Enzyme separated from plant lactobacillus and application thereof

Abstract

The invention belongs to the technical field of biology, and relates to an enzyme separated from plant lactobacillus and application of the enzyme, the enzyme is prepared through a prokaryotic expression system and can efficiently degrade patulin, 1 mg / L of enzyme can completely degrade 5 mg / L of PAT, the degradation rate is still higher than 80% when the concentration of PAT is 40 mg / L, a degradation product is identified as low-toxicity E / Z-ascladiol, the cytotoxicity is remarkably lower than that of PAT, and the enzyme can be used for efficiently degrading patulin. The enzyme separated from the plant lactobacillus, provided by the invention, provides effective theoretical support and candidates for degrading patulin in food and feed by lactic acid bacteria and biological enzymes, and provides a safe basis for performing biological detoxification by industrially using the biological enzymes and the lactic acid bacteria.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, and in particular relates to an enzyme isolated from Lactobacillus plantarum and its application. Background Technology

[0002] Patulin (PAT), also known as patulin, is a fungicide produced by the genus Aspergillus. Aspergillus spp.), Penicillium ( Penicillium Secondary metabolites produced by fungi such as *Penicillium expansum* (spp.). Commonly found in fruits and grains are *Penicillium* fungi. P. expansum ), Penicillium arcus ( P. cyclopium ), Penicillium chrysogenum ( P. crustosum ) and gray penicillium ( P. griseofulvum PAT can be produced by various fungi, including *Penicillium expansum*. *Penicillium expansum* is the most abundant PAT-producing fungus, contaminating fruits such as apples and pears, as well as their juices. PAT is easily contaminated during the growth, processing, and storage of fruits and crops, posing a threat to food safety and human health. Excessive intake can lead to liver and kidney damage; therefore, controlling PAT levels in food and reducing consumer exposure is crucial.

[0003] Fruits are susceptible to fungal contamination and toxin production during growth, transportation, and storage. Therefore, a dual control strategy is needed to inhibit fungal growth (reducing toxin production) and eliminate existing toxins. Currently, the key strategy for inhibiting PAT accumulation lies in using synthetic fungicides to suppress Penicillium expansum infection. However, due to environmental risks, toxicological concerns, and the emergence of drug-resistant fungi, chemical control methods are limited, necessitating the development of alternative or integrated biological control methods. Biological methods use microorganisms, enzymes, and other biological means to adsorb, degrade, or inhibit toxin formation, reducing PAT contamination in food. These methods are superior to physical and chemical methods due to their lower contamination levels, higher safety, and preservation of food's nutritional characteristics. For example, lactic acid bacteria can adsorb and enzymatically degrade toxins, and esterases can degrade PAT at room temperature with an efficiency exceeding 95%.

[0004] While current research has made progress in terms of strain types, degradation efficiency, and product structure, most strains are derived from non-food-grade microorganisms, and existing technologies can only convert PAT into low-toxicity derivatives, not completely detoxify it. Practical application and safety remain uncertain. Therefore, developing novel, highly efficient degradation strains derived from food-grade microorganisms and bioenzyme preparations has become a crucial research direction in this field. Summary of the Invention

[0005] This invention aims to utilize genetic engineering techniques to discover the potential of Lactobacillus plantarum RB-4 (… Lactiplantibacillus plantarum The enzyme RB-4 is provided for the degradation of patulin (PAT).

[0006] An enzyme gene A-1002321 isolated from Lactiplantibacillus plantarum, the nucleotide sequence of which is shown in SEQ ID NO: 1.

[0007] The enzyme ASADH2-JQ encoded by the enzyme gene A-1002321 isolated from Lactiplantibacillus plantarum, the amino acid sequence of which is shown in SEQ ID NO: 2.

[0008] The present application isolates a strain of Lactiplantibacillus plantarum RB-4 from the milk cake purchased in the traditional market of Yunnan Province, which has been preserved in the China Center for Type Culture Collection, located in Wuhan University, Wuhan, China, and the strain preservation number is CCTCC NO: M 2023268; the preservation date is March 8, 2023.

[0009] The present application also provides the application of the enzyme isolated from Lactiplantibacillus plantarum in degrading patulin.

[0010] The present application screens Lactiplantibacillus plantarum RB-4 with PAT degradation activity from milk cake, Lactiplantibacillus plantaru m ) RB-4 combined with whole genome and protein quantitative detection results, a new degradation enzyme gene A-1002321 with PAT degradation activity is identified.

[0011] The present application constructs a genetically engineered strain A-1002321 for efficient expression of ASADH2-JQ, and realizes its heterologous expression in Escherichia coli. The protein induced by the nickel column is purified, and the purified enzyme can completely degrade 5mg / L of PAT. With the increase of PAT concentration to 40mg / L, the PAT degradation rate decreases, but is still higher than 80%.

[0012] The enzyme ASADH2-JQ isolated from Lactiplantibacillus plantarum of the present application is found to be a formaldehyde dehydrogenase by comparison with NCBI database, which is one of the potential PAT degradation enzymes.

[0013] The enzyme ASADH2-JQ isolated from Lactiplantibacillus plantarum of the present application can degrade PAT to generate a new product (retention time shorter than PAT), which is speculated to be low-toxic E / Z-ascladiol, and its toxicity to HepG2 cells is significantly lower than that of PAT, which provides a theoretical basis for the subsequent development of efficient PAT biodegradation enzymes. BRIEF DESCRIPTION OF DRAWINGS

[0014] Figure 1 Agarose gel electrophoresis map of enzyme gene fragment from Lactiplantibacillus plantarum RB-4 (A: PCR amplified target gene; B: PCR product of bacterial liquid of positive clone); Figure 2 Schematic diagram of ASADH2-JQ purified protein electrophoresis (A: SDS-PAGE gel electrophoresis analysis of pET-22b-JQ; B: Western blotting analysis of pET-22b-JQ; M: Protein Marker; Lanes 1, 2, 3, 4: Bacterial culture collected at 0, 4, 8, and 24 h after induction, respectively; Lane 5: Sonicated disruption solution; Lane 6: Disruption supernatant; C: SDS-PAGE gel electrophoresis analysis of JQ purified protein; M: Protein Marker; 1: Unpurified crude enzyme; 2: Purified enzyme). Figure 3 To verify the degradation ability of PAT (A: degradation effect of crude enzyme solution on PAT; B: degradation effect of ASADH2-JQ on PAT); Figure 4 HPLC analysis of PAT degradation products by ASADH2-JQ (A: HPLC chromatogram of PAT standard; B: HPLC chromatogram of PAT after degradation by ASADH2-JQ; 1: Peak of PAT standard; 2: Peak of degradation product). Figure 5 To analyze the toxicity of degradation products to HepG2 cells. Detailed Implementation

[0015] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments. However, the scope of protection of the present invention is not limited to the contents described. Unless otherwise specified, the reagents and methods used in the embodiments are all conventional reagents and conventional methods.

[0016] This invention isolates a strain of *Lactobacillus plantarum* RB-4 from milk cake purchased from traditional markets in Yunnan Province. Lactiplantibacillus plantarum RB-4 has been deposited at the China Center for Type Culture Collection, Wuhan University, Wuhan, China, with accession number CCTCC NO: M 2023268 and deposit date of March 8, 2023.

[0017] Example 1 Isolated from Lactobacillus plantarum RB-4 ( Lactiplantibacillus plantarum Cloning of the RB-4 enzyme gene: (1) Genomic DNA of Lactobacillus plantarum RB-4 was extracted using the bacterial gene extraction kit from Shanghai Sangon Biotech Co., Ltd. The concentration of the extracted DNA was detected by a micro spectrophotometer and stored at -20℃ to avoid repeated freeze-thaw cycles. (2) Primer design: Based on the results of two omics studies, namely the whole genome of Lactobacillus plantarum RB-4 and label-free quantitative proteomics, the PAT degrading enzyme gene was identified, and the upstream and downstream PCR primers involved in the PAT degrading enzyme gene were A-1002321-F and A-1002321-R. A-1002321-F: cggaattaattcggatccgGTGAGTGGATATAACGTCGCG; A-1002321-R: gtggtgctcgagtgcTTGCATGTGCAATAAACCCATCT; (3) Cloning of enzyme gene: Using the whole genome of Lactobacillus plantarum RB-4 as a template, the target fragment was amplified by PCR using the primers designed above. The PCR amplification system was as follows: DNA template 50-400 ng, forward and reverse primers (10 μM) 2 μL each, dNTPMix 1 μL, 2×PhantaMax Buffer 25 μL, PhantaMax Super-Fidelity DNA Polymerase 1 μL, Sterile Water up to 50 μL; PCR amplification conditions: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 90 s, 30 cycles; 72℃ extension for 5 min. The target fragment obtained by amplification using a DNA gel recovery kit was sent to Shanghai Sangon Biotech Co., Ltd. for sequencing verification. Figure 1 A) According to sequencing results, the enzyme ASADH2-JQ isolated from *Lactobacillus plantarum* is 1059 bp in length (as shown in SEQ ID NO.1), and the enzyme ASADH2-JQ isolated from *Lactobacillus plantarum* RB-4 encodes a protein composed of 353 amino acids (as shown in SEQ ID NO.2). (4) Vector linearization: The vector linearization double enzyme digestion system is as follows: pET-22b plasmid DNA 5 μg, 10×CutOne™ Color Buffer 5 μL, EcoR I 5 μL, Not I 5 μL, Sterile Water up to 50 μL. After adding all the reagents, the system is digested at 37℃ for 2 h.

[0018] Example 2 Expression and purification of the enzyme ASADH2-JQ isolated from Lactobacillus plantarum in Escherichia coli: (1) Construction of expression carrier: The linearized plasmid and the target gene were connected with the ready-to-use seamless cloning kit from Shanghai Generay (B632219). The recombination reaction system was as follows: 2xSeamless cloning Master Mix 10 μL, linearized pET-22b vector 50-100 ng, target gene fragment X ng (the molar ratio of the fragment and the vector was between 2:1-3:1), sterilized ddH2O up to 20 μL, the prepared reaction system was incubated at 50°C for 20 min, and then the tube was immediately placed on ice for 2 min. After transformation, the cells were incubated at 37°C, 180 rpm for 1 h, centrifuged at 6000 rpm for 4 min, and the supernatant was discarded. The remaining liquid was resuspended and plated on an ampicillin-containing plate and incubated overnight. A single colony was selected and cultured in 5 mL of ampicillin-containing LB liquid medium for 12 h. The primers T7-F and T7-R were verified by pET-22b vector bacterial liquid PCR (the system and procedure were the same as in Example 1(3), and the template was replaced with the bacterial liquid). The PCR product was tested for band size by agarose gel electrophoresis and sent to Generay for sequencing. The E. coli DH5α competent cells were thawed on ice, and 10 μL of the ligation product was transformed. After ice bath for 30 min, 42°C heat shock for 80 s, and ice bath for 3 min, 800 μL of normal LB liquid medium was added, and the mixture was incubated at 37°C, 180 rpm for 1 h. Then, the mixture was centrifuged at 6000 rpm for 4 min, and 800 μL of supernatant was discarded. The remaining liquid was resuspended and plated on an ampicillin-containing plate and incubated overnight. A single colony was selected and cultured in 5 mL of ampicillin-containing LB liquid medium for 12 h. The primers T7-F and T7-R were verified by pET-22b vector bacterial liquid PCR (the system and procedure were the same as in Example 1(3), and the template was replaced with the bacterial liquid). The PCR product was tested for band size by agarose gel electrophoresis and sent to Generay for sequencing. Figure 1 B); T7-F: TAATACGACTCACTATAGGG; T7-R: GCTAGTTATTGCTCAGCGG; The correctly sequenced plasmid was named pET22b-ASADH2-JQ. The correctly sequenced DH5α strain was expanded to 50 mL of LB medium and incubated overnight. The recombinant plasmid was extracted using a plasmid extraction kit, transformed into Rosetta (DE3) competent cells (the method was the same as above), and the successfully transformed recombinant strain was preserved at -80°C with 50% glycerol. (2) Expression of enzyme ASADH2-JQ separated from plant Lactobacillus: the recombinant strain is named as recombinant strain JQ, activated in 5 mL LB culture medium containing ampicillin for 12 h, 1% of the bacterial liquid by volume is expanded to 50 mL LB culture medium containing ampicillin, cultured at 37°C, 180 rpm, until OD600 is about 0.4, then IPTG is added (the final concentration is 0.1 mM), and the culture is placed in a 12°C, 150 rpm shaking bed, and samples are taken at 0, 4, 8, 24 h (500 μL is taken); the OD600 of the sample is unified to 0.4, 40 μL of the bacterial liquid is taken, 10 μL of 4x protein loading buffer is added, and the total protein is dissolved in boiling water for 10 min, and 40 μL of the protein liquid is taken for SDS-PAGE to identify whether the target protein is expressed Figure 2 A); (3) WB verification of target protein: to confirm that the band in the broken supernatant is the target protein band, Western Blot (WB) is performed with His-tagged antibody, 20 μL of bacterial liquid of different induction times, broken liquid and broken supernatant are taken, 5 μL of 4x protein loading buffer is added, the total protein is dissolved in boiling water for 10 min, the cell fragments are precipitated by short centrifugation, 20 μL of the sample is taken for SDS-PAGE electrophoresis, after electrophoresis, the target protein on the gel is transferred to a PVDF membrane by wet transfer, the transfer conditions are 80V, 2h, after transfer, the membrane is immersed in TBST containing 5% skimmed milk powder for 1 hour; the membrane is washed with TBST for 5 min, repeated three times, and the blocking solution is removed; the rabbit anti-His monoclonal antibody is diluted with antibody diluent (reference manual, 1:2000), the membrane is incubated with the primary antibody at room temperature for 2h; the membrane is washed with TBST for 5 min, repeated three times, and the unbound antibody is removed; the mouse anti-rabbit secondary antibody is diluted with antibody diluent (reference manual, 1:5000), the membrane is incubated with the secondary antibody at room temperature for 1h; the membrane is washed with TBST for 3 times, 10 min each time, and the residual secondary antibody is completely removed; the ECL luminescent reagent is evenly coated on the surface of the membrane, and the light is avoided for 1 min, the chemical luminescence instrument is exposed for 20s to capture the target band Figure 2 B); (4) Enzyme purification: The recombinant strain JQ was induced at low temperature, and the bacterial cells were lysed on ice with a lysing solution to release the protein. The supernatant was obtained by centrifugation at 12,000 rpm for 30 min in a low-temperature centrifuge, filtered with a 0.45-μm filter membrane, and temporarily stored at 4°C. The supernatant was purified through a Ni-NTA column to obtain the target protein. A 5-mL preloaded gravity nickel column was fixed on a rack, and the protective solution was drained. Then, 2-3 times the column volume of the Lysis buffer (10 mM imidazole) was added to the column, and the solution was slowly drained and collected. If there was excess crude protein, it was added to the column again to increase the binding rate of the target protein to the nickel column. Then, 3-4 times the column volume of the Wash buffer (25 mM imidazole) was added to the column until no protein was present in the washing solution. Then, 2-3 times the column volume of the Elution buffer (250 mM imidazole) was added to the column to elute the target protein. The eluate was collected, and the process was repeated 4-5 times to ensure that the target protein was eluted. The purification effect was detected by SDS-PAGE, and a specific band was present near 45 kDa, which was the theoretical value of ASADH2-JQ (43 kDa). Because the pET-22b vector contained a pelB tag (2.2 kDa) and a His histidine tag (0.84 kDa), the SDS-PAGE gel result was about 3 kDa larger than the target gene. Therefore, the isolated and purified protein was considered to be the target protein JQ. Figure 2 C}.

[0019] Example 3 Verification of the degradation ability of ASADH2-JQ to PAT: The recombinant strain JQ was induced at low temperature, and after induction, the bacterial cells were collected by centrifugation, washed with PBS twice, resuspended with a small amount of PBS, and then 0.1 mM protease inhibitor cocktail was added at a ratio of 1:100 (v:v). The cells were broken by ultrasonic cell disrupter under ice bath conditions. The cell lysate was centrifuged at 4°C, 12000 rpm for 30 min, and the supernatant was collected as the crude enzyme solution of the recombinant strain JQ. The target proteinase in the crude enzyme solution was purified by nickel column, and the purified enzyme was collected by elution and filtered by 0.45 μm. The protein concentration was detected by protein concentration detection kit at 595 nm, and the protein concentration was unified to 1 mg / mL. 900 μL of crude enzyme solution was added with 100 μL of PAT solution to make the final concentration of PAT 5 mg / L. The control group was the recombinant strain pET-22b transformed with empty plasmid pET-22b, which was incubated at 37°C, 150 rpm for 12 h. The supernatant was collected by centrifugation, filtered by 0.22 μm, and then detected by HPLC for PAT residue. 900 μL of purified enzyme ASADH2-JQ was added with 100 μL of PAT solution to make the final concentration of PAT 5 mg / L, 10 mg / L, 20 mg / L, and 40 mg / L. The mixture was incubated at 37°C, 150 rpm for 12 h. The supernatant was collected by centrifugation, filtered by 0.22 μm, and then detected by HPLC for PAT residue.

[0020] The results showed that the crude enzyme solution of the recombinant strain JQ could effectively degrade PAT after 12 hours of co-incubation with PAT. The broken supernatant of the recombinant strain pET-22b had certain degradation effect on PAT, but the degradation effect was not as good as that of the crude enzyme solution of the recombinant strain JQ. Figure 3 A), ASADH2-JQ could completely degrade 5 mg / L of PAT after 12 hours of co-incubation with PAT. With the increase of PAT concentration, the PAT degradation rate decreased, but was higher than 80% Figure 3 B), indicating that ASADH2-JQ had high potential for PAT degradation.

[0021] Example 4 Identification of degradation products of PAT degraded by ASADH2-JQ: The purified protease of the recombinant strain JQ (protein final concentration 1 mg / mL) was co-incubated with PAT (final concentration 5 mg / L) at 37°C, 150 rpm for 24 h. The degradation products were extracted with equal volume of ethyl acetate, and the organic phase was collected after vigorous shaking for 10 min. The extraction was repeated 3 times, and the degradation products were redissolved in acetic acid aqueous solution after evaporation of ethyl acetate at 40°C. The results showed that the PAT standard appeared the highest peak (peak 1) at 6.4 min. Figure 4A), a new peak (peak 2) appeared after 12 hours of incubation of PAT with ASADH2-JQ, and the peak of PAT was not detected Figure 4 B), according to the literature, the retention time of the degradation product E / Z-ascladiol of PAT is shorter than that of PAT, so it is preliminarily judged that PAT may be converted into E / Z-ascladiol after enzymatic hydrolysis.

[0022] Example 5 Toxicity analysis of degradation products of PAT degraded by ASADH2-JQ: The HepG2 cell cryopreservation tube was taken out from liquid nitrogen, quickly shaken to melt in a 37°C water bath, and after the supernatant was discarded, the cell pellet was blown with 1-2ml of complete medium, and then transferred to a culture bottle containing 5mL of complete medium, and cultured in a 37°C, 5% CO2 incubator for 3-4h. After the cells adhered, the medium was changed and the cells were cultured to a density of about 80%. When the cells were subcultured, the old medium was aspirated, the cells were washed with 2mL of 1xPBS for 2-3 times, and then digested with 2mL of 0.25% trypsin. After 2min of standing, the digestion was terminated by adding complete medium containing serum, and the cells were blown off and transferred to a centrifuge tube. 200μL of cell suspension was added to a new culture dish containing 4.8mL of medium, and the cells were cultured to a density of about 80%. After three passages, logarithmic growth phase cells were used to seed 96-well plates, and after 24h of culture, different concentrations of PAT (2.5μg / mL, 10μg / mL) and degradation products (2.5μg / mL, 10μg / mL) were added for co-culture for 24h. After washing twice with PBS, MTT solution (final concentration 0.5mg / mL) was added for incubation for 12h. The supernatant was discarded and 150μL of DMSO was added for shaking for 10min. The OD 570 nm absorbance value to obtain the cell survival rate, with PBS as the control. The results showed that the cell survival of the PAT treatment group was the lowest compared with the PBS control, and the cell viability of the PAT degradation product treated by ASADH2-JQ was significantly higher than that of the PAT group (p<0.05); with the increase of concentration, the toxicity of the two degradation products and PAT to hepatoma cells was greater (Figure 5), so the toxicity of the enzyme degradation product was lower than that of PAT, but it was not completely non-toxic to cells. Studies have reported that low-concentration degradation product E / Z-ascladiol has very low toxicity to cells, and there is no significant difference with the PBS treatment group. The final degradation product is non-toxic to cells; the toxicity of the low-concentration degradation product of the present application to cells is significantly higher than that of the PBS treatment group (p<0.05), which may be due to the fact that PAT has not been completely degraded and extracted by ethyl acetate, or the residual organic solvent has an impact on the viability of the cells.

[0023] SEQ ID NO.1: SEQ ID NO. 2: VSGYNVAIVGATGAVGARMIKMVEQTSLPVNSVKLLASSRSAGKQLQFNGQALTVEETVPESFEGIDLALFSAGGSVSKKFAPEAVKRGAVVVDNTSAFRMDPKIPLVVPEVNPEALKLHHGIVANPNCSTIQMVVALEPVRKAFGLKRVIVSTYQAVGGAGNRALKELHDETEAYLKGEEMEAHILPVAGDKKHYPIAFNALPQIDVFEEDGYTHEEWKMIHETKKIMCGGDMDSKDIKVTATCVRIPVPVSHSESVYFEVEDPKATVKGIQDALAAAPGVVLQDDPDNQIYPQAHNAEGSKDTFVGRVRPDQETPQAFHMWNVSDNLLKGAAWNSVQIAETMDKMGLLHMQ

Claims

1. An enzyme gene A-1002321 isolated from Lactobacillus plantarum, the nucleotide sequence of which is shown in SEQ ID NO:

1.

2. An enzyme ASADH2-JQ isolated from Lactobacillus plantarum, the amino acid sequence of which is shown in SEQ ID NO:

2.

3. Use of an enzyme isolated from Lactobacillus plantarum in degrading patulin.

Images