 with both jAd2 and iTx1 knockouts; D represents the seed setting rate of F1 with both jAd2 and iTx2 knockouts; E represents that the homozygous iAd1 transgene restores the seed setting rate of F1 after jAd2 knockout to normal. Scale bar: 3 cm, asterisks indicate unfruited florets; F represents... Figure 4 The fertility of female gametes corresponding to the AE genetic material; G indicates the change in the segregation ratio of the HS12 genotype in the self-pollinated population of F1 with jAd2 knockout compared to its segregation ratio in the self-pollinated population of wild-type F1; H indicates the transmission pattern of male and female gametes in F1 after jAd2 knockout, red crosses indicate gamete abortion or the absence of individuals with a specific genotype, and red scissors indicate gene knockout.

[0027] Figure 5 The fertility and seed setting rate of female gametes controlled by HS12 are shown in Figure 12. Here, A represents the ears of KY131 and NIL12 after maturity (scale bar: 3 cm); B represents the seed setting rate of KY131 and NIL12; and C represents the fertility rate of female gametes of KY131 and NIL12.

[0028] Figure 6 This study demonstrates how HS12 regulates the fruit set rate of NIL12 through a dose-effect relationship. A represents the fruit set level and rate of NIL12 after iTx1 knockout; B represents the fruit set level and rate of NIL12 after iTx2 knockout; asterisks indicate unfruited florets; scale bar: 3 cm; C represents the expression level of iAd1 in its overexpression genetic material; D represents the effect of iAd1 overexpression on the fruit set rate of NIL12; E represents the expression level of iAd1 in its overexpression genetic material; and F represents the effect of jAd2 overexpression on the fruit set rate of NIL12. Detailed Implementation

[0029] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer as a result of the description. However, these embodiments are merely illustrative and do not constitute any limitation on the scope of protection defined by the claims of the present invention.

[0030] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that the upper and lower limits of the range and each intermediate value between them are specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, are also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0031] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0032] Example 1: Construction and phenotypic identification of near-isogenic lines of HS12

[0033] In this experiment, a set of near-isogenic lines (NILs) were constructed using Kongyu 131 (KY131, a japonica rice variety) and 9311 (an indica rice variety) as the recipient parent and donor parent, respectively. Figure 1 As shown in Figure A), one of the NIL12 strains had a 9311 fragment inserted only at the end of the long arm of chromosome 12. Figure 1 As shown in Figure B), the plant morphology of this strain is basically the same as that of KY131. Figure 2 As shown in Figure A), pollen fertility was examined using the I2-KI staining method. The pollen fertility of NIL12 was 96.1±1.4%, and that of KY131 was 94.5±3.6%. Both NIL12 and KY131 exhibited completely normal pollen fertility, but their F1 hybrids showed pollen hemisterility, with a fertility of only 46.3±3.7%. Approximately half of the pollen lacked sufficient starch accumulation, resulting in a significantly lighter staining color when stained with I2-KI. Figure 2 (As shown in B). This phenomenon indicates that there is a locus controlling the semi-sterility of pollen in indica-japonica hybrids in the region covered by the indica rice chromosome segment of NIL12. Because it is located at the end of the long arm of chromosome 12, it is named HS12 (Hybrid sterility locus on chromosome 12).

[0034] Example 2: Genetic analysis and fine mapping of the HS12 locus

[0035] To determine the pollen abortion type (i.e., whether the aborted pollen inherited indica or japonica alleles) in the F1 generation of the NIL12 / KY131 hybrid, we conducted a gamete transmission rate analysis. Specifically, F1 (hybrid indica / japonica, i / j) was used as the male parent and testcrossed with KY131 (homozygous japonica, j / j). The genotypes of the resulting hybrids at the HS12 locus were then analyzed. The results showed that 98.5% of the individuals carried the heterozygous genotype (i / j), while only 1.5% carried the homozygous japonica genotype (j / j). Figure 2As shown in Figure C), this indicates that 98.5% of the pollen from F1 inherited the indica allele at the HS12 locus, while only 1.5% inherited the japonica allele. This suggests that aborted pollen in F1 inherited the japonica allele at the HS12 locus. Further analysis of the genotype segregation ratio of HS12 in the F2 population showed that homozygous japonica genotypes (j / j) were extremely rare, while the number of heterozygous genotypes (i / j) and homozygous indica genotypes (i / i) were roughly equal, with the ratio of each genotype deviating significantly from 1:2:1. Figure 2 As shown in Figure D), this further corroborates that the aborted pollen in F1 inherited the japonica type allele. In addition, we also observed that the transmission rate of japonica type female gametes in F1 was 37.1%, which was lower than the transmission rate of indica type female gametes at 62.9%, suggesting that HS12 may also affect the fertility of some japonica type female gametes.

[0036] To locate the HS12 site, an F2 population of KY131 / NIL12 was constructed, and 240 individuals from this population were used to initially locate HS12 between molecular markers Sy26 and Sy29. Based on this, 2600 F2 individuals were used for further fine mapping of HS12, ultimately locating it between molecular markers Sy55 and Sy8. The sequence of molecular marker Sy55 is as follows:

[0037] Sy55-F: CGGTCAAACCTGTTTAGAAAAGTC (SEQ ID NO. 1);

[0038] Sy55-R: CTTTAGGGGCTGTTTGGTTCT (SEQ ID NO.2),

[0039] The sequence of the molecular marker Sy8 is as follows:

[0040] Sy8-F: ACGTCCATCCATTCTGGGTT (SEQ ID NO.3);

[0041] Sy8-R: GCTAGCTTCTTCCATCGTGC (SEQ ID NO. 4).

[0042] Locational interval sequence analysis showed that the physical length of japonica rice between Sy55 and Sy8 was 83.1 kb, while the corresponding physical length of indica rice was 105 kb due to two larger fragment insertions. Figure 2 (As shown in E). Besides the three transposons, japonica and indica rice contain 9 and 10 candidate genes, respectively, within this interval. Among them, the indica allele of candidate gene 1 frames shift and terminates prematurely relative to its japonica allele; the japonica alleles of candidate genes 4 and 7 frames shift and terminate prematurely relative to their indica alleles; and candidate gene 8 is unique to indica rice and is completely absent in japonica rice. Figure 2 (as shown in SEQ ID NO. 5). The nucleotide sequence of candidate gene 4, the indica allele (renamed iTx1), is shown in SEQ ID NO. 5, and the protein sequence it encodes is shown in SEQ ID NO. 9. The nucleotide sequence of candidate gene 8 (renamed iTx2) is shown in SEQ ID NO. 6, and the protein sequence it encodes is shown in SEQ ID NO. 10. The nucleotide sequence of candidate gene 7, the indica allele (renamed iAd1), is shown in SEQ ID NO. 7, and the protein sequence it encodes is shown in SEQ ID NO. 11. The nucleotide sequence of candidate gene 1, the japonica allele (renamed jAd2), is shown in SEQ ID NO. 8, and the protein sequence it encodes is shown in SEQ ID NO. 12.

[0043] Example 3: Gene cloning at the HS12 locus

[0044] This experiment developed two gene-editing primers, Primer1 and Primer2, targeting the iTx1 coding region (Primer1: TCACTCTACAACAATATGTG (SEQ ID NO.13); Primer2: CGAAAGGCAAGAGTTGGAAT (SEQ ID NO.14)). These primers were then recombined into a CRISPR / Cas9 vector using INFUSION recombinase. After transforming the correctly sequenced vector into Agrobacterium, the vector was transferred into the F1 generation using Agrobacterium-mediated transgenic technology. Sequencing analysis of the iTx1 in the transformed plants identified three independent lines (denoted as F1-itx1). KO ), of which F1-itx1 KO -1# and F1-itx1 KO The iTx1 of strain -2# showed deletions of 1 and 7 bases at Primer1, while F1-itx1... KO The iTx1 of strain -3# underwent a two-base deletion at Primer2, and all three strains exhibited frameshift and premature termination mutations in iTx1. Pollen fertility studies showed that pollen fertility in all three strains recovered to normal levels. Figure 3 (As shown in Figure A); Genotypic segregation ratios were detected using the molecular marker Sy8, which is closely linked to the HS12 locus. The results showed that the genotypic segregation ratio at the HS12 locus in the self-pollinated populations of these three lines was restored to 1:2:1. Figure 3 (As shown in B). These results indicate that iTx1 plays a role in inducing pollen abortion, and knocking out this gene can completely eliminate pollen abortion caused by the HS12 site.

[0045] Using the same strategy, two gene-editing primers, Primer3 and Primer4, targeting iTx2 were also developed (Primer3: AGGGGGAAAGAGTAAGAACC (SEQ ID NO.15); Primer4: GAGGATTTGGTTTTGTAAAG (SEQ ID NO.16). Using CRISPR / Cas9 technology and Agrobacterium-mediated transgenic strains, three independent knockout lines (denoted as F1-itx2) were created. KO ), of which F1-itx2 KO The -1# strain had a two-base deletion at Primer3, while the F1-itx2 strain... KO -2# and F1-itx2 KO The -3# line showed a one-base deletion and insertion at Primer4, respectively. All three lines exhibited frameshift and premature termination mutations in iTx2. We found that knocking out iTx2 also restored pollen fertility in F1. Figure 3 As shown in C), it can also restore the normal 1:2:1 genotype segregation ratio at the HS12 locus (as shown in C). Figure 3 As shown in Figure D), this indicates that iTx2 also plays a role in inducing pollen abortion. The above experiments show that iTx1 and iTx2 work together to induce pollen abortion, and knocking out either of them can eliminate the pollen abortion phenomenon caused by HS12 in indica-japonica crosses.

[0046] Furthermore, we amplified the iAd1 genome fragment from indica rice 9311 using primers Primer5 (CCGGCGCGCCAAGCTTCCGCAAGGGAAGAAATCAA (SEQ ID NO. 17)) and Primer6 (GAATTCCCGGGGATCCTCTGCGTTGCGTTACGACTG (SEQ ID NO. 18)). This fragment contains a 2.5 kb iAd1 genome sequence, along with 2.7 kb upstream of the start codon and 1.2 kb downstream of the stop codon. Using the INFUSION recombinase, this fragment was recombined between the HindIII and BamHI restriction sites of the pCUBi1390 vector, thus constructing the complementary vector of iAd1 (denoted as pCUBi1390-iAd1). After transferring the vector with a completely correct sequence into the F1 generation using Agrobacterium-mediated transgenic technology, we screened and obtained three independent transgenic lines containing a single copy of the hemizygous iAd1 transgene (denoted as F1-iAd1(+ / -), where + indicates transgene positive, - indicates transgene negative, and + / - indicates the transgene is hemizygous). Pollen fertility studies showed that they all exhibited approximately 75% pollen fertility. Figure 3 As shown in Figure E), the segregation of HS12 loci genotypes in their self-crossed populations conformed to a ratio of 1:3:2. Figure 3 (As shown in F1). Furthermore, we screened the self-pollinated progeny of these three lines for plants carrying the homozygous iAd1 transgene and the indica-japonica heterozygous HS12 (equivalent to F1) (denoted as F1-iAd1(+ / +), where + / + indicates the transgene is homozygous). These plants exhibited completely normal pollen fertility. Figure 3 As shown in G), the segregation ratio of the HS12 genotype in the self-pollinated populations of these individual plants also completely recovered to 1:2:1. Figure 3 (As shown in H). These results indicate that iAd1 protects pollen through its gametophyte mechanism, and homozygous iAd1 transgenes can completely restore pollen fertility in F1.

[0047] The jAd2 gene from japonica rice is homologous to the iAd1 gene mentioned above. To analyze whether jAd2 also participates in the HS12 system, a gene editing primer Primer7 (Primer7: CTGCTGGAGCGACGACGACG (SEQ ID NO.19)) targeting jAd2 was designed. Using CRISPR / Cas9 technology, jAd2 was knocked out in F1 cells, resulting in two knockout lines (denoted as F1-jad2) where a single base was inserted at Primer7, leading to frameshift and premature termination. KO Pollen fertility studies showed that knocking out jAd2 in F1 did not change the proportion of pollen abortion, but it exacerbated the degree of pollen abortion. Aborted pollen in F1 stained lighter with I2-KI, indicating insufficient starch accumulation in aborted pollen. After knocking out jAd2 in F1, the previously lightly stained aborted pollen became almost completely unstainable. Figure 3 (As shown in I and J). To analyze whether jAd2 is an essential gene for pollen development or another "antidote" gene for the HS12 system, jAd2 and either iTx1 or iTx2 were simultaneously knocked out in F1 (referred to as F1-jad2, respectively). KO ;itx1 KO and F1-jad2 KO ;itx2 KO The results showed that double mutants of jAd2 and iTx1 or iTx2 all had normal pollen fertility. Figure 3 (As shown in K and L), this indicates that jAd2 is another "antidote" gene in the HS12 system, rather than an essential gene for pollen development. It is important to note that pollen that inherits jAd2 will still fail to produce offspring, but knocking out this gene will exacerbate the failure of these pollen. Therefore, jAd2 only provides a certain degree of protection for pollen; it is a weakly functional "antidote" gene.

[0048] Example 4: HS12 regulation of female gamete fertility in F1

[0049] During implementation, it was also observed that, compared to F1, F1-jad2 KO The fruit setting rate decreased significantly, from 80.7±4.7% to 32.3±4.5%. Figure 4 (As shown in A and B). Since each spikelet has an excess of pollen, pollen semi-sterility does not significantly affect the seed set rate. However, since each spikelet has only one female gamete, its sterility directly affects the seed set rate. Therefore, it is speculated that F1-jad2... KO The decreased seed setting rate may be due to female gamete abortion. To verify this hypothesis, the F1-jad2 strain was examined. KO F1-jad2 KO (Knock out jAd2 in F1), F1-jad2 KO iTx1 KO (Simultaneously knock out jAd2 and iTx1), F1-jad2 KO iTx2 KO (Simultaneously knock out jAd2 and iTx12), F1-jad2 KO iAd1 KO The female gametes (whose fertility was simultaneously knocked out, including jAd2 and iAd1) showed the expected result: F1-jad2 KO The female gametes exhibited obvious semi-sterility. Figure 4 (As shown in F1). Furthermore, the HS12 genotype was also found in F1-jad2. KO The proportion of inbred populations exhibited even more extreme characteristics: only homozygous indica genotypes were observed, while homozygous japonica and heterozygous genotypes were absent. Figure 4 As shown in G), this indicates that knocking out jAd2 in F1 results in selective sterility in female gametes that inherit the japonica allele. Figure 4 As shown in Figure H), we hypothesize that jAd2 may also have a protective effect on female gametes. To prove this hypothesis, we examined two double mutants, F1-jad2. KO ;itx1 KO and F1-jad2 KO ;itx2 KO The results showed that both exhibited normal female gamete fertility and seed setting rate. Figure 4 (As shown in C, D and F), this indicates that the female gamete abortion caused by the knockout of jAd2 is caused by iTx1 and iTx2, that is, iTx1 and iTx2 can also induce female gamete abortion in F1, while jAd2 can protect female gametes in F1 that have inherited the japonica rice allele.

[0050] Since the female gametes of F1 cells that inherit the japonica allele are protected by jAd2, further research is needed to determine which gene protects the female gametes that inherit the indica allele. Because the jAd2 allele terminates prematurely in indica rice, it may not have the function of protecting female gametes. Therefore, it is hypothesized that female gametes that inherit the indica allele may be protected by iAd1. To verify this hypothesis, the iAd1 complement vector pCUBi1390-iAd1 constructed in Example 3 was transgenic into F1-jad2. KO In the process, plants homozygous for transgenic iAd1 (referred to as F1-jad2) were obtained through screening. KO iAd1 (+ / +) fertility surveys show that the iAd1 transgenic strain will produce F1-jad2 KO The seed setting rate and female gamete fertility have returned to normal levels. Figure 4 As shown in E and F), this indicates that iAd1 does indeed have a female gamete protection function.

[0051] Example 5: HS12 regulation of seed setting rate and female gamete fertility in homozygous individuals

[0052] Unlike other cloned hybrid sterility loci, HS12 also leads to decreased fertility when it is homozygous. Specifically, the homozygous genotype in indica rice causes sterility in approximately 60% of female gametes in the japonica rice genome background (e.g., Figure 5 As shown in C), this resulted in a decrease in the fruit setting rate to approximately 40%. Figure 5 As shown in Figure B), the ear phenotypes of KY131 and NIL12 (HS12 is in the indica homozygous state) after maturity are as follows: Figure 5 As shown in Figure A. To explain this phenomenon, we first created F1-itx1 in the previous work. KO and F1-itx2 KO In a self-pollinated population, lines were selected that were homozygous for the indica genotype HS12 (i.e., NIL12 genotype), but whose iTx1 and iTx2 were homozygous knocked out (denoted as NIL12-itx1). KO and NIL12-itx2 KO Fertility studies showed that NIL-itx1 KO and NIL-itx2 KO All have normal fruit setting rate ( Figure 6 (As shown in A and B), this indicates that the decreased fruit set rate caused by female gamete abortion in NIL12 is due to the "poison" genes iTx1 and iTx2.

[0053] All female gametes from NIL12 contain the "antidote" gene iAd1 (because iAd1 is homozygous in NIL12), but the "poison" gene still causes 60% of female gametes to abort, a stark contrast to the normal fertility of F1 female gametes containing iAd1. Considering that the two poison genes iTx1 and iTx2 are heterozygous in F1 but homozygous in NIL12, it is hypothesized that the homozygous iTx1 and iTx2 in NIL12 may produce more "toxicity," with the excessive "poison" dose exceeding the protective effect of the "antidote" gene iAd1 on female gametes, thus leading to the abortion of most female gametes. To verify this hypothesis, it was investigated whether reducing the dose of the "poison" gene in NIL12 would lead to an increase in its fruit set rate. Therefore, NIL12 was compared with NIL12-itx1... KO and NIL12-itx2 KO Heterozygous knockout lines of iTx1 and iTx2 were constructed through hybridization. Figure 6 The Chinese representation is NIL12-iTx1 / itx1 KO and NIL12-iTx2 / itx2 KO As expected, the seed setting rates of both heterozygous knockout lines were significantly higher than those of NIL12, but significantly lower than those of the homozygous knockout line NIL-iTx1. KO and NIL-iTx2 KO ( Figure 6 (As shown in A and B).

[0054] Lowering the "poison" dosage can increase the fruit set rate. Could increasing the "antidote" dosage also increase the fruit set rate? To investigate this, primers were used to amplify the genomic fragments of iAd1 and jAd2, respectively. The amplified iAd1 fragment contained a 2.5kb iAd1 genomic sequence and a 1.2kb sequence downstream of the stop codon, while the amplified jAd2 fragment contained a 1.4kb iAd2 genomic sequence and a 1.8kb sequence downstream of the stop codon. Using the INFUSION recombinase, these two fragments were extended between the KpnI and BamHI restriction sites of the pCUBi1390 vector, and sequencing yielded correctly sequenced overexpression vectors of iAd1 and jAd2. Figure 6 The Chinese version is represented as pCUBi1390-iAd1 OE and pCUBi1390- jAd2 OE Using Agrobacterium-mediated transgenic technology, the two vectors were transgenic into NIL12, resulting in three independent overexpression lines. As expected, overexpression of either iAd1 or jAd2 in NIL12 significantly improved seed setting rate. Figure 6 (C and D in the middle).

[0055] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A rice indica-japonica subspecies inter-subspecific hybrid sterile locus HS12, characterized in that, comprise four fertility-related genes iTx1, iTx2, iAd1 and jAd2; wherein the amino acid sequence of the protein encoded by the gene iTx1 is as shown in SEQ ID NO. 9, the amino acid sequence of the protein encoded by the gene iTx2 is as shown in SEQ ID NO. 10, the amino acid sequence of the protein encoded by the gene iAd1 is as shown in SEQ ID NO. 11, and the amino acid sequence of the protein encoded by the gene jAd2 is as shown in SEQ ID NO.

12.

2. The indica-japonica subspecies hybrid male sterile locus HS12 of claim 1, wherein, The nucleotide sequence of the gene iTx1 is as shown in SEQ ID NO. 5, the nucleotide sequence of the gene iTx2 is as shown in SEQ ID NO. 6, the nucleotide sequence of the gene iAd1 is as shown in SEQ ID NO. 7, and the nucleotide sequence of the gene jAd2 is as shown in SEQ ID NO.

8.

3. The use of the indica-japonica subspecies hybrid male sterile locus HS12 of any one of claims 1-2 in overcoming the sterility of indica-japonica subspecies hybrid rice or in increasing the seed setting rate of indica-japonica subspecies hybrid rice or in breeding a fertility-compatible rice line.

4. Use according to claim 3, characterized in that, comprising the following steps: functionally knocking out or inhibiting the expression of the gene iTx1 and / or the gene iTx2 of the indica-japonica subspecies hybrid sterile rice, and / or introducing either or both of the genes iAd1 and jAd2.

5. Use according to claim 4, characterized in that, The method for functionally knocking out or inhibiting the expression is gene editing technology.

6. A method for preparing a broad-affinity rice material, characterized by, comprising the following steps: (1) functionally destroying or knocking out the gene iTx1 and / or the gene iTx2 in a rice material containing the gene iTx1 and the gene iTx2 to obtain a modified material, and screening the offspring to obtain a wide-compatible rice material; or, (2) introducing the gene iAd1 and / or the gene jAd2 into a rice material, and screening and breeding to obtain a wide-compatible rice material; or, (3) simultaneously performing the modification of step (2) in the modified material obtained in (1), and screening and breeding to obtain a wide-compatible rice material; wherein the amino acid sequence of the protein encoded by the gene iTx1 is as shown in SEQ ID NO. 9, the amino acid sequence of the protein encoded by the gene iTx2 is as shown in SEQ ID NO. 10, the amino acid sequence of the protein encoded by the gene iAd1 is as shown in SEQ ID NO. 11, and the amino acid sequence of the protein encoded by the gene jAd2 is as shown in SEQ ID NO.

12.

7. The production method according to claim 6, characterized by, The method for functionally knocking out or inhibiting the expression is gene editing technology.

8. Use of the production process according to claim 6 or 7 for breeding a male-fertile indica-rice hybrid breeding line, characterized in that, The rice material constructed by the method of claim 6 or 7 is crossed with a japonica rice line to produce a fertile hybrid.

Images